The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP054657	Lactobacillus reuteri strain AN417 chromosome, complete genome	2069421	19421	78672	2069421	transposase,protease	Bacillus_phage(33.33%)	42	NA	NA
WP_016496345.1|19421_20642_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	43.3	4.2e-83
WP_003668074.1|21488_22457_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003675553.1|22863_24513_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.8	4.1e-110
WP_003675551.1|24857_25565_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.6	4.3e-40
WP_003675548.1|25578_27444_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	34.7	5.5e-34
WP_003675546.1|27421_28717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675544.1|28729_29572_+	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_174891748.1|29589_30396_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.1	4.3e-36
WP_174891749.1|30499_31780_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.3	6.2e-21
WP_174891750.1|31871_32381_+	phosphatidylglycerophosphatase A	NA	A0A291I9Q0	Lactobacillus_phage	51.9	1.4e-40
WP_003675538.1|32689_33676_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_035161733.1|34144_34624_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_003675532.1|34767_34986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675530.1|35053_35596_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003675528.1|35814_36987_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_019251835.1|37054_37831_-	VOC family protein	NA	NA	NA	NA	NA
WP_003675527.1|37832_38645_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003675525.1|38945_40319_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003675522.1|40494_41577_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003675520.1|41578_42277_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	2.6e-37
WP_063164305.1|42263_43499_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016496365.1|43638_44298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164136.1|44363_45332_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_041821552.1|45564_46959_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_016496976.1|48190_49141_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_086131695.1|49285_49672_-	OsmC family protein	NA	NA	NA	NA	NA
WP_016496411.1|49740_50664_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	5.1e-33
WP_003670244.1|50920_51142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174892014.1|51274_53497_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.8	1.6e-120
WP_174891751.1|54410_57287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079375840.1|57371_57998_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016496373.1|58095_59559_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_016496374.1|59673_63456_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_063164315.1|63455_67634_+	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.0	2.1e-17
WP_003675501.1|67634_68570_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003675500.1|68633_69812_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_016496437.1|70112_71531_+|transposase	ISLre2-like element ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_003670259.1|71701_73051_+	SLC45 family MFS transporter	NA	NA	NA	NA	NA
WP_003675498.1|73139_75392_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_174891752.1|75410_76073_+	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_003675493.1|76332_76953_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
WP_013923736.1|77541_78672_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
>prophage 2
NZ_CP054657	Lactobacillus reuteri strain AN417 chromosome, complete genome	2069421	115515	150189	2069421	tRNA,transposase	Bacillus_phage(25.0%)	32	NA	NA
WP_143455706.1|115515_116802_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_143455706.1|117070_118357_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_003668074.1|118576_119545_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003675442.1|119827_120079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675440.1|120175_120856_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.8	2.5e-29
WP_174891761.1|120852_122184_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	7.6e-22
WP_003675438.1|122288_122939_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_063164326.1|125100_125421_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_003675433.1|125546_126140_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003675432.1|126289_126970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675431.1|126971_127946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675430.1|128179_129052_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.2	2.1e-52
WP_003675429.1|129154_129640_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003675428.1|129698_130568_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003665145.1|131223_131427_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_174891762.1|131427_132288_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_035161724.1|132394_132934_+	phenolic acid decarboxylase	NA	NA	NA	NA	NA
WP_003675423.1|132976_133507_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_174892015.1|133509_134109_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_003670156.1|134208_135210_+	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_174891763.1|135267_136257_-	asparaginase	NA	NA	NA	NA	NA
WP_003675420.1|137328_138207_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.9	8.0e-52
WP_003669414.1|138307_138886_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016496408.1|140118_140763_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003669411.1|140868_141240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003669410.1|141341_142013_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_013923736.1|142057_143188_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
WP_143455706.1|143645_144932_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_174891764.1|145711_146392_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_174891765.1|146460_147759_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.5	1.3e-55
WP_016496414.1|147778_148789_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	43.4	5.5e-65
WP_016496411.1|149265_150189_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	5.1e-33
>prophage 3
NZ_CP054657	Lactobacillus reuteri strain AN417 chromosome, complete genome	2069421	157426	216720	2069421	tRNA,transposase	unidentified_phage(12.5%)	50	NA	NA
WP_016496411.1|157426_158350_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	5.1e-33
WP_016496417.1|158382_159696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035161715.1|159688_160141_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_035161712.1|160205_160808_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_174892016.1|160905_161226_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003675390.1|161343_162000_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_174891768.1|162180_162618_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003669379.1|162746_162980_+	cytochrome b5	NA	NA	NA	NA	NA
WP_003665104.1|163115_163334_+	cytochrome b5	NA	NA	NA	NA	NA
WP_003675383.1|163346_163592_+	cytochrome b5	NA	NA	NA	NA	NA
WP_016496424.1|163649_164786_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	45.5	6.0e-84
WP_003675378.1|165546_166503_+	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_081372314.1|166686_168081_-	amino acid permease	NA	NA	NA	NA	NA
WP_072575256.1|169611_170856_+	MFS transporter	NA	NA	NA	NA	NA
WP_016497187.1|171454_172168_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	36.1	3.8e-28
WP_142490569.1|172164_173016_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	25.2	8.9e-16
WP_174891769.1|173089_174895_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	32.1	6.0e-86
WP_016496430.1|175223_175907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142499187.1|176218_177595_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	39.5	2.3e-29
WP_171945898.1|177660_179301_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003665087.1|179825_180836_+	zinc-dependent alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.8	3.1e-07
WP_003675363.1|181097_181610_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_174891770.1|181620_182679_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003675359.1|182696_183383_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	7.2e-32
WP_086131509.1|183481_185464_+	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	40.7	1.9e-32
WP_003675355.1|185689_185926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675352.1|186028_186346_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_174891771.1|186473_188171_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	39.6	2.7e-24
WP_003675348.1|188597_189542_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.5	4.4e-16
WP_003675345.1|189673_189859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003675343.1|190084_190705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675341.1|190706_191903_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	34.8	3.4e-53
WP_003675339.1|192224_193502_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016496435.1|193623_194118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016496436.1|194221_194860_-	NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_086131511.1|195057_196443_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_174891772.1|196634_198053_+|transposase	ISLre2-like element ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_013923736.1|198349_199480_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
WP_003669331.1|199830_200487_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_003675328.1|200685_201267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003675327.1|201337_202549_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_003675325.1|202616_203471_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003675324.1|203633_204755_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_079376222.1|204910_207040_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.7	9.6e-160
WP_003665058.1|207165_207429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003675320.1|207560_208214_+	phosphoglycerate mutase family protein	NA	NA	NA	NA	NA
WP_003675317.1|209977_211387_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_035161696.1|211698_213027_-	purine permease	NA	Q9KX94	Enterobacteria_phage	30.8	3.5e-35
WP_016496447.1|213393_214827_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_142499022.1|214977_216720_+|transposase	IS1182 family transposase	transposase	A0A146ICT8	Staphylococcus_phage	39.5	1.2e-96
>prophage 4
NZ_CP054657	Lactobacillus reuteri strain AN417 chromosome, complete genome	2069421	378862	436994	2069421	transposase	Macacine_betaherpesvirus(33.33%)	43	NA	NA
WP_016496813.1|378862_380239_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	39.5	3.0e-29
WP_016496521.1|380501_381740_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_016496522.1|381810_382683_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_174892018.1|383196_384162_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_086131366.1|384555_385170_+	sugar permease	NA	NA	NA	NA	NA
WP_086131365.1|386267_386744_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_174891793.1|386859_387723_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_086131675.1|390386_391568_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_016496813.1|391670_393047_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	39.5	3.0e-29
WP_003674998.1|393313_393871_+	elongation factor P	NA	NA	NA	NA	NA
WP_003668074.1|394219_395188_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_086132486.1|395210_395921_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_063164373.1|396046_396919_+	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003674993.1|396923_397823_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_174891794.1|397822_398704_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_016496537.1|398714_399470_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.9	4.3e-14
WP_016496538.1|399480_400185_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003674981.1|403691_404831_+	beta-glucanase	NA	NA	NA	NA	NA
WP_003674979.1|404827_405589_-	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_174891795.1|405666_407439_-	oleate hydratase	NA	NA	NA	NA	NA
WP_003674975.1|407593_408937_+	Trk family potassium uptake protein	NA	NA	NA	NA	NA
WP_003664702.1|408929_409598_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_003674974.1|409615_410161_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_174891796.1|410428_411733_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_117115056.1|411735_412668_-	ferrochelatase	NA	NA	NA	NA	NA
WP_003664688.1|412975_413890_+	cysteine synthase family protein	NA	A0A1X9I5K7	Streptococcus_phage	41.4	5.7e-61
WP_174891797.1|414083_414623_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_174891798.1|414984_417204_+	choice-of-anchor A family protein	NA	NA	NA	NA	NA
WP_086141568.1|417274_418303_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_063164376.1|418482_419199_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_086132214.1|419293_420763_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	24.7	2.0e-23
WP_174891772.1|421079_422498_-|transposase	ISLre2-like element ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_086132595.1|422671_424189_+	YfcC family protein	NA	NA	NA	NA	NA
WP_003674958.1|424201_425536_+	Sapep family Mn(2+)-dependent dipeptidase	NA	NA	NA	NA	NA
WP_003674956.1|425832_427050_+	MFS transporter	NA	NA	NA	NA	NA
WP_003668877.1|427070_428528_+	sucrose phosphorylase	NA	NA	NA	NA	NA
WP_003674954.1|428680_429478_-	serine hydrolase	NA	NA	NA	NA	NA
WP_003674953.1|430748_431993_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_003668870.1|432332_432773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003674951.1|432849_433887_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_086141410.1|434004_434232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003674947.1|434255_435653_-	DUF2252 domain-containing protein	NA	NA	NA	NA	NA
WP_016496566.1|435833_436994_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	66.7	3.9e-147
>prophage 6
NZ_CP054657	Lactobacillus reuteri strain AN417 chromosome, complete genome	2069421	675725	759563	2069421	head,tail,transposase,plate,integrase,protease,portal,tRNA,terminase,capsid	Lactobacillus_phage(60.47%)	96	668776:668810	746818:746852
668776:668810	attL	GGGAGCGAGACAGAAGTCACTTGTGACTTCGTTTT	NA	NA	NA	NA
WP_003675835.1|675725_678146_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	68.5	0.0e+00
WP_003675833.1|678207_678471_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_016496675.1|678585_680235_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_174891820.1|680436_681723_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_003675829.1|681820_682681_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_035161886.1|682769_684173_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_003675826.1|684197_684710_+	universal stress protein	NA	NA	NA	NA	NA
WP_003675824.1|684798_685845_+	glucosaminidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	32.2	9.0e-10
WP_003664204.1|685879_686512_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	46.4	2.1e-46
WP_003675822.1|686727_687336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675820.1|687417_688434_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003675819.1|688490_689414_+	ribokinase	NA	NA	NA	NA	NA
WP_003668533.1|689531_689777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675817.1|689760_690438_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003664194.1|690781_691060_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_174891821.1|691304_692393_-|integrase	site-specific integrase	integrase	E9LUK6	Lactobacillus_phage	50.4	4.8e-99
WP_174891822.1|692480_693017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174891823.1|693104_693755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174891824.1|693823_694249_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M7RF74	Lactobacillus_phage	37.1	2.8e-10
WP_123835263.1|694245_694569_-	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	65.1	5.7e-32
WP_107721247.1|694720_694936_+	helix-turn-helix transcriptional regulator	NA	E9LUL5	Lactobacillus_phage	69.0	8.8e-21
WP_174891825.1|694963_695752_+	phage antirepressor KilAC domain-containing protein	NA	B8R674	Lactobacillus_phage	64.9	1.1e-87
WP_174891826.1|695763_696102_+	DUF771 domain-containing protein	NA	Q37943	Lactococcus_phage	51.5	7.6e-27
WP_174891827.1|696250_696436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174891828.1|696471_696699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174891829.1|696691_696961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174892021.1|696984_697626_+	ERF family protein	NA	A0A1S5SAA3	Streptococcus_phage	56.7	5.5e-34
WP_174891830.1|697618_697999_+	single-stranded DNA-binding protein	NA	G4KNN8	Staphylococcus_phage	29.1	3.8e-11
WP_174891831.1|698768_699608_+	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	36.7	3.2e-34
WP_174891832.1|699755_700283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174891833.1|700340_700853_+	DUF1064 domain-containing protein	NA	A0A1I9KKZ1	Lactobacillus_phage	54.4	1.1e-32
WP_174891834.1|700879_701359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086141608.1|701345_701534_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_174891744.1|701533_701806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174891835.1|702022_702292_+	hypothetical protein	NA	Q5ULN6	Lactobacillus_virus	50.6	4.6e-19
WP_174891836.1|702291_702543_+	hypothetical protein	NA	A0A2K9VC51	Lactobacillus_phage	50.6	4.0e-17
WP_174891837.1|702543_703290_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_174891838.1|703339_703534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174891839.1|703546_703990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174891840.1|704199_704715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174891841.1|706331_706604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174891842.1|706590_706743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174891843.1|706790_707294_+	HNH endonuclease	NA	B8R694	Lactobacillus_phage	37.7	1.4e-24
WP_174891844.1|707525_708065_+|terminase	phage terminase small subunit P27 family	terminase	A0A0M7REI3	Lactobacillus_phage	92.7	5.2e-86
WP_174892022.1|708090_709980_+|terminase	terminase large subunit	terminase	A0A0M7RDK9	Lactobacillus_phage	96.5	0.0e+00
WP_174891845.1|710156_711344_+|portal	phage portal protein	portal	A0A0M9JJ63	Lactobacillus_phage	96.2	1.2e-215
WP_174891846.1|711318_713226_+|capsid	phage major capsid protein	capsid	A0A0M7RF71	Lactobacillus_phage	88.0	6.2e-283
WP_174891847.1|713300_713570_+	hypothetical protein	NA	A0A0M7RDR5	Lactobacillus_phage	90.1	8.1e-32
WP_174892023.1|713553_713916_+|head	phage head closure protein	head	A0A0M7RFE1	Lactobacillus_phage	89.1	2.4e-55
WP_174891848.1|713908_714346_+	HK97 gp10 family phage protein	NA	A0A0M7RDL2	Lactobacillus_phage	94.4	5.0e-71
WP_174891849.1|714342_714732_+	DUF806 family protein	NA	A0A0M7RE53	Lactobacillus_phage	88.3	4.2e-61
WP_174891850.1|714735_715449_+|tail	phage tail protein	tail	A0A0M7RF39	Lactobacillus_phage	91.4	3.1e-123
WP_174891851.1|715521_715932_+	hypothetical protein	NA	A0A0M7REI9	Lactobacillus_phage	89.0	1.5e-61
WP_174891852.1|715991_716162_+	hypothetical protein	NA	A0A0M7RDM0	Lactobacillus_phage	90.9	6.9e-21
WP_174891853.1|719997_720843_+|tail	phage tail family protein	tail	A0A0B5CTY7	Listeria_phage	23.4	4.7e-09
WP_174891854.1|720842_722681_+|tail	phage tail protein	tail	E9LUJ4	Lactobacillus_phage	31.2	3.3e-39
WP_174891855.1|722670_722922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174891856.1|722931_723111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174891857.1|723107_724181_+|plate	BppU family phage baseplate upper protein	plate	E9LUJ9	Lactobacillus_phage	30.1	5.6e-23
WP_174891858.1|724193_724481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174891859.1|724480_724624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174891860.1|724592_726272_+	hypothetical protein	NA	A0A2P0ZL67	Lactobacillus_phage	30.7	4.1e-12
WP_174891861.1|726428_726809_+	hypothetical protein	NA	A0A0A1ENR5	Lactobacillus_phage	57.6	5.5e-34
WP_174891862.1|726969_727431_+	hypothetical protein	NA	A0A0A1ELI5	Lactobacillus_phage	43.1	5.0e-21
WP_174891863.1|727443_728373_+	SH3 domain-containing protein	NA	A0A0A1ERA5	Lactobacillus_phage	69.1	3.5e-130
WP_035168688.1|728540_728813_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_109913969.1|728878_729217_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A9D9Y1	Lactobacillus_prophage	45.3	9.6e-22
WP_174891864.1|729641_730037_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_079376116.1|730100_730460_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003675807.1|730462_730975_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_174891865.1|730956_731535_+	GTP cyclohydrolase I FolE	NA	A0A2I7S8W4	Vibrio_phage	41.3	6.4e-34
WP_003675803.1|731521_732781_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016496682.1|732770_733358_+	non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_003675799.1|733359_734523_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	24.2	8.8e-06
WP_016496683.1|734488_734824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003664174.1|734965_735238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164460.1|735423_736362_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003664171.1|736374_737190_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003675795.1|737550_739239_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.4	1.3e-71
WP_003675792.1|739406_741572_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_003675790.1|741620_741992_+	YlbF family regulator	NA	NA	NA	NA	NA
WP_003675789.1|742071_743256_+	DNA repair exonuclease	NA	A0A2H4UT91	Bodo_saltans_virus	26.4	9.9e-05
WP_016496685.1|743259_745752_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_003675786.1|745866_746802_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_003675785.1|746974_747205_-	hypothetical protein	NA	NA	NA	NA	NA
746818:746852	attR	GGGAGCGAGACAGAAGTCACTTGTGACTTCGTTTT	NA	NA	NA	NA
WP_016496686.1|747207_747642_-	HIT family protein	NA	D7NW73	Streptomyces_phage	31.3	1.9e-06
WP_003670839.1|747778_748516_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	2.9e-23
WP_086131533.1|748508_749711_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003675776.1|749723_750365_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016496689.1|751134_751641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174892024.1|751878_754257_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_174892025.1|755843_756824_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	28.5	7.4e-06
WP_016496694.1|756992_757913_-	glutaminase A	NA	NA	NA	NA	NA
WP_003675767.1|757963_758302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003664132.1|758466_758787_+	thioredoxin family protein	NA	J7KD15	Aeromonas_phage	35.8	2.0e-05
WP_003675765.1|758915_759563_+|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP054657	Lactobacillus reuteri strain AN417 chromosome, complete genome	2069421	809276	869893	2069421	tRNA,integrase,transposase,protease	Lactobacillus_prophage(15.38%)	59	828620:828639	853631:853650
WP_003675691.1|809276_810782_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L0I5	Tupanvirus	31.9	1.3e-09
WP_003675688.1|810894_812076_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003675687.1|812761_813613_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_086142601.1|814179_814584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086142602.1|814679_815864_-|integrase	site-specific integrase	integrase	A9D9I9	Lactobacillus_prophage	37.9	1.3e-60
WP_174891871.1|815914_816406_-	hypothetical protein	NA	D6PSS8	Lactobacillus_phage	27.8	3.3e-07
WP_086142711.1|816439_816823_-	helix-turn-helix domain-containing protein	NA	A0A075LYE4	Staphylococcus_phage	57.0	1.4e-16
WP_094542325.1|817320_817578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086142697.1|817589_817835_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_086142698.1|817865_818150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086142699.1|818164_819493_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_162606835.1|819516_819684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143454410.1|819820_820027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086878903.1|820037_820370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174891872.1|821002_821341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086142703.1|821364_821679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174891873.1|821693_822902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086142705.1|822918_823314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174891874.1|823325_823481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086132178.1|823637_824237_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	35.7	3.1e-23
WP_143449786.1|824173_825082_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_086142707.1|825434_825767_+	hypothetical protein	NA	S5MAA0	Brevibacillus_phage	40.3	4.7e-05
WP_086142708.1|825808_826144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086142709.1|826189_826726_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_086142712.1|826814_827738_+	hypothetical protein	NA	NA	NA	NA	NA
828620:828639	attL	ATTTTGGCGAAACTTTGAAA	NA	NA	NA	NA
WP_086118196.1|828884_829193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086118195.1|829194_829650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086118194.1|829681_830119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086118193.1|830158_832171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086118192.1|832274_832457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086118190.1|832873_833212_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A9D9Y1	Lactobacillus_prophage	48.6	9.6e-22
WP_086118189.1|833277_833550_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_086118188.1|833832_834375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174891875.1|834484_835498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086118186.1|835570_837889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172396917.1|837929_838100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086118185.1|838247_838685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086118184.1|838875_839799_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	1.0e-33
WP_086118183.1|840147_840807_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_086118182.1|840787_841465_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_086118181.1|841482_842223_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.2	1.4e-33
WP_086118180.1|842244_843102_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_174891876.1|843209_844133_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	1.9e-32
WP_086118125.1|844203_847026_+	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_086118124.1|847364_849296_+	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_086118123.1|849279_850347_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_086118122.1|850448_851366_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	45.3	5.0e-73
WP_086118121.1|851590_852166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086118120.1|852505_853501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174891877.1|853712_860969_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
853631:853650	attR	ATTTTGGCGAAACTTTGAAA	NA	NA	NA	NA
WP_174891878.1|861136_861631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153706039.1|861614_861845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172401352.1|862611_862818_+	NrdH-redoxin	NA	NA	NA	NA	NA
WP_174891879.1|862824_863976_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_174891880.1|864045_864531_-	helix-turn-helix domain-containing protein	NA	Q20DG0	Lactobacillus_phage	48.4	2.1e-09
WP_174891881.1|864729_866784_+	type IA DNA topoisomerase	NA	NA	NA	NA	NA
WP_174891882.1|866787_867600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102817005.1|867621_868041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174891883.1|868057_869893_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	36.7	2.2e-83
>prophage 8
NZ_CP054657	Lactobacillus reuteri strain AN417 chromosome, complete genome	2069421	907023	963508	2069421	tRNA,transposase,protease	Indivirus(18.18%)	59	NA	NA
WP_003664008.1|907023_907347_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003664006.1|907372_907654_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003675674.1|907779_908487_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_142499182.1|908499_909576_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_086118324.1|909577_910252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003663867.1|910341_910779_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003663865.1|910780_911197_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_003675667.1|911327_912188_+	hypothetical protein	NA	A0A249XZQ2	Enterococcus_phage	41.7	6.6e-35
WP_003675664.1|912180_913518_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	34.3	4.1e-39
WP_003675663.1|913519_913801_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_003675661.1|913819_914692_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_003668402.1|914703_915525_+	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_003675659.1|915543_915996_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003675657.1|916011_917691_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_003668397.1|917828_918179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003663856.1|918320_918941_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	33.0	6.5e-24
WP_003663855.1|918937_919156_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003675656.1|919266_920472_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.7	2.1e-42
WP_003675654.1|920472_922902_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_003675652.1|922919_923873_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	31.6	5.7e-11
WP_016496724.1|923862_925212_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_003675648.1|925219_925960_+	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_003675646.1|925963_927868_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1Q1PNS5	Noumeavirus	36.3	1.3e-17
WP_003675644.1|927880_928771_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_003663836.1|928781_929435_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_063164556.1|929520_930171_+	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_003663833.1|930320_930506_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_003663831.1|930700_931063_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003675642.1|931088_932798_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_086142170.1|932900_934937_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_003675638.1|934954_935986_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_003663823.1|936022_936277_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_003663822.1|936455_937157_+	ribonuclease III	NA	A0A1V0SDK0	Indivirus	35.3	4.0e-22
WP_174891910.1|937173_940737_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_003675634.1|940759_942286_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_003663818.1|942300_942642_+	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_003675632.1|942643_944089_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_003663816.1|944187_944463_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_003675631.1|944475_944736_+	KH domain-containing protein	NA	NA	NA	NA	NA
WP_086120478.1|944790_945297_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003663813.1|945296_946055_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_174891911.1|946065_947496_+	amino acid permease	NA	NA	NA	NA	NA
WP_003675625.1|947618_947978_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_086132178.1|948505_949105_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	35.7	3.1e-23
WP_143449786.1|949041_949950_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_174891912.1|950150_951119_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_072575358.1|951319_952606_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_003675622.1|952847_953072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035161845.1|953221_953554_+	DNA-binding protein	NA	M5AWB2	Nitratiruptor_phage	42.2	3.8e-15
WP_003675618.1|953556_954384_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	63.0	1.4e-98
WP_003675615.1|954435_954915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016496813.1|955215_956592_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	39.5	3.0e-29
WP_086120500.1|956659_957640_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_003675611.1|957720_958620_+	prenyltransferase	NA	NA	NA	NA	NA
WP_003675609.1|958655_959357_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_003675607.1|959377_960613_-	MFS transporter	NA	NA	NA	NA	NA
WP_003675605.1|960731_961610_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_003667006.1|961755_962025_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_174891913.1|962221_963508_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP054657	Lactobacillus reuteri strain AN417 chromosome, complete genome	2069421	968923	1047206	2069421	transposase	Lactococcus_phage(25.0%)	54	NA	NA
WP_016496813.1|968923_970300_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	39.5	3.0e-29
WP_016496743.1|982375_982600_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_063164569.1|983205_984213_+	sugar transferase	NA	NA	NA	NA	NA
WP_174891914.1|984232_985423_+	accessory Sec system protein translocase subunit SecY2	NA	NA	NA	NA	NA
WP_003675585.1|985425_986937_+	accessory Sec system protein Asp1	NA	NA	NA	NA	NA
WP_072574913.1|986948_988436_+	accessory Sec system protein Asp2	NA	NA	NA	NA	NA
WP_174891915.1|988438_989326_+	accessory Sec system protein Asp3	NA	NA	NA	NA	NA
WP_016496747.1|989329_991678_+	accessory Sec system translocase SecA2	NA	NA	NA	NA	NA
WP_174891916.1|991692_993231_+	accessory Sec system glycosyltransferase GtfA	NA	NA	NA	NA	NA
WP_003675575.1|993223_994549_+	accessory Sec system glycosylation chaperone GtfB	NA	NA	NA	NA	NA
WP_016496748.1|994541_994739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675573.1|994996_995545_+	serine-rich glycoprotein adhesin	NA	NA	NA	NA	NA
WP_142490509.1|995680_997414_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_142490597.1|997532_998222_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	50.0	2.9e-49
WP_063164572.1|998160_999381_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	44.3	4.0e-86
WP_174891917.1|999499_1000903_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_174891918.1|1001041_1002871_+	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_003663508.1|1002953_1003139_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_174891919.1|1003273_1004776_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_174891920.1|1004820_1005333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496755.1|1005365_1005602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124216391.1|1006717_1007719_+	LCP family protein	NA	NA	NA	NA	NA
WP_174891921.1|1007739_1008615_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_174891922.1|1008627_1009374_+	CpsD/CapB family tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	35.0	3.0e-23
WP_174891923.1|1009389_1010049_+	sugar transferase	NA	NA	NA	NA	NA
WP_174892027.1|1010107_1010557_+	UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase	NA	NA	NA	NA	NA
WP_174891924.1|1010566_1011061_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_174891925.1|1011375_1012245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174891926.1|1012259_1013306_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_174891927.1|1013277_1014279_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_174891928.1|1014280_1015738_+	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_174891929.1|1015718_1016687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174891930.1|1016689_1017850_+	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_174891931.1|1017853_1018675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174891932.1|1018681_1019410_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_174891933.1|1019435_1020488_+	NAD(P)-dependent oxidoreductase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	23.7	8.5e-08
WP_086118184.1|1020528_1021452_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	1.0e-33
WP_174891934.1|1021827_1022946_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	76.8	3.0e-168
WP_174891935.1|1023156_1024377_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	44.3	4.0e-86
WP_142490597.1|1024315_1025005_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	50.0	2.9e-49
WP_003676711.1|1025241_1026282_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	39.6	8.5e-61
WP_099979896.1|1028185_1029589_+	amino acid permease	NA	NA	NA	NA	NA
WP_016496796.1|1029667_1029925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041816984.1|1030322_1030721_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	3.0e-46
WP_174891936.1|1030720_1031896_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0ICY9	Lactobacillus_phage	55.7	1.0e-118
WP_003663560.1|1032257_1032500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174891937.1|1032681_1034577_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_174891938.1|1034641_1038127_+	DEAD/DEAH box helicase	NA	V9XTV7	Choristoneura_murinana_nucleopolyhedrovirus	26.7	1.5e-37
WP_003676694.1|1038222_1038999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174891939.1|1039151_1040054_+	glycoside hydrolase family 25	NA	A0A0A1ERA5	Lactobacillus_phage	54.9	6.8e-99
WP_003676691.1|1040206_1041325_+	exonuclease SbcCD subunit D	NA	J9PM68	Bacillus_phage	25.7	4.2e-05
WP_174891940.1|1041326_1044428_+	SMC family ATPase	NA	NA	NA	NA	NA
WP_072574974.1|1045064_1045742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174891941.1|1046075_1047206_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	32.5	5.1e-35
>prophage 10
NZ_CP054657	Lactobacillus reuteri strain AN417 chromosome, complete genome	2069421	1070050	1098917	2069421	integrase,transposase	Bacillus_phage(28.57%)	31	1085735:1085750	1099065:1099080
WP_010011610.1|1070050_1070929_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	2.0e-42
WP_003688751.1|1070952_1071240_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003673983.1|1071507_1071945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003673985.1|1071960_1072920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013923736.1|1073040_1074171_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
WP_174891951.1|1074345_1075365_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003673988.1|1075424_1076201_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	8.1e-16
WP_174892028.1|1076197_1077193_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_063164053.1|1077185_1077635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035161426.1|1077765_1078167_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_003667715.1|1078166_1078412_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_003667716.1|1078458_1079652_+	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_072574765.1|1079712_1080618_-	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_003663627.1|1080622_1081591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003663628.1|1081596_1081869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003673997.1|1081964_1082618_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_174891952.1|1082610_1083666_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003663631.1|1083816_1084101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667723.1|1084090_1084663_-	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_003674001.1|1084662_1085151_-	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_016496822.1|1085129_1086347_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
1085735:1085750	attL	TATTAAAGATCTTTCC	NA	NA	NA	NA
WP_016496823.1|1086336_1086834_-	MogA/MoaB family molybdenum cofactor biosynthesis protein	NA	NA	NA	NA	NA
WP_142490513.1|1086830_1087850_-	HesA/MoeB/ThiF family protein	NA	NA	NA	NA	NA
WP_003674008.1|1087995_1091661_+	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_003674010.1|1091650_1093210_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	42.2	9.3e-19
WP_003663647.1|1093202_1093781_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_003667738.1|1093773_1094463_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_174892029.1|1094579_1095800_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	23.9	2.5e-11
WP_013923736.1|1095840_1096971_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
WP_003674013.1|1097270_1098161_-	DMT family transporter	NA	NA	NA	NA	NA
WP_003663651.1|1098269_1098917_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	30.7	2.5e-18
1099065:1099080	attR	TATTAAAGATCTTTCC	NA	NA	NA	NA
>prophage 11
NZ_CP054657	Lactobacillus reuteri strain AN417 chromosome, complete genome	2069421	1114897	1175121	2069421	transposase	Staphylococcus_phage(23.08%)	56	NA	NA
WP_072575358.1|1114897_1116184_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_016496411.1|1116420_1117344_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	5.1e-33
WP_013923736.1|1117519_1118650_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
WP_063164071.1|1121075_1121432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003674047.1|1121565_1122213_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_003674050.1|1123148_1123421_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003674052.1|1123420_1123786_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_003674054.1|1124338_1124701_+	LapA family protein	NA	NA	NA	NA	NA
WP_016496837.1|1124721_1125558_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003674056.1|1125602_1126085_-	nucleoside 2-deoxyribosyltransferase	NA	A0A0A7DMT2	Lactobacillus_phage	65.6	8.2e-59
WP_174891954.1|1126160_1126316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003674059.1|1126317_1127181_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003674061.1|1127256_1127895_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_072574984.1|1127904_1128348_-	DUF3290 family protein	NA	NA	NA	NA	NA
WP_041821675.1|1128464_1128752_+	DUF454 family protein	NA	NA	NA	NA	NA
WP_072575358.1|1128861_1130148_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_003674065.1|1130294_1132619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003674068.1|1132797_1133652_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_016496839.1|1133761_1135153_-	amino acid permease	NA	NA	NA	NA	NA
WP_003674070.1|1135437_1136343_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003674072.1|1136382_1138158_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_072574989.1|1138325_1139576_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003663794.1|1139578_1140271_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_086131692.1|1140334_1142848_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	31.9	5.9e-132
WP_003663797.1|1142863_1143202_-	CrcB family protein	NA	A0A2H4PQR0	Staphylococcus_phage	34.2	4.2e-09
WP_003674077.1|1143194_1143572_-	CrcB family protein	NA	NA	NA	NA	NA
WP_003663799.1|1143679_1144072_+	VOC family protein	NA	NA	NA	NA	NA
WP_063164079.1|1144123_1144936_-	YdcF family protein	NA	NA	NA	NA	NA
WP_063164080.1|1144939_1146673_-	AarF/ABC1/UbiB kinase family protein	NA	C7U092	Ostreococcus_tauri_virus	26.1	5.6e-33
WP_003674080.1|1146812_1148174_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_143455706.1|1148300_1149587_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_003666232.1|1149754_1150183_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_003674082.1|1150337_1151726_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_003674084.1|1151774_1152230_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_174891955.1|1152301_1152766_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003674088.1|1152815_1153292_-	flavodoxin	NA	NA	NA	NA	NA
WP_003674090.1|1153334_1154219_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086135912.1|1154264_1155155_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.7	8.3e-57
WP_003666221.1|1155292_1155559_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_035160101.1|1157098_1157623_-	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	31.6	2.5e-13
WP_003674096.1|1157782_1158628_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003674098.1|1158601_1159450_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_086131689.1|1159548_1160205_+	HD domain-containing protein	NA	S4W232	Pandoravirus	26.3	3.8e-06
WP_003674102.1|1160268_1160913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086135911.1|1160909_1161788_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	36.6	7.8e-15
WP_086135910.1|1162004_1163687_+	NFACT family protein	NA	M1I5P2	Paramecium_bursaria_Chlorella_virus	38.0	1.2e-08
WP_086118341.1|1163735_1166213_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_086118342.1|1166209_1167295_-	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_086135909.1|1167371_1168283_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.7	1.9e-11
WP_086118343.1|1168286_1168733_-	signal peptidase II	NA	NA	NA	NA	NA
WP_003667861.1|1168733_1169141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003674114.1|1169165_1169561_+	ribonuclease HI family protein	NA	NA	NA	NA	NA
WP_174891956.1|1169744_1170899_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_174891957.1|1171060_1172443_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.3	1.0e-29
WP_086135998.1|1172959_1173436_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_072575358.1|1173834_1175121_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP054657	Lactobacillus reuteri strain AN417 chromosome, complete genome	2069421	1192729	1240428	2069421	integrase,transposase	Staphylococcus_phage(31.25%)	43	1238929:1238946	1241138:1241155
WP_174891963.1|1192729_1193905_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0ICY9	Lactobacillus_phage	55.4	1.0e-118
WP_174892030.1|1193904_1194303_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.1	8.6e-46
WP_086135861.1|1195252_1196131_+	ROK family protein	NA	NA	NA	NA	NA
WP_086135860.1|1196205_1197180_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003666171.1|1197207_1197948_-	LrgB family protein	NA	NA	NA	NA	NA
WP_003666169.1|1197940_1198360_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_003674135.1|1198561_1199293_-	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_041821694.1|1199273_1201037_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	29.8	4.7e-59
WP_003674137.1|1201037_1201904_-	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_079376029.1|1201922_1203290_-	RsmF rRNA methyltransferase first C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_079376032.1|1203434_1204247_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003666157.1|1204304_1204541_-	cytochrome b5	NA	NA	NA	NA	NA
WP_003674140.1|1205008_1205680_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003674141.1|1205873_1206764_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003667917.1|1206780_1207113_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_003674143.1|1207145_1208555_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_003674144.1|1208547_1209009_-	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_003674145.1|1208995_1210234_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	45.4	1.8e-105
WP_003674148.1|1210214_1211504_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003666143.1|1211515_1212313_-	Fe-S cluster assembly ATPase SufC	NA	A0A2R8FFL6	Cedratvirus	26.4	2.8e-11
WP_003674151.1|1212539_1212743_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_016496871.1|1212744_1214736_+	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_003667936.1|1214742_1214901_+	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
WP_086141193.1|1214966_1216388_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	34.4	2.4e-74
WP_003667939.1|1216402_1217224_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_003674156.1|1217256_1217631_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_016496874.1|1217978_1218554_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003667944.1|1218759_1219944_-	MFS transporter	NA	NA	NA	NA	NA
WP_174891964.1|1220112_1223001_+	YfhO family protein	NA	NA	NA	NA	NA
WP_086131402.1|1223074_1223800_+	potassium channel family protein	NA	A0A1B0Y2S3	Lactobacillus_phage	45.0	3.3e-27
WP_035157468.1|1223845_1224304_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.0	2.3e-26
WP_063164093.1|1224311_1225493_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.9	6.2e-92
WP_063164094.1|1225492_1226095_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.0	3.3e-33
WP_117114954.1|1226087_1227155_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	32.5	1.2e-41
WP_016496813.1|1227229_1228606_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	39.5	3.0e-29
WP_079376020.1|1228979_1229924_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_063164097.1|1230162_1231338_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0ICY9	Lactobacillus_phage	55.4	1.0e-118
WP_041816984.1|1231337_1231736_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	3.0e-46
WP_174891965.1|1232224_1234492_-	phospholipase	NA	NA	NA	NA	NA
WP_003667958.1|1234847_1235087_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_174891966.1|1235143_1238269_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	29.3	3.7e-67
WP_174892031.1|1238321_1238906_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
1238929:1238946	attL	ACTAAATTATCATTTATT	NA	NA	NA	NA
WP_174891967.1|1239459_1240428_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	28.6	1.1e-33
WP_174891967.1|1239459_1240428_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	28.6	1.1e-33
1241138:1241155	attR	ACTAAATTATCATTTATT	NA	NA	NA	NA
>prophage 13
NZ_CP054657	Lactobacillus reuteri strain AN417 chromosome, complete genome	2069421	1892159	1935911	2069421	tRNA,transposase,protease	Klosneuvirus(20.0%)	39	NA	NA
WP_003674580.1|1892159_1894187_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.2	1.0e-89
WP_003674578.1|1894264_1895113_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_003674572.1|1895562_1896261_-	NAD-dependent protein deacylase	NA	S5M4R0	Bacillus_phage	30.4	9.2e-19
WP_003674570.1|1896266_1897226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003674568.1|1897218_1898481_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_086131394.1|1898473_1899415_-	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_003674565.1|1899558_1900581_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003674562.1|1900858_1901818_+	site-specific DNA-methyltransferase	NA	A0A0H3UZ66	Geobacillus_virus	28.2	2.5e-14
WP_003665559.1|1901869_1902313_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	44.4	8.4e-26
WP_086131393.1|1902400_1904719_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_003674558.1|1904731_1905901_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_174892005.1|1906183_1907545_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.3	3.5e-22
WP_035161517.1|1907507_1908980_-	amino acid permease	NA	NA	NA	NA	NA
WP_003674553.1|1909277_1909919_+	endonuclease III	NA	NA	NA	NA	NA
WP_003674551.1|1909930_1910221_+	FMN-binding protein	NA	NA	NA	NA	NA
WP_174892006.1|1910302_1911499_-	MFS transporter	NA	A0A2H4UVM2	Bodo_saltans_virus	20.4	2.0e-05
WP_174892007.1|1911613_1912900_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_063164136.1|1913135_1914104_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003674547.1|1914244_1915177_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003671339.1|1915700_1916552_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003674545.1|1916564_1917629_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	1.9e-23
WP_003665503.1|1917621_1918311_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003674542.1|1918329_1919475_+	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_035161516.1|1919821_1921159_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_003674537.1|1921310_1921739_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_003674534.1|1921810_1922449_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003674533.1|1922441_1923212_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.0	4.3e-25
WP_003674531.1|1923186_1923852_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003674529.1|1923918_1924818_-	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016496437.1|1924953_1926372_-|transposase	ISLre2-like element ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_003674526.1|1926546_1927002_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_072575172.1|1927004_1927859_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_003674522.1|1928074_1929265_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_086131390.1|1929368_1931177_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	29.9	1.3e-69
WP_003674517.1|1931634_1932369_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_063164073.1|1932475_1933444_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003674515.1|1933523_1934228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667139.1|1934337_1934658_-	membrane protein	NA	NA	NA	NA	NA
WP_063164051.1|1934780_1935911_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.5	1.3e-35
>prophage 1
NZ_CP054658	Lactobacillus reuteri strain AN417 plasmid pAN417A, complete sequence	57676	7739	51913	57676	integrase,transposase	Bacillus_phage(23.53%)	55	11169:11185	53675:53691
WP_174892037.1|7739_8333_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	32.2	1.9e-17
WP_086132079.1|8515_9544_-	SHOCT domain-containing protein	NA	NA	NA	NA	NA
WP_174892038.1|9946_10540_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	50.5	9.2e-28
WP_063164136.1|10676_11645_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
11169:11185	attL	CACTTTGAAGCTGATAC	NA	NA	NA	NA
WP_174892039.1|11719_13429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174892040.1|13618_14098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174892041.1|14210_15446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174892070.1|15540_16479_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_174892042.1|16728_17979_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.1e-58
WP_174892043.1|18026_18509_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	53.0	4.5e-33
WP_174892044.1|18692_19040_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q708N9	Streptococcus_phage	46.8	1.7e-05
WP_142499496.1|19195_19546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010011610.1|19624_20503_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	2.0e-42
WP_003688751.1|20526_20814_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_087356023.1|21114_21444_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_174892045.1|21433_21694_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_174892046.1|22082_22382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174892047.1|22411_22699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174892048.1|22740_22977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072574785.1|23015_23243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170090834.1|23272_23752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174892049.1|23771_23945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079376332.1|23976_24186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174892050.1|24191_24374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174892051.1|24399_25257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174892052.1|25321_25657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174892053.1|25680_25956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086120079.1|25980_26307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019253554.1|26331_26511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174892054.1|26586_26868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019253558.1|27257_27467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174892055.1|27527_28076_-	hypothetical protein	NA	A0A0A7NU68	Lactobacillus_phage	65.9	2.0e-61
WP_174892056.1|28116_28545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174892057.1|28578_29103_-	antirestriction protein ArdA	NA	A0A142F1K6	Bacillus_phage	28.8	1.2e-10
WP_174892058.1|29167_29371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174892059.1|30497_30719_-	hypothetical protein	NA	D2KRD0	Lactobacillus_phage	40.3	3.1e-05
WP_142499461.1|33782_34124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016497270.1|34136_35345_-	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_142499463.1|36217_36625_-	replication-associated protein RepC	NA	NA	NA	NA	NA
WP_142499465.1|36628_37585_-	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	36.2	3.9e-44
WP_174892060.1|38359_39448_+	replication protein, repA	NA	NA	NA	NA	NA
WP_174892061.1|39795_40521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174892062.1|40606_41269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016497263.1|41374_41641_+	HU family DNA-binding protein	NA	A0A075E147	Dickeya_phage	35.3	2.0e-06
WP_072574806.1|41864_42995_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.3	6.7e-35
WP_174892063.1|43291_44257_+|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	30.7	9.5e-14
WP_174892064.1|44304_44466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174892065.1|44462_44870_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	29.9	4.0e-06
WP_102816977.1|44866_45226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016058040.1|45368_45830_-	GNAT family N-acetyltransferase	NA	E9LUK4	Lactobacillus_phage	100.0	1.7e-82
WP_174892066.1|45929_46412_-	helix-turn-helix domain-containing protein	NA	H7BUM7	unidentified_phage	41.5	9.5e-07
WP_086142426.1|46848_48000_+	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_056936359.1|48945_49923_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_086136127.1|50082_50511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174892067.1|50989_51913_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	41.0	2.1e-50
53675:53691	attR	CACTTTGAAGCTGATAC	NA	NA	NA	NA
