The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP054715	Salmonella enterica strain 85-0120 chromosome, complete genome	4794154	449331	468560	4794154	portal,protease,terminase,integrase,holin	Escherichia_phage(33.33%)	25	456912:456925	472418:472431
WP_174895024.1|449331_449706_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.2	2.8e-14
WP_174895025.1|450351_451887_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	63.1	8.2e-177
WP_000196423.1|451883_452090_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	48.6	1.1e-07
WP_174895026.1|452086_454195_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	70.4	8.0e-292
WP_000348549.1|454181_454673_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	57.5	4.5e-44
WP_126487362.1|455066_455603_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_174895027.1|455599_456217_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	82.3	9.1e-95
WP_001527046.1|456219_456564_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
456912:456925	attL	ATGATATATTTTCT	NA	NA	NA	NA
WP_174896633.1|457230_458064_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_174895028.1|458354_459191_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	83.3	2.6e-124
WP_174895029.1|459187_460048_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPA6	Escherichia_phage	83.9	1.9e-135
WP_000105297.1|461843_462500_+	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	74.8	8.2e-94
WP_115267537.1|462639_462837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085336127.1|462839_463031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000129880.1|463104_463299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000155900.1|463295_463481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079832474.1|463668_463878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174895030.1|463801_464218_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	55.7	1.4e-27
WP_174894859.1|464217_464418_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	69.8	1.6e-13
WP_174895031.1|464448_465354_+	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	77.6	8.3e-129
WP_174895032.1|465350_465917_+	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	38.3	7.5e-27
WP_079918440.1|465913_466138_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	64.8	4.3e-18
WP_174895033.1|466134_466347_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	77.1	9.9e-25
WP_174895034.1|466343_466805_+	ATPase	NA	A0A1B5FPC7	Escherichia_phage	52.2	3.0e-42
WP_174895035.1|467354_468560_-|integrase	tyrosine-type recombinase/integrase	integrase	A5LH57	Enterobacteria_phage	84.5	8.3e-209
472418:472431	attR	ATGATATATTTTCT	NA	NA	NA	NA
>prophage 2
NZ_CP054715	Salmonella enterica strain 85-0120 chromosome, complete genome	4794154	985320	1036995	4794154	protease,plate,head,capsid,integrase,tail	Cronobacter_phage(64.71%)	46	1015945:1015961	1033341:1033357
WP_000208241.1|985320_985851_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_174895235.1|985860_987192_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	1.9e-44
WP_174895236.1|987258_988188_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872918.1|988280_988766_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000051370.1|988987_989227_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084285.1|989625_990471_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000136809.1|990491_992000_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250617.1|992111_993122_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_174895237.1|993218_993965_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000155239.1|994071_994500_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802237.1|994600_995197_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216335.1|995309_996077_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_174895238.1|996168_996933_-	epimerase	NA	NA	NA	NA	NA
WP_001543603.1|996942_997233_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774146.1|997315_998191_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_174895239.1|998219_999242_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000981826.1|999270_1000272_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911134.1|1000268_1001312_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001167250.1|1001305_1002841_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_001283049.1|1003096_1004056_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_174895240.1|1004142_1005735_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001173081.1|1005748_1006099_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000061014.1|1006335_1006500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174895241.1|1006597_1007320_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_174895242.1|1007382_1008423_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_174895243.1|1008432_1009392_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_174895244.1|1009402_1010737_-	MFS transporter	NA	NA	NA	NA	NA
WP_174895245.1|1011001_1011757_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000758724.1|1011857_1012847_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591793.1|1013011_1013974_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_002954865.1|1014157_1015060_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_174895246.1|1015417_1016170_-	peptide transporter	NA	NA	NA	NA	NA
1015945:1015961	attL	TGATATCCTGCGCGTTA	NA	NA	NA	NA
WP_174895247.1|1018647_1018902_+|integrase	integrase	integrase	S4TP66	Salmonella_phage	82.3	3.0e-20
WP_174895248.1|1020508_1022212_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	80.9	2.4e-222
WP_174895249.1|1022727_1023453_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.8	5.0e-68
WP_174896649.1|1023442_1023997_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	87.3	1.1e-88
WP_174895250.1|1026129_1026717_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	6.4e-90
WP_174895251.1|1026709_1027894_-|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.9	1.5e-178
WP_001002797.1|1027890_1028220_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_174895252.1|1028216_1030184_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.5	1.9e-266
WP_023185862.1|1030774_1031107_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.6e-35
WP_000175560.1|1031106_1031448_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_079892356.1|1032202_1033330_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.2	1.2e-174
WP_079895316.1|1034503_1034956_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.0	4.7e-48
1033341:1033357	attR	TGATATCCTGCGCGTTA	NA	NA	NA	NA
WP_079895315.1|1035049_1035241_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	55.4	8.1e-10
WP_058673815.1|1035966_1036995_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.3	7.5e-134
>prophage 3
NZ_CP054715	Salmonella enterica strain 85-0120 chromosome, complete genome	4794154	1041265	1050223	4794154	integrase	Enterobacteria_phage(37.5%)	10	1028583:1028597	1049315:1049329
1028583:1028597	attL	CAGCAGATTAATAAA	NA	NA	NA	NA
WP_080171132.1|1041265_1041634_-	DUF2528 family protein	NA	K7PGR6	Enterobacteria_phage	52.1	3.0e-29
WP_174895253.1|1041698_1044395_-	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	47.0	5.5e-237
WP_174895254.1|1044654_1045215_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	34.1	2.7e-21
WP_174895255.1|1045224_1045557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048227709.1|1045559_1045829_-	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	55.6	2.0e-22
WP_174895256.1|1045930_1046251_+	helix-turn-helix transcriptional regulator	NA	A0A0U4ISL7	Pseudomonas_phage	36.8	3.4e-08
WP_174895257.1|1046335_1047319_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	67.3	6.1e-125
WP_001233471.1|1047503_1048004_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_001033731.1|1048154_1048853_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580433.1|1048849_1050223_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	1.1e-15
1049315:1049329	attR	TTTATTAATCTGCTG	NA	NA	NA	NA
>prophage 4
NZ_CP054715	Salmonella enterica strain 85-0120 chromosome, complete genome	4794154	2379967	2490585	4794154	portal,tRNA,capsid,head,transposase,plate,terminase,integrase,tail	Cronobacter_phage(28.57%)	96	2385643:2385659	2464403:2464421
WP_071651506.1|2379967_2380120_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	78.1	1.0e-07
WP_079816476.1|2380182_2380953_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	27.8	3.0e-10
WP_174895092.1|2382336_2383484_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	90.7	3.6e-145
WP_174895702.1|2384582_2385695_+	His-Xaa-Ser system radical SAM maturase HxsC	NA	NA	NA	NA	NA
2385643:2385659	attL	ATTTCAGTTCATCAAAA	NA	NA	NA	NA
WP_174895703.1|2385691_2386294_+	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
2385643:2385659	attL	ATTTCAGTTCATCAAAA	NA	NA	NA	NA
WP_174895704.1|2386384_2388415_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_174895705.1|2388411_2390094_+	ATP-dependent helicase	NA	A0A1P8CWU5	Bacillus_phage	24.9	3.8e-10
WP_174895706.1|2390626_2391523_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_174895707.1|2391519_2392416_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_174895708.1|2392405_2393962_-	recombinase family protein	NA	Q9XJF6	Enterococcus_phage	26.9	8.4e-12
WP_174895709.1|2394244_2395474_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	87.3	8.4e-209
WP_047748625.1|2396022_2396361_+	hypothetical protein	NA	J9Q6E9	Salmonella_phage	36.9	7.1e-09
WP_079916824.1|2396372_2397140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174894878.1|2397247_2398606_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	39.7	2.2e-85
WP_079916823.1|2398791_2399970_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	94.6	3.9e-211
WP_174895710.1|2400502_2400964_-	ATPase	NA	A0A1B5FPC7	Escherichia_phage	51.2	7.4e-41
WP_174895711.1|2400960_2401173_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	77.1	6.4e-24
WP_079918440.1|2401169_2401394_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	64.8	4.3e-18
WP_174895712.1|2401390_2401957_-	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	38.9	6.8e-28
WP_174895713.1|2401953_2402820_-	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	76.1	1.7e-126
WP_174895714.1|2402819_2403101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174895715.1|2403100_2403514_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	68.6	8.6e-49
WP_174895716.1|2403571_2405122_+	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	86.5	1.6e-260
WP_023237658.1|2405118_2406087_+	toprim domain-containing protein	NA	A0A1B5FPA8	Escherichia_phage	95.3	3.2e-179
WP_174895717.1|2406086_2406947_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPA6	Escherichia_phage	84.6	6.0e-137
WP_174895718.1|2406943_2407780_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	80.4	4.2e-127
WP_001533567.1|2407911_2408598_-	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	98.2	1.1e-130
WP_174895719.1|2411413_2411944_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	77.1	4.9e-73
WP_174895720.1|2411995_2413126_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	36.9	7.6e-39
WP_174895721.1|2413510_2413897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024172626.1|2413896_2414367_-	SocA family protein	NA	D0UIM3	Aggregatibacter_phage	44.5	7.1e-23
WP_174895722.1|2414627_2414867_-	DinI family protein	NA	K7P797	Enterobacteria_phage	94.8	3.8e-33
WP_001518569.1|2417041_2417524_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242604.1|2417673_2418150_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|2418139_2418430_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203442.1|2418591_2418930_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_174895723.1|2419078_2420740_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_174895724.1|2420825_2421704_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_023187382.1|2421827_2422421_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_127172650.1|2422481_2423768_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|2423787_2424579_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_174895725.1|2424744_2426106_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|2426358_2426607_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|2426625_2427174_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469807.1|2427344_2428112_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|2428152_2428500_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_174895726.1|2429155_2430226_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	8.1e-91
WP_174895727.1|2430235_2431357_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_174895464.1|2431546_2432905_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	39.7	2.2e-85
WP_174895728.1|2433024_2433933_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200082.1|2433893_2435054_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|2435153_2435201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174895729.1|2435365_2436358_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	54.8	5.0e-103
WP_174895730.1|2436457_2436760_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	56.0	5.9e-23
WP_148977804.1|2436855_2437182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174895731.1|2437212_2437545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174895732.1|2437554_2438115_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	35.5	7.2e-22
WP_174895733.1|2438374_2441071_+	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	47.1	3.8e-238
2440210:2440226	attR	TTTTGATGAACTGAAAT	NA	NA	NA	NA
WP_080171132.1|2441135_2441504_+	DUF2528 family protein	NA	K7PGR6	Enterobacteria_phage	52.1	3.0e-29
2440210:2440226	attR	TTTTGATGAACTGAAAT	NA	NA	NA	NA
WP_174895734.1|2441570_2441840_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	80.7	6.0e-35
WP_023187394.1|2441893_2442913_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	68.8	3.0e-135
WP_031603163.1|2444903_2445743_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.0	4.8e-46
WP_058673815.1|2445777_2446806_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.3	7.5e-134
WP_079895314.1|2446817_2447516_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	51.7	2.2e-60
WP_079895315.1|2447534_2447726_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	55.4	8.1e-10
WP_079895316.1|2447819_2448272_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.0	4.7e-48
WP_000175560.1|2451326_2451668_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_023185862.1|2451667_2452000_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.6e-35
WP_000411498.1|2452146_2452404_+|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	61.0	3.1e-20
WP_001002797.1|2454553_2454883_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_174895251.1|2454879_2456064_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.9	1.5e-178
WP_174895735.1|2456652_2458764_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	78.7	2.0e-149
WP_174896673.1|2458776_2459331_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	87.8	2.0e-88
WP_174895736.1|2459320_2460046_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.8	3.8e-68
WP_174895737.1|2460017_2460563_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.5	3.2e-59
WP_174895738.1|2460562_2462266_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	80.9	4.1e-222
WP_174895739.1|2463878_2464307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|2464447_2464786_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197658.1|2465057_2465795_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|2465926_2466907_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_174895740.1|2466903_2467635_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235096.1|2467764_2470338_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	6.9e-128
WP_000985653.1|2476394_2476850_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_174895741.1|2476953_2478255_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.1	1.0e-42
WP_001264473.1|2478251_2478575_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_174896674.1|2478619_2479975_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_174895742.1|2480089_2482750_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_023194661.1|2482803_2483484_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098732.1|2483556_2483976_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|2484179_2485217_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|2485332_2486022_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|2486340_2486724_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_174895743.1|2486785_2487364_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000365861.1|2487466_2488366_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_174895744.1|2488383_2489718_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.2e-43
WP_174895745.1|2489847_2490585_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP054715	Salmonella enterica strain 85-0120 chromosome, complete genome	4794154	2945769	3076956	4794154	portal,capsid,head,plate,lysis,transposase,terminase,tail,integrase,tRNA,holin	Cronobacter_phage(36.73%)	113	2958145:2958162	3001919:3001936
WP_000989296.1|2945769_2946465_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000045719.1|2946461_2946860_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_000024658.1|2946991_2947900_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000194222.1|2948025_2949384_+	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_174895901.1|2949395_2950433_+	gentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_174895902.1|2950448_2951150_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_094964397.1|2951158_2951803_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_000150099.1|2951817_2953011_+	3-hydroxybenzoate 6-monooxygenase	NA	NA	NA	NA	NA
WP_001264834.1|2953119_2954058_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_000698460.1|2954115_2954199_-	protein YohP	NA	NA	NA	NA	NA
WP_174895903.1|2954516_2955953_+	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000169608.1|2956018_2956780_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001523476.1|2956827_2957397_-	DedA family protein	NA	NA	NA	NA	NA
WP_001017057.1|2957555_2958143_+	YIP1 family protein	NA	NA	NA	NA	NA
2958145:2958162	attL	GCGAAAAAGGGCTGGCGC	NA	NA	NA	NA
WP_000911555.1|2958308_2959256_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_174895904.1|2959314_2961045_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_174895905.1|2961300_2963598_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_171775276.1|2963778_2964696_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_174895906.1|2964699_2965866_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_079823561.1|2965858_2966806_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	2.2e-23
WP_174895907.1|2966789_2967521_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001234242.1|2967501_2967609_-	protein YohO	NA	NA	NA	NA	NA
WP_079804825.1|2967668_2968400_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	88.4	5.9e-101
WP_174895908.1|2968622_2970311_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	90.8	1.0e-273
WP_079804826.1|2970303_2971023_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_174895909.1|2971074_2971545_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	85.3	3.5e-70
WP_174895910.1|2971669_2972128_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	71.2	5.4e-52
WP_174895911.1|2972368_2974402_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	3.6e-55
WP_174895912.1|2974566_2975676_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_000760402.1|2975953_2976235_+	YehE family protein	NA	NA	NA	NA	NA
WP_174895913.1|2977105_2977786_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_174895914.1|2977798_2980279_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_174895915.1|2980288_2981302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000837539.1|2981354_2981669_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_076009991.1|2982078_2982867_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822241.1|2982863_2983664_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_174895916.1|2983700_2984447_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_174895917.1|2984420_2985386_-	sugar kinase	NA	NA	NA	NA	NA
WP_000642803.1|2985382_2986387_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_174895918.1|2986383_2987655_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129591.1|2987908_2988961_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_174895919.1|2989013_2989913_-	lipid kinase YegS	NA	NA	NA	NA	NA
WP_174895920.1|2991070_2991487_+	CesT family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_174895921.1|2991912_2992926_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	89.6	8.3e-178
WP_080171139.1|2993041_2993341_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	85.9	2.3e-43
WP_080171138.1|2993458_2993734_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	81.3	1.5e-41
WP_080171136.1|2994071_2994632_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	33.5	7.9e-21
WP_174895253.1|2994891_2997588_+	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	47.0	5.5e-237
WP_080171132.1|2997652_2998021_+	DUF2528 family protein	NA	K7PGR6	Enterobacteria_phage	52.1	3.0e-29
WP_174895922.1|2998089_2998359_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	79.5	1.7e-34
WP_174895923.1|2998412_2999432_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	68.5	3.9e-135
WP_174895924.1|2999428_3001213_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.5	1.3e-247
WP_058673815.1|3002296_3003325_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.3	7.5e-134
3001919:3001936	attR	GCGAAAAAGGGCTGGCGC	NA	NA	NA	NA
WP_079895314.1|3003336_3004035_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	51.7	2.2e-60
WP_079895315.1|3004053_3004245_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	55.4	8.1e-10
WP_079895316.1|3004338_3004791_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.0	4.7e-48
WP_079895317.1|3004787_3005270_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	8.8e-37
WP_174895925.1|3005266_3005971_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.1	1.5e-69
WP_079892356.1|3005967_3007095_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.2	1.2e-174
WP_023185863.1|3007091_3007547_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.3e-58
WP_001154426.1|3007559_3007856_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_000175560.1|3007852_3008194_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_023185862.1|3008193_3008526_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.6e-35
WP_000411498.1|3008672_3008930_+|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	61.0	3.1e-20
WP_001002797.1|3011080_3011410_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_174895926.1|3011406_3012591_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.6	8.8e-179
WP_174895250.1|3012583_3013171_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	6.4e-90
WP_174896649.1|3015302_3015857_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	87.3	1.1e-88
WP_174895249.1|3015846_3016572_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.8	5.0e-68
WP_023185855.1|3016543_3017089_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.5	1.9e-59
WP_174895738.1|3017088_3018792_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	80.9	4.1e-222
WP_174895927.1|3020403_3020832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001517981.1|3021095_3022457_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	95.4	2.3e-207
WP_000137927.1|3022596_3023319_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	6.4e-31
WP_000870068.1|3023315_3024719_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	2.1e-30
WP_174895928.1|3024718_3026131_-	MFS transporter	NA	NA	NA	NA	NA
WP_174895929.1|3026127_3029208_-	multidrug efflux RND transporter permease subunit MdtC	NA	S5VTK5	Leptospira_phage	22.9	4.9e-64
WP_174895930.1|3029208_3032331_-	multidrug efflux RND transporter permease subunit MdtB	NA	NA	NA	NA	NA
WP_079804763.1|3032330_3033572_-	multidrug efflux RND transporter subunit MdtA	NA	NA	NA	NA	NA
WP_074430376.1|3033854_3033914_+	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_174895931.1|3034012_3035365_-	molecular chaperone	NA	NA	NA	NA	NA
WP_079823546.1|3035498_3036368_+	DNA-3-methyladenine glycosylase 2	NA	NA	NA	NA	NA
WP_174895932.1|3036335_3039323_-	MASE1 domain-containing protein	NA	NA	NA	NA	NA
WP_000132082.1|3039653_3040295_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	2.5e-34
WP_079804710.1|3040385_3040967_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.6	1.6e-32
WP_174895933.1|3041005_3042862_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_174895934.1|3042947_3044528_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	8.2e-39
WP_079804714.1|3045201_3046341_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000482224.1|3046346_3046796_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_174895935.1|3046792_3048952_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.8	5.4e-17
WP_000205695.1|3049038_3049881_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	NA	NA	NA	NA
WP_000888724.1|3049883_3050372_+	colanic acid biosynthesis acetyltransferase WcaB	NA	NA	NA	NA	NA
WP_174895936.1|3050368_3051586_+	colanic acid biosynthesis glycosyltransferase WcaC	NA	NA	NA	NA	NA
WP_000091392.1|3051560_3052775_+	putative colanic acid polymerase WcaD	NA	NA	NA	NA	NA
WP_174895937.1|3052787_3053534_+	colanic acid biosynthesis glycosyltransferase WcaE	NA	NA	NA	NA	NA
WP_001153600.1|3053549_3054104_+	colanic acid biosynthesis acetyltransferase WcaF	NA	NA	NA	NA	NA
WP_000048166.1|3054127_3055249_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.5	5.3e-133
WP_071650738.1|3055251_3056217_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.5	3.5e-85
WP_071650739.1|3056219_3056693_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_023187279.1|3056689_3057913_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_174895938.1|3057909_3059352_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.5	7.2e-50
WP_079807452.1|3060884_3062279_+	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_174895939.1|3062280_3063759_+	colanic acid undecaprenyl disphosphate flippase WzxC	NA	NA	NA	NA	NA
WP_174895940.1|3063820_3065101_+	colanic acid biosynthesis pyruvyl transferase WcaK	NA	NA	NA	NA	NA
WP_174895941.1|3065097_3066318_+	colanic acid biosynthesis glycosyltransferase WcaL	NA	NA	NA	NA	NA
WP_001111207.1|3066328_3067732_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.6e-20
WP_071650745.1|3067908_3068802_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	3.6e-44
WP_174895942.1|3069137_3070268_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_174895943.1|3070413_3071850_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	30.4	1.1e-55
WP_174895944.1|3071945_3073313_+	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	26.5	1.4e-31
WP_174895945.1|3073309_3074596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174896681.1|3074651_3075803_+	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
WP_174895765.1|3075918_3076956_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP054715	Salmonella enterica strain 85-0120 chromosome, complete genome	4794154	3098128	3149698	4794154	tail,transposase,integrase	Salmonella_phage(33.33%)	36	3127620:3127637	3157599:3157616
WP_174894878.1|3098128_3099487_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	39.7	2.2e-85
WP_111722124.1|3099640_3101071_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_171775225.1|3101246_3102428_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4QX09	Salmonella_phage	91.1	6.4e-214
WP_174895958.1|3102408_3102600_-	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	79.0	7.0e-22
WP_174895959.1|3102889_3103333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174895960.1|3103361_3103613_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_174895961.1|3103824_3104394_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	85.2	3.1e-89
WP_174895962.1|3104596_3105115_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_174895963.1|3105163_3105433_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023239910.1|3105472_3105649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174895964.1|3106632_3108909_+	thiosulfate reductase PhsA	NA	NA	NA	NA	NA
WP_001016228.1|3108923_3109502_+	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	37.6	1.9e-22
WP_174895965.1|3109498_3110263_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_174895966.1|3110386_3111559_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	87.1	9.9e-199
WP_079804755.1|3111704_3112172_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_079804756.1|3112290_3113349_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450405.1|3113592_3113928_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_174895967.1|3114626_3116078_+	cobyric acid synthase	NA	NA	NA	NA	NA
WP_174895968.1|3116255_3117185_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_174895969.1|3117890_3120791_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_171774052.1|3123378_3123546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023186591.1|3123597_3123732_-	ash family protein	NA	NA	NA	NA	NA
WP_174895092.1|3126471_3127618_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	90.7	3.6e-145
3127620:3127637	attL	ATTATCCGTGGCGATTCA	NA	NA	NA	NA
WP_174895970.1|3127638_3131403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174895971.1|3131482_3132415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174895972.1|3132418_3133414_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_174895973.1|3134490_3135378_+|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_174895974.1|3136789_3137827_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_174895975.1|3137836_3138796_-	DMT family transporter	NA	NA	NA	NA	NA
WP_174895976.1|3138917_3140414_-	acyl--CoA ligase	NA	NA	NA	NA	NA
WP_174895974.1|3140988_3142026_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_174895977.1|3142223_3143219_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_174895978.1|3143368_3144247_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_174895979.1|3145021_3146212_-|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.5	1.8e-70
WP_174896683.1|3146584_3148036_-	EmmdR/YeeO family multidrug/toxin efflux MATE transporter	NA	NA	NA	NA	NA
WP_174895980.1|3148435_3149698_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.2	9.0e-73
3157599:3157616	attR	TGAATCGCCACGGATAAT	NA	NA	NA	NA
>prophage 7
NZ_CP054715	Salmonella enterica strain 85-0120 chromosome, complete genome	4794154	3943764	4001543	4794154	tRNA,holin,transposase,bacteriocin	Escherichia_phage(21.43%)	58	NA	NA
WP_162007618.1|3943764_3944283_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_000272241.1|3944279_3944387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174896282.1|3944593_3945040_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_174896283.1|3945019_3945814_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_174896284.1|3945914_3947099_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_001222527.1|3947217_3947565_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000487128.1|3947550_3947862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000673492.1|3947930_3948182_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001589065.1|3948377_3948476_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_000512149.1|3948614_3948863_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000762776.1|3949177_3949819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513733.1|3950048_3950231_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_001248993.1|3950233_3950596_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457190.1|3950768_3951407_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_174896285.1|3951602_3952148_-	chorismate mutase	NA	NA	NA	NA	NA
WP_001524298.1|3952230_3952386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000208086.1|3952464_3952713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000190263.1|3952967_3953816_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001562706.1|3953884_3954478_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_086776411.1|3954622_3955411_-	cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9)	NA	NA	NA	NA	NA
WP_174894878.1|3955652_3957011_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	39.7	2.2e-85
WP_174896697.1|3957132_3957780_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_174896286.1|3957976_3958303_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_174896698.1|3958496_3959630_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000947460.1|3959711_3960302_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_174896287.1|3960295_3961093_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	1.8e-10
WP_174896288.1|3961086_3961899_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_174896699.1|3961888_3962863_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_174896289.1|3962862_3964503_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000182479.1|3965191_3965506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929971.1|3965654_3966185_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	3.7e-36
WP_174896290.1|3966267_3967311_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_001218118.1|3967649_3968117_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_174896291.1|3968311_3968542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002951235.1|3969256_3969601_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_174896292.1|3970812_3971370_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9LA63	Enterobacterial_phage	31.6	8.4e-15
WP_079803535.1|3972176_3972440_+	virulence factor	NA	NA	NA	NA	NA
WP_174896293.1|3972664_3972877_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_174896294.1|3973423_3973945_+	RICIN domain-containing protein	NA	NA	NA	NA	NA
WP_079803534.1|3974152_3974392_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	87.3	1.9e-32
WP_174894878.1|3974606_3975965_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	39.7	2.2e-85
WP_174896295.1|3976094_3980249_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	41.8	7.1e-300
WP_174896296.1|3980741_3983012_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_079803531.1|3983429_3983831_+	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_000588501.1|3984361_3984652_+	Bor family protein	NA	C6ZCX3	Enterobacteria_phage	70.8	2.3e-32
WP_174896297.1|3988207_3990334_-	E3 ubiquitin--protein ligase	NA	Q9MBL9	Phage_Gifsy-2	77.9	1.3e-58
WP_051124265.1|3990830_3991955_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_174896298.1|3993596_3993878_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	78.5	2.2e-35
WP_001294873.1|3993864_3994254_-|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	72.5	4.8e-41
WP_000444203.1|3994499_3994841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001663850.1|3994877_3995687_-|bacteriocin	lipid II-degrading bacteriocin	bacteriocin	NA	NA	NA	NA
WP_000658043.1|3995813_3996002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023227239.1|3996310_3997006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174896299.1|3997307_3998144_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	76.3	5.5e-119
WP_000609694.1|3998140_3998413_-	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	76.3	2.7e-27
WP_174896300.1|3999487_4000027_+	HD family hydrolase	NA	A0A192Y8M4	Salmonella_phage	97.2	4.7e-95
WP_174896301.1|4000169_4000406_+	excisionase	NA	NA	NA	NA	NA
WP_174895765.1|4000505_4001543_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP054715	Salmonella enterica strain 85-0120 chromosome, complete genome	4794154	4200414	4210600	4794154		Escherichia_phage(42.86%)	9	NA	NA
WP_174896373.1|4200414_4203027_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.9	1.4e-19
WP_174896374.1|4203451_4203676_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	87.7	8.5e-27
WP_174896704.1|4204393_4205203_+	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	50.2	8.4e-64
WP_174896375.1|4205365_4205743_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.2	9.7e-15
WP_174896376.1|4205910_4206462_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	65.5	1.2e-69
WP_174896377.1|4206658_4207390_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	50.0	2.1e-58
WP_174896378.1|4207538_4207697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174896379.1|4209669_4210095_-	subtilase cytotoxin subunit B-like protein	NA	NA	NA	NA	NA
WP_174896380.1|4210021_4210600_-	hypothetical protein	NA	A0A0U2KD26	Escherichia_phage	66.5	4.4e-51
>prophage 9
NZ_CP054715	Salmonella enterica strain 85-0120 chromosome, complete genome	4794154	4659424	4701959	4794154	portal,coat,lysis,terminase,integrase,tail,holin	Salmonella_phage(62.96%)	59	4659253:4659297	4701975:4702019
4659253:4659297	attL	TGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
WP_174896564.1|4659424_4661608_-	hypothetical protein	NA	A0A193GYB8	Enterobacter_phage	46.8	1.5e-147
WP_174896565.1|4661710_4661998_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	66.7	4.2e-26
WP_058820361.1|4662037_4662811_-	ORF6N domain-containing protein	NA	H6WRU9	Salmonella_phage	66.1	1.0e-79
WP_174896715.1|4662894_4663533_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	82.5	2.2e-96
WP_021548180.1|4663606_4663780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174896566.1|4663877_4664738_+	helix-turn-helix domain-containing protein	NA	K7P850	Enterobacteria_phage	35.1	2.7e-20
WP_174896567.1|4664826_4665312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174896568.1|4665402_4667334_-	lytic transglycosylase domain-containing protein	NA	Q716G2	Shigella_phage	88.9	8.9e-306
WP_174896569.1|4667333_4668683_-	phage DNA ejection protein	NA	B9UDL0	Salmonella_phage	98.7	5.2e-244
WP_000964907.1|4668692_4669382_-	hypothetical protein	NA	A0A1R3Y5P8	Salmonella_virus	97.8	5.4e-88
WP_001531194.1|4669384_4669840_-	DUF2824 family protein	NA	I6R0L6	Salmonella_phage	99.3	8.8e-87
WP_174896570.1|4669839_4670541_-|tail	phage tail protein	tail	A0A0M4QWW6	Salmonella_phage	97.4	1.1e-75
WP_174896571.1|4670609_4671101_+	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	45.6	1.6e-30
WP_174896572.1|4671104_4672523_-	packaged DNA stabilization protein gp10	NA	B9UDK6	Salmonella_phage	94.7	2.3e-266
WP_001166096.1|4672482_4672983_-	packaged DNA stabilization protein p27	NA	I6RSF6	Salmonella_phage	100.0	2.5e-90
WP_174896573.1|4672966_4673527_-	hypothetical protein	NA	I6S1J7	Salmonella_phage	93.0	2.5e-99
WP_065348417.1|4673567_4674860_-|coat	coat protein	coat	A0A075B8L2	Enterobacteria_phage	99.5	4.2e-243
WP_174896574.1|4674859_4675771_-	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	99.0	5.4e-160
WP_174896575.1|4675784_4677962_-|portal	portal protein	portal	A0A0M4RCZ3	Salmonella_phage	98.3	0.0e+00
WP_174896576.1|4678010_4678511_+	HNH endonuclease	NA	A0A0M4R2Z1	Salmonella_phage	98.8	2.1e-94
WP_023892386.1|4678514_4680014_-|terminase	terminase	terminase	A0A192Y824	Salmonella_phage	99.6	4.1e-306
WP_174896577.1|4679991_4680480_-	DNA-packaging protein	NA	A8CGG1	Salmonella_phage	99.4	6.5e-88
WP_174896578.1|4680503_4680683_-	hypothetical protein	NA	Q9AZ02	Salmonella_phage	93.2	2.7e-23
WP_000807788.1|4680684_4680927_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_174896579.1|4681230_4681920_-	Rha family transcriptional regulator	NA	Q5G8R0	Enterobacteria_phage	98.7	4.7e-124
WP_174896580.1|4682137_4682575_-|lysis	lysis protein	lysis	A0A0N6WGE8	Salmonella_phage	97.2	1.7e-71
WP_174896716.1|4682571_4683009_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	98.6	7.4e-75
WP_000738703.1|4682992_4683319_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_174896581.1|4683696_4684185_-	DUF1133 family protein	NA	A0A192Y911	Salmonella_phage	87.7	4.2e-79
WP_174896582.1|4684181_4684364_-	hypothetical protein	NA	C6ZR61	Salmonella_phage	93.3	3.0e-22
WP_174896583.1|4684351_4684822_-	hypothetical protein	NA	C6ZR60	Salmonella_phage	96.2	4.4e-89
WP_001749499.1|4684802_4685039_-	hypothetical protein	NA	C6ZR59	Salmonella_phage	88.5	3.4e-34
WP_174896584.1|4685031_4685202_-	NinF family protein	NA	Q5G8S2	Enterobacteria_phage	89.1	5.7e-23
WP_001659070.1|4685198_4685375_-	NinE family protein	NA	I6RSI9	Salmonella_phage	100.0	2.3e-27
WP_000679702.1|4685341_4685515_-	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_174896585.1|4685511_4685949_-	recombination protein NinB	NA	C6ZR55	Salmonella_phage	97.2	7.9e-77
WP_079918900.1|4686022_4686301_-	hypothetical protein	NA	Q5G8S7	Enterobacteria_phage	94.6	2.1e-46
WP_174896586.1|4686301_4688182_-	toprim domain-containing protein	NA	Q5G8S8	Enterobacteria_phage	99.0	0.0e+00
WP_174896587.1|4689169_4689460_-	hypothetical protein	NA	I6RSP4	Salmonella_phage	97.9	2.6e-44
WP_001059982.1|4689590_4689800_-	helix-turn-helix transcriptional regulator	NA	I6S1U2	Salmonella_phage	100.0	2.1e-35
WP_174896588.1|4689909_4690563_+	LexA family transcriptional regulator	NA	I6R0S2	Salmonella_phage	99.1	4.3e-127
WP_174896717.1|4690562_4691033_+	hypothetical protein	NA	B9UDH1	Salmonella_phage	95.5	2.6e-78
WP_080151913.1|4691064_4691418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000834175.1|4691554_4691758_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
WP_174896589.1|4692114_4692477_+	antitermination protein	NA	C6ZR44	Salmonella_phage	93.3	3.4e-57
WP_174896590.1|4692550_4693777_+	hypothetical protein	NA	Q5G8T6	Enterobacteria_phage	99.2	2.2e-68
WP_000983400.1|4693986_4694121_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	68.2	1.4e-08
WP_001191777.1|4694105_4694258_+	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_174896718.1|4694342_4694651_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	98.0	7.3e-53
WP_006786550.1|4694647_4695550_+	recombinase RecT	NA	K7PKG9	Enterobacteria_phage	87.5	1.7e-145
WP_064013238.1|4695533_4696016_+	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	96.2	5.1e-77
WP_023200936.1|4696027_4696342_+	hypothetical protein	NA	A0A0M4R304	Salmonella_phage	95.2	2.1e-47
WP_023993441.1|4696358_4696529_+	DUF2737 family protein	NA	A0A0N7CAQ8	Salmonella_phage	98.2	1.8e-24
WP_174896591.1|4696516_4696930_+	hypothetical protein	NA	A0A0N6WGF1	Salmonella_phage	57.3	3.4e-21
WP_174896592.1|4696926_4697262_+	hypothetical protein	NA	H6WRY0	Salmonella_phage	93.6	8.3e-50
WP_174896593.1|4697263_4698583_+	phosphoadenosine phosphosulfate reductase family protein	NA	Q8W6P3	Burkholderia_virus	32.2	3.6e-40
WP_023230812.1|4698593_4698803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024140007.1|4700234_4700507_+	hypothetical protein	NA	A0A2H4FNB3	Salmonella_phage	100.0	6.9e-39
WP_174896594.1|4700795_4701959_+|integrase	site-specific integrase	integrase	B9UDL9	Salmonella_phage	98.4	1.0e-224
4701975:4702019	attR	TGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
>prophage 1
NZ_CP054717	Salmonella enterica strain 85-0120 plasmid unnamed1, complete sequence	162029	5667	60584	162029	bacteriocin,transposase,lysis	Escherichia_phage(31.25%)	48	NA	NA
WP_102025837.1|5667_6767_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.2	1.5e-47
WP_174896744.1|7224_13059_-	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_174895649.1|14734_16093_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	39.5	1.9e-84
WP_174896745.1|16847_17369_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_174896746.1|17365_18319_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_174896747.1|18405_20730_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_174896748.1|21692_22691_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_174896749.1|22687_23644_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_174896750.1|23644_24412_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	26.7	4.9e-13
WP_004178129.1|25539_25773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174896751.1|26579_27353_-	sprT domain-containing protein	NA	NA	NA	NA	NA
WP_000780222.1|27731_28013_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|27993_28323_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_174896752.1|28435_28867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080096647.1|29699_29936_+	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_171774016.1|30023_30566_+	colicin immunity protein Cui	NA	NA	NA	NA	NA
WP_171774047.1|32417_32801_+	Exc2 family lipoprotein	NA	NA	NA	NA	NA
WP_174896753.1|33389_33959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174896754.1|34026_34197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174896755.1|34187_34403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174896829.1|34497_34857_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	87.3	4.1e-55
WP_168445557.1|34862_35165_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	45.1	1.7e-17
WP_174896756.1|35226_35976_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_174896757.1|36011_36497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174896758.1|36711_37644_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_174896759.1|38305_39217_-	DMT family transporter	NA	NA	NA	NA	NA
WP_174896760.1|39312_40341_-	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_174896761.1|41060_41663_-	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	30.3	2.7e-06
WP_174896762.1|41941_42268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174896763.1|42260_42557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174896764.1|42903_43212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174896765.1|43350_43968_+	riboflavin synthase subunit alpha	NA	A0A1V0SE20	Indivirus	32.8	3.8e-16
WP_174896766.1|44010_44373_-	hypothetical protein	NA	H7BVT3	unidentified_phage	38.5	5.0e-08
WP_174896767.1|44501_45017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174896768.1|45265_45661_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_174896769.1|45668_46625_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	54.1	5.4e-94
WP_174896770.1|46945_47380_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.5	1.6e-29
WP_174896771.1|48764_49742_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	52.2	8.2e-82
WP_174896772.1|49741_50947_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	8.1e-164
WP_174896773.1|51909_52950_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	87.9	5.2e-183
WP_023229282.1|53558_54500_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_174896774.1|54651_55575_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_085398029.1|55612_56701_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_085398018.1|56710_57532_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_174896830.1|58205_58709_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_095472388.1|59441_59900_+|transposase	IS200/IS605 family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	3.4e-14
WP_174896775.1|60087_60234_-|lysis	colicin release lysis protein	lysis	NA	NA	NA	NA
WP_174896776.1|60320_60584_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 2
NZ_CP054717	Salmonella enterica strain 85-0120 plasmid unnamed1, complete sequence	162029	72253	148728	162029	protease,transposase,integrase,coat,holin	Aeromonas_phage(18.18%)	58	84933:84960	112811:112838
WP_174896791.1|72253_73414_+|coat	spore coat protein CotH	coat	NA	NA	NA	NA
WP_174896833.1|73900_75382_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_174896792.1|75378_75771_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_174896793.1|75858_76173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174896794.1|77027_79355_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	26.9	4.7e-35
WP_174896795.1|79366_79822_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_174896834.1|79900_80287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174896796.1|80713_81640_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_174896797.1|81864_83097_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_174896798.1|83134_84325_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
84933:84960	attL	CTCATATTCTTCTTGCTCAGTTGATATC	NA	NA	NA	NA
WP_174896799.1|85516_85792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000389613.1|87160_87856_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_071678786.1|88359_89142_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	1.9e-52
WP_057394649.1|89686_89977_-	cytoplasmic protein	NA	NA	NA	NA	NA
WP_001159874.1|89978_90284_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813642.1|90285_90504_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_171774035.1|91215_91830_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_174896800.1|92000_92231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174896801.1|92261_92567_+	cytoplasmic protein	NA	NA	NA	NA	NA
WP_171774034.1|93098_93629_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_171774033.1|93632_93902_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_077907168.1|94755_95748_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	60.3	6.6e-103
WP_174896802.1|96263_99215_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	22.6	3.5e-51
WP_174896731.1|99333_99951_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	35.3	2.7e-22
WP_174896803.1|100057_100918_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.7	5.3e-08
WP_171774032.1|101938_102235_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_171774031.1|102221_102488_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_174896804.1|102944_103238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171774006.1|103234_103687_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_171774005.1|103792_104146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174896805.1|104198_104447_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_171774003.1|105311_105677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171774002.1|105716_106844_+	acyl-protein synthase	NA	NA	NA	NA	NA
WP_174896806.1|106845_109254_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_174896807.1|109292_110594_+	phenylacetate--CoA ligase family protein	NA	NA	NA	NA	NA
WP_174896808.1|110590_111475_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_174896809.1|112807_113164_-	recombinase family protein	NA	NA	NA	NA	NA
112811:112838	attR	CTCATATTCTTCTTGCTCAGTTGATATC	NA	NA	NA	NA
WP_174896810.1|113474_113594_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_174896811.1|113666_114062_+	recombinase family protein	NA	A0A219YB42	Aeromonas_phage	45.0	3.5e-15
WP_174896812.1|114614_115067_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_114047722.1|115066_115324_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_171773995.1|116249_118028_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_174896813.1|118516_119704_+	knotted carbamoyltransferase YgeW	NA	NA	NA	NA	NA
WP_171773994.1|119765_120965_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_171773993.1|121028_122240_+	YgeY family selenium metabolism-linked hydrolase	NA	NA	NA	NA	NA
WP_174896814.1|122290_123697_+	dihydropyrimidinase	NA	NA	NA	NA	NA
WP_174896815.1|123709_124642_+	carbamate kinase	NA	NA	NA	NA	NA
WP_024274377.1|124692_125526_-	XdhC family protein	NA	NA	NA	NA	NA
WP_174896816.1|126057_129162_+	putative selenate reductase subunit YgfK	NA	NA	NA	NA	NA
WP_164852917.1|129164_130496_+	putative aminohydrolase SsnA	NA	NA	NA	NA	NA
WP_004103174.1|130593_131070_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_174896817.1|131066_133007_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_174896818.1|133518_134994_+	purine permease	NA	Q9KX94	Enterobacteria_phage	27.5	8.2e-25
WP_171773988.1|135127_137275_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	3.6e-29
WP_032728392.1|137349_137955_-	CTP--molybdopterin cytidylyltransferase	NA	NA	NA	NA	NA
WP_004103181.1|138020_138479_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	36.6	1.6e-19
WP_174896819.1|138491_141704_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_174895092.1|147581_148728_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	90.7	3.6e-145
>prophage 1
NZ_CP054718	Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence	118798	2602	55101	118798	terminase,head,tail,portal,capsid	Klebsiella_phage(52.46%)	65	NA	NA
WP_174896837.1|2602_3037_-|terminase	P27 family phage terminase small subunit	terminase	Q6UAY1	Klebsiella_phage	86.8	1.3e-66
WP_070799287.1|3669_4722_-	DNA cytosine methyltransferase	NA	O64366	Escherichia_phage	66.3	4.5e-134
WP_174896838.1|4801_5110_-	DUF4406 domain-containing protein	NA	Q6UAS4	Klebsiella_phage	87.8	1.9e-45
WP_069720971.1|5106_5373_-	hypothetical protein	NA	A0A0M3LQ80	Mannheimia_phage	41.2	2.3e-10
WP_061379842.1|5483_5696_-	hypothetical protein	NA	Q6UAS6	Klebsiella_phage	82.5	6.2e-19
WP_023197217.1|6105_6597_-	hypothetical protein	NA	Q6UAS8	Klebsiella_phage	92.0	2.2e-83
WP_023197218.1|6593_6902_-	hypothetical protein	NA	Q6UAS9	Klebsiella_phage	84.0	8.4e-41
WP_023197222.1|8946_9258_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	80.4	7.9e-39
WP_023197223.1|9254_9536_+	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	66.7	7.2e-31
WP_023197224.1|9561_9810_-	hypothetical protein	NA	Q7Y3V8	Yersinia_phage	46.7	5.0e-12
WP_174896839.1|10200_10791_-	hypothetical protein	NA	Q7Y3W0	Yersinia_phage	68.3	5.7e-78
WP_174896840.1|10747_11014_-	hypothetical protein	NA	O64355	Escherichia_phage	45.7	4.3e-09
WP_174896835.1|12130_12592_-	hypothetical protein	NA	G9L6G6	Escherichia_phage	52.4	9.7e-17
WP_174896841.1|12554_13148_-	3'-5' exonuclease	NA	Q6UAU3	Klebsiella_phage	54.5	1.1e-36
WP_174896842.1|13349_13778_-	hypothetical protein	NA	Q7Y3W9	Yersinia_phage	50.0	1.5e-27
WP_174896843.1|13774_14224_-	hypothetical protein	NA	Q7Y3W9	Yersinia_phage	44.9	3.1e-20
WP_174896844.1|14288_14504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174896872.1|14848_15328_-	hypothetical protein	NA	A0A2I6TCB3	Escherichia_phage	36.8	4.4e-20
WP_174896845.1|15451_15784_-	hypothetical protein	NA	Q7Y3X3	Yersinia_phage	59.8	1.4e-25
WP_031621397.1|16377_17022_+	XRE family transcriptional regulator	NA	Q7Y3X6	Yersinia_phage	61.7	4.9e-67
WP_174896846.1|22075_22228_+	DUF5448 family protein	NA	Q6UAU9	Klebsiella_phage	67.6	4.3e-06
WP_174896847.1|22190_22517_+	DUF5448 family protein	NA	Q6UAU9	Klebsiella_phage	70.5	8.1e-26
WP_174896848.1|24728_26585_+	protelomerase	NA	Q6UAV6	Klebsiella_phage	55.0	1.3e-189
WP_174896849.1|26660_27050_-	DUF5448 family protein	NA	Q6UAU9	Klebsiella_phage	71.3	8.7e-43
WP_080087190.1|27537_27864_-	hypothetical protein	NA	O64345	Escherichia_phage	69.2	9.8e-40
WP_174896850.1|27874_31849_-	hypothetical protein	NA	Q7Y3X9	Yersinia_phage	70.3	0.0e+00
WP_031621397.1|32114_32759_-	XRE family transcriptional regulator	NA	Q7Y3X6	Yersinia_phage	61.7	4.9e-67
WP_024148375.1|32861_33068_+	Cro/Cl family transcriptional regulator	NA	Q7Y3X4	Yersinia_phage	55.9	1.2e-14
WP_024145689.1|33087_33690_+	hypothetical protein	NA	Q7Y3X3	Yersinia_phage	64.5	2.7e-67
WP_069040855.1|33676_34342_+	hypothetical protein	NA	Q7Y3X2	Yersinia_phage	40.5	1.3e-41
WP_137948900.1|34640_34859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069721606.1|34862_35801_+	recombination-associated protein RdgC	NA	Q7Y3W9	Yersinia_phage	46.5	5.3e-70
WP_174896851.1|35800_36001_+	hypothetical protein	NA	Q7Y3W8	Yersinia_phage	56.1	1.4e-12
WP_174896852.1|36003_36933_+	3'-5' exonuclease	NA	Q6UAU3	Klebsiella_phage	62.5	7.9e-66
WP_174896853.1|36929_37412_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	44.2	1.5e-31
WP_070799302.1|38375_38999_+	hypothetical protein	NA	Q7Y3W0	Yersinia_phage	64.4	4.9e-80
WP_023197225.1|39086_39323_+	DinI-like family protein	NA	Q7Y3V9	Yersinia_phage	55.8	4.1e-19
WP_023197224.1|39360_39609_+	hypothetical protein	NA	Q7Y3V8	Yersinia_phage	46.7	5.0e-12
WP_023197223.1|39634_39916_-	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	66.7	7.2e-31
WP_023197222.1|39912_40224_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	80.4	7.9e-39
WP_023197221.1|40394_40616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023197220.1|40665_40899_+	hypothetical protein	NA	O64359	Escherichia_phage	51.4	3.0e-14
WP_174896854.1|41159_42221_+	site-specific DNA-methyltransferase	NA	Q6UAT0	Klebsiella_phage	87.3	1.8e-162
WP_023197218.1|42278_42587_+	hypothetical protein	NA	Q6UAS9	Klebsiella_phage	84.0	8.4e-41
WP_023197217.1|42583_43075_+	hypothetical protein	NA	Q6UAS8	Klebsiella_phage	92.0	2.2e-83
WP_070799294.1|43091_43556_+	hypothetical protein	NA	Q6UAS7	Klebsiella_phage	84.4	2.1e-64
WP_128189420.1|43503_43698_+	hypothetical protein	NA	Q6UAS6	Klebsiella_phage	82.5	5.7e-19
WP_069720971.1|43808_44075_+	hypothetical protein	NA	A0A0M3LQ80	Mannheimia_phage	41.2	2.3e-10
WP_174896838.1|44071_44380_+	DUF4406 domain-containing protein	NA	Q6UAS4	Klebsiella_phage	87.8	1.9e-45
WP_070799287.1|44459_45512_+	DNA cytosine methyltransferase	NA	O64366	Escherichia_phage	66.3	4.5e-134
WP_023197212.1|45565_45928_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	89.8	8.1e-59
WP_023197211.1|46147_46582_+|terminase	P27 family phage terminase small subunit	terminase	Q6UAY1	Klebsiella_phage	87.5	2.5e-67
WP_079975380.1|46617_48327_+|terminase	terminase large subunit	terminase	Q6UAY0	Klebsiella_phage	88.0	2.3e-305
WP_024145686.1|48320_48500_+	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	63.2	4.3e-13
WP_070799274.1|48499_49759_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.5	2.3e-222
WP_069040874.1|49791_50142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174896855.1|50125_51043_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	78.2	5.8e-130
WP_174896856.1|51116_52403_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	87.9	4.4e-208
WP_023197205.1|52458_52749_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	61.4	2.6e-20
WP_174896857.1|52729_53053_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q7Y407	Yersinia_phage	64.2	3.4e-32
WP_023228903.1|53049_53394_+	hypothetical protein	NA	Q6UAX3	Klebsiella_phage	63.6	1.8e-36
WP_079975377.1|53374_53764_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	72.2	9.0e-48
WP_069720979.1|53760_54162_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	88.0	7.6e-58
WP_174896858.1|54194_54668_+|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	78.7	2.4e-63
WP_023197199.1|54738_55101_+	hypothetical protein	NA	Q6UAW8	Klebsiella_phage	55.1	1.9e-28
>prophage 2
NZ_CP054718	Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence	118798	67972	91341	118798	tail,transposase	Yersinia_phage(23.81%)	25	NA	NA
WP_174896873.1|67972_68428_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	73.7	5.0e-58
WP_174896862.1|68431_68950_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.0	4.3e-45
WP_174896836.1|69595_70012_-	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	83.8	1.7e-60
WP_070799248.1|70241_70838_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	87.5	1.2e-88
WP_079820990.1|70895_71135_+	DNA polymerase V	NA	I6PD82	Cronobacter_phage	55.7	1.7e-20
WP_000506738.1|71137_71446_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	57.1	2.0e-26
WP_174896863.1|71576_72758_-	ParB/RepB/Spo0J family plasmid partition protein	NA	Q7Y3Y7	Yersinia_phage	60.4	7.8e-127
WP_109909712.1|74138_74252_+	ash family protein	NA	NA	NA	NA	NA
WP_023197247.1|74304_74469_+	host cell division inhibitor Icd-like protein	NA	Q7Y3Y4	Yersinia_phage	83.0	1.1e-18
WP_023197246.1|74465_74693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174896864.1|74659_75232_+	helix-turn-helix domain-containing protein	NA	A0A1I9KF42	Aeromonas_phage	58.5	2.8e-53
WP_174896865.1|75407_75626_+|transposase	transposase	transposase	A0A1I9KF42	Aeromonas_phage	70.4	1.1e-13
WP_174896874.1|75592_75847_+|transposase	transposase	transposase	A0A1I9KF42	Aeromonas_phage	58.4	5.3e-17
WP_174896866.1|77310_78525_-|transposase	transposase	transposase	A0A1I9KF42	Aeromonas_phage	55.7	1.6e-119
WP_023197246.1|78491_78719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023197247.1|78715_78880_-	host cell division inhibitor Icd-like protein	NA	Q7Y3Y4	Yersinia_phage	83.0	1.1e-18
WP_109909712.1|78932_79046_-	ash family protein	NA	NA	NA	NA	NA
WP_023197248.1|79263_80433_+	plasmid-partitioning protein SopA	NA	Q7Y3Y6	Yersinia_phage	84.1	4.0e-192
WP_174896863.1|80429_81611_+	ParB/RepB/Spo0J family plasmid partition protein	NA	Q7Y3Y7	Yersinia_phage	60.4	7.8e-127
WP_000506738.1|81741_82050_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	57.1	2.0e-26
WP_079820990.1|82052_82292_-	DNA polymerase V	NA	I6PD82	Cronobacter_phage	55.7	1.7e-20
WP_174896867.1|82943_84149_+	hypothetical protein	NA	Q6K1H2	Salmonella_virus	48.8	3.3e-88
WP_174896873.1|84229_84685_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	73.7	5.0e-58
WP_174896862.1|84688_85207_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.0	4.3e-45
WP_174896868.1|87945_91341_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	70.1	0.0e+00
>prophage 3
NZ_CP054718	Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence	118798	98091	102075	118798	head,tail,capsid	Klebsiella_phage(85.71%)	7	NA	NA
WP_023197199.1|98091_98454_-	hypothetical protein	NA	Q6UAW8	Klebsiella_phage	55.1	1.9e-28
WP_174896858.1|98524_98998_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	78.7	2.4e-63
WP_069720979.1|99030_99432_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	88.0	7.6e-58
WP_079975377.1|99428_99818_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	72.2	9.0e-48
WP_023228903.1|99798_100143_-	hypothetical protein	NA	Q6UAX3	Klebsiella_phage	63.6	1.8e-36
WP_174896857.1|100139_100463_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q7Y407	Yersinia_phage	64.2	3.4e-32
WP_174896856.1|100788_102075_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	87.9	4.4e-208
>prophage 4
NZ_CP054718	Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence	118798	106589	113783	118798	terminase	Klebsiella_phage(62.5%)	9	NA	NA
WP_174896875.1|106589_106853_-|terminase	P27 family phage terminase small subunit	terminase	Q6UAY1	Klebsiella_phage	87.4	1.1e-36
WP_174896869.1|108780_109065_-	DUF4406 domain-containing protein	NA	Q6UAS4	Klebsiella_phage	86.7	2.9e-40
WP_069720971.1|109084_109351_-	hypothetical protein	NA	A0A0M3LQ80	Mannheimia_phage	41.2	2.3e-10
WP_061379842.1|109460_109673_-	hypothetical protein	NA	Q6UAS6	Klebsiella_phage	82.5	6.2e-19
WP_023197217.1|110082_110574_-	hypothetical protein	NA	Q6UAS8	Klebsiella_phage	92.0	2.2e-83
WP_023197218.1|110570_110879_-	hypothetical protein	NA	Q6UAS9	Klebsiella_phage	84.0	8.4e-41
WP_023197221.1|112529_112751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023197223.1|113227_113509_+	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	66.7	7.2e-31
WP_023197224.1|113534_113783_-	hypothetical protein	NA	Q7Y3V8	Yersinia_phage	46.7	5.0e-12
