The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP054780	Klebsiella pneumoniae strain KP20194a chromosome, complete genome	5448829	448676	528774	5448829	portal,protease,tRNA,integrase,tail,transposase,head,terminase,capsid	uncultured_Caudovirales_phage(57.14%)	78	466284:466301	482279:482296
WP_002919147.1|448676_449624_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|449638_450148_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|450276_451401_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|451372_451846_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|451871_452414_+	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_002919132.1|452418_452991_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|452994_453813_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|453809_454067_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|454042_454597_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|460392_460614_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|460907_464018_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|464030_465170_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|465548_466199_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
466284:466301	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|466474_467701_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|467793_468735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|468916_469201_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|469211_469991_+	phage antirepressor KilAC domain-containing protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|470442_470712_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|470704_470893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|470885_471200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|471196_471565_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|471561_471927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|471926_474062_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|474404_474740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|474788_475301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|475564_476731_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|476782_477343_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|477344_478586_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|478582_478918_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|478914_479214_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|479213_479657_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004150957.1|479649_479802_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_000113647.1|479932_480289_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|480272_481934_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_004150954.1|481936_482128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000462905.1|482281_482578_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
482279:482296	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004144972.1|482602_483568_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_002918745.1|483925_484807_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_002918742.1|484818_486270_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918740.1|486259_486502_-	YhdT family protein	NA	NA	NA	NA	NA
WP_002918738.1|486612_487962_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918736.1|487972_488440_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918732.1|488462_488915_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918689.1|489138_489747_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918688.1|489746_490748_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918687.1|490976_491168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002918686.1|491247_493188_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918653.1|493493_494537_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_004149974.1|494607_495600_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918648.1|495599_496088_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_002918646.1|496095_496677_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918644.1|496679_498149_+	ribonuclease G	NA	NA	NA	NA	NA
WP_004150952.1|498186_501984_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_002918642.1|502072_503518_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_002918641.1|503553_504483_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918640.1|504614_504818_+	AaeX family protein	NA	NA	NA	NA	NA
WP_002918639.1|504825_505758_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918632.1|505763_507731_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918629.1|507810_508086_+	barstar family protein	NA	NA	NA	NA	NA
WP_002918627.1|508136_508403_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918626.1|508501_508765_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918625.1|509140_509611_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918570.1|510025_510964_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918568.1|511100_512159_-	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_062954970.1|512246_513614_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918565.1|513787_514186_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_004144945.1|514376_515504_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918559.1|515769_516198_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_000829818.1|516213_516606_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_135801240.1|516663_516948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002918467.1|516917_517556_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002918465.1|517559_518054_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918463.1|518178_518883_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002918461.1|518937_520356_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002918458.1|520365_524826_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_002918455.1|525499_526432_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.8	3.4e-16
WP_049118345.1|526483_527716_-	MFS transporter	NA	NA	NA	NA	NA
WP_000019445.1|527793_528774_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 2
NZ_CP054780	Klebsiella pneumoniae strain KP20194a chromosome, complete genome	5448829	1176773	1262106	5448829	portal,tRNA,integrase,plate,tail,transposase,head,lysis,terminase,capsid	Salmonella_phage(69.23%)	97	1190527:1190546	1239207:1239226
WP_002914765.1|1176773_1179401_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	4.9e-81
WP_000906486.1|1179764_1179950_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_002914359.1|1181471_1181786_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_002914357.1|1181911_1182478_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_002914355.1|1182474_1182903_+	DedA family protein	NA	NA	NA	NA	NA
WP_002914353.1|1182969_1184526_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_002914351.1|1184682_1185198_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_002914345.1|1185250_1186018_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002914344.1|1185996_1187673_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002914342.1|1187809_1189348_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_002914339.1|1189363_1190536_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
1190527:1190546	attL	TTGCACTCATGTTATTCTCC	NA	NA	NA	NA
WP_002914337.1|1190661_1191192_-	transcriptional repressor MprA	NA	NA	NA	NA	NA
WP_002914335.1|1191282_1191618_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_002914333.1|1191607_1192354_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_002914330.1|1192531_1193530_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_004151038.1|1193608_1194676_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_002914328.1|1194668_1195871_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.8	1.2e-26
WP_002914327.1|1196227_1197190_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.2	1.5e-131
WP_002914325.1|1197200_1199342_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	46.4	2.5e-184
WP_002914321.1|1199314_1199725_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_002914320.1|1199721_1199967_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	41.1	5.5e-11
WP_004151037.1|1200150_1200582_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004149442.1|1200670_1202023_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_002914293.1|1202166_1202514_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_002914291.1|1202663_1203026_+	YgaC family protein	NA	NA	NA	NA	NA
WP_002914289.1|1203111_1203561_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_004217497.1|1204271_1204691_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_002914284.1|1204763_1204943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914281.1|1205148_1206051_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.2	2.6e-37
WP_002914279.1|1206031_1206577_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_002914277.1|1206584_1206884_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002914274.1|1206959_1207565_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004145715.1|1207668_1208577_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004151036.1|1208659_1210447_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_004151035.1|1210710_1212231_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000019473.1|1212962_1213943_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_062955148.1|1213988_1214987_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
WP_004151019.1|1214989_1215619_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1215741_1215984_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1216016_1216526_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1216533_1216734_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1216697_1217036_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1217103_1217337_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1217336_1217564_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1217560_1218412_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1218408_1220793_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004178082.1|1221270_1222758_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151011.1|1222865_1223054_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1223065_1223299_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1223394_1224078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1224064_1225144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1225143_1226145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1226666_1226936_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1226992_1228036_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1228035_1229799_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1229939_1230773_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1230789_1231842_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1231845_1232499_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1232594_1233059_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1233058_1233262_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1233265_1233481_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1233461_1233971_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1233975_1234359_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1234355_1234784_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_072093160.1|1234758_1234917_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150997.1|1234879_1235302_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1235294_1235741_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1235763_1236630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1236724_1237297_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1237293_1237656_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1237642_1238551_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1238543_1239215_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1239216_1241166_+	CotH kinase family protein	NA	Q6QI97	Burkholderia_phage	38.9	1.0e-06
1239207:1239226	attR	GGAGAATAACATGAGTGCAA	NA	NA	NA	NA
WP_004200602.1|1241175_1242294_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|1242345_1243419_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1243567_1244740_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1244749_1245265_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1245317_1245617_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1245631_1245751_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_072093161.1|1245977_1248374_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.5	8.1e-107
WP_004150983.1|1248370_1248856_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1248852_1249947_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1250013_1250232_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1250259_1250637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1251240_1251723_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_004188817.1|1251833_1252310_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1252299_1252590_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1252656_1252998_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914159.1|1253145_1254807_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1254893_1255772_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1255896_1256487_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1256606_1257893_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1257912_1258704_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1258867_1260232_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1260491_1260740_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1260758_1261307_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1261338_1262106_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP054780	Klebsiella pneumoniae strain KP20194a chromosome, complete genome	5448829	1368128	1434353	5448829	protease,integrase,tail,holin,transposase,terminase	Salmonella_phage(31.48%)	72	1369123:1369140	1437101:1437118
WP_004151980.1|1368128_1369595_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
1369123:1369140	attL	GTATTCCGGTTATCGCTG	NA	NA	NA	NA
WP_004151979.1|1369662_1371240_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_060617729.1|1371432_1372683_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.1	3.1e-206
WP_004200579.1|1372699_1372891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060617728.1|1372887_1373658_-	hypothetical protein	NA	D5LH17	Escherichia_phage	52.0	2.7e-64
WP_060617727.1|1373654_1374248_-	adenine methylase	NA	T1SA14	Salmonella_phage	91.9	9.6e-110
WP_032439437.1|1374244_1374403_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	4.3e-17
WP_071182196.1|1374395_1374689_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	3.0e-32
WP_009485476.1|1374798_1375047_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	70.7	1.0e-28
WP_124747885.1|1375095_1375977_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	82.6	2.7e-132
WP_124747886.1|1375973_1376795_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A193GYK2	Enterobacter_phage	82.4	6.0e-134
WP_060617724.1|1376791_1377091_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	52.5	1.1e-18
WP_004164037.1|1377087_1377237_-	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
WP_060617723.1|1377465_1378047_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.8e-64
WP_023285447.1|1378201_1378435_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	1.2e-23
WP_004152537.1|1378581_1378791_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_023285446.1|1378790_1379558_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_032418532.1|1379554_1380340_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_071182195.1|1380459_1380804_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	85.1	6.3e-53
WP_071182197.1|1380996_1381407_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	55.6	7.3e-16
WP_032441402.1|1381390_1381582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441401.1|1381578_1382223_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
WP_157772047.1|1383208_1383379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071182194.1|1383375_1384314_+	DUF551 domain-containing protein	NA	R9TQX3	Aeromonas_phage	61.8	6.1e-42
WP_071182193.1|1384398_1384704_+	hypothetical protein	NA	Q7Y3Y0	Yersinia_phage	43.4	1.7e-14
WP_071182192.1|1384696_1385035_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	88.2	1.9e-49
WP_071182168.1|1385112_1385442_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	56.1	5.1e-28
WP_032457429.1|1385499_1386084_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	89.1	5.8e-91
WP_071182167.1|1386080_1387556_+|terminase	terminase	terminase	Q858H3	Salmonella_phage	93.5	1.3e-280
WP_004141368.1|1388291_1388498_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_032441398.1|1388512_1390195_+|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	1.5e-264
WP_004152446.1|1390191_1390488_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_032441397.1|1390490_1391171_+	peptidase	NA	G9L6C4	Escherichia_phage	84.0	6.1e-76
WP_004200546.1|1391185_1392172_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
WP_020953461.1|1392225_1392663_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
WP_062955141.1|1392673_1393015_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	2.4e-36
WP_004152441.1|1393065_1393389_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_062955139.1|1393388_1393994_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.0	4.0e-87
WP_062955138.1|1393993_1396471_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.4	0.0e+00
WP_004152438.1|1396470_1396935_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_032447858.1|1396934_1397474_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
WP_124747888.1|1397484_1400001_+	hypothetical protein	NA	T1SBJ1	Salmonella_phage	81.5	0.0e+00
WP_094923803.1|1399997_1401800_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	82.0	1.5e-270
WP_094923800.1|1401804_1404279_+	hypothetical protein	NA	T1S9I6	Salmonella_phage	94.8	0.0e+00
WP_032457415.1|1404474_1404771_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	92.7	7.5e-47
WP_074195329.1|1404814_1405012_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	63.5	3.7e-18
WP_064189924.1|1405015_1405273_-	DUF1902 domain-containing protein	NA	NA	NA	NA	NA
WP_064152944.1|1405365_1406055_-	anti-repressor protein	NA	G9L6E2	Escherichia_phage	65.2	2.1e-79
WP_004152432.1|1406369_1406666_-	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	64.0	1.1e-24
WP_094923797.1|1409556_1409751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124747889.1|1409943_1410348_+	hypothetical protein	NA	A0A0F6R7N0	Escherichia_coli_O157_typing_phage	82.6	1.0e-54
WP_023339240.1|1410334_1410640_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
WP_062955009.1|1410629_1411259_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
WP_062955008.1|1411255_1411756_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	1.3e-59
WP_004152009.1|1411942_1413811_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_004162150.1|1413794_1414973_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_002913847.1|1415266_1416499_-	MFS transporter	NA	NA	NA	NA	NA
WP_004221278.1|1416572_1417484_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004174861.1|1417580_1417754_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	78.8	1.4e-16
WP_002913841.1|1418124_1420353_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_002913839.1|1420406_1421939_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_002913838.1|1421942_1424003_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_004152007.1|1424183_1424825_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
WP_002913836.1|1424821_1425859_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
WP_002913833.1|1426122_1427016_+	ROK family protein	NA	NA	NA	NA	NA
WP_002913829.1|1427025_1428459_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002913827.1|1428676_1429303_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002913824.1|1429398_1430685_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_020947395.1|1430783_1431485_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002913812.1|1431481_1432393_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
WP_002913810.1|1432520_1432880_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_002913807.1|1432889_1434353_-|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
1437101:1437118	attR	GTATTCCGGTTATCGCTG	NA	NA	NA	NA
>prophage 4
NZ_CP054780	Klebsiella pneumoniae strain KP20194a chromosome, complete genome	5448829	1746162	1753067	5448829	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_072353998.1|1746162_1747026_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	7.4e-10
WP_094818808.1|1747036_1747810_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	5.1e-26
WP_004151134.1|1748050_1748947_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1749189_1750551_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1750869_1751592_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_072353997.1|1751588_1753067_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.9e-29
>prophage 5
NZ_CP054780	Klebsiella pneumoniae strain KP20194a chromosome, complete genome	5448829	1797612	1808636	5448829	transposase	Escherichia_phage(33.33%)	9	NA	NA
WP_000043543.1|1797612_1799019_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_004180506.1|1799245_1800661_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_039819506.1|1800682_1802053_+	O9 family phosphomannomutase RfbK2	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
WP_039819536.1|1802207_1803272_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
WP_023278825.1|1803285_1804155_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.7e-110
WP_004175259.1|1804186_1805077_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_039819508.1|1805091_1805646_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
WP_072353991.1|1805825_1806992_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	9.1e-112
WP_000019445.1|1807655_1808636_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 6
NZ_CP054780	Klebsiella pneumoniae strain KP20194a chromosome, complete genome	5448829	2798569	2809456	5448829		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|2798569_2801677_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2801731_2802997_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2803027_2804116_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2804202_2804463_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2804760_2805621_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2805641_2806403_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|2806663_2807566_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|2807577_2808843_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|2808835_2809456_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
NZ_CP054780	Klebsiella pneumoniae strain KP20194a chromosome, complete genome	5448829	3002726	3074491	5448829	integrase,plate,transposase,holin,terminase	uncultured_Caudovirales_phage(33.33%)	83	3065604:3065618	3071613:3071627
WP_002902268.1|3002726_3003812_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004151598.1|3003775_3005530_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004151599.1|3007201_3010627_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002902254.1|3010610_3011750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902252.1|3011746_3012004_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004151601.1|3012048_3014466_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_002902180.1|3014453_3014984_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902178.1|3015051_3015582_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902176.1|3015650_3016181_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902174.1|3016248_3016779_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902172.1|3016847_3017378_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902169.1|3017441_3018221_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_004228410.1|3018221_3020591_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.1e-18
WP_002902163.1|3020592_3023247_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
WP_002902160.1|3023511_3024003_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004151602.1|3024007_3025714_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004151603.1|3025710_3026400_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004218490.1|3026396_3027740_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002902148.1|3027749_3029294_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000019473.1|3029365_3030346_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_002902136.1|3030941_3031190_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
WP_002902133.1|3031412_3031697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902131.1|3031801_3032011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902128.1|3032007_3032739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218487.1|3032749_3033478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152577.1|3035828_3036026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152576.1|3036025_3036892_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|3036891_3037665_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|3037661_3038858_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|3038857_3039211_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|3039212_3039866_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|3039919_3040486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199301.1|3040528_3040711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|3040760_3041102_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|3041101_3042124_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004217362.1|3042126_3042354_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004152567.1|3042429_3043029_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|3043028_3045032_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3045021_3045174_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3045209_3045635_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|3045638_3046079_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152177.1|3046089_3047235_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|3047238_3047679_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3047773_3048160_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3048159_3048666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3048662_3049082_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3049050_3049332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|3049371_3050313_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|3050324_3050819_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|3050822_3052025_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3052076_3052625_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3052680_3054132_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3054369_3055770_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004218030.1|3055720_3056209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152170.1|3056574_3056895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|3057129_3057519_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3057515_3058046_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3058048_3058297_-|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_004152167.1|3058702_3059485_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3059481_3059958_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|3059954_3060917_-	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3060918_3062577_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|3063153_3063375_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3063472_3064141_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3064311_3064626_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3064618_3064807_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|3064976_3065342_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|3065334_3065589_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|3065560_3065779_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
3065604:3065618	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004152156.1|3065775_3066201_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3066197_3066392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3066388_3067216_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3067320_3067839_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3067844_3068555_+	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3068544_3068769_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|3068765_3068978_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_014343018.1|3069220_3069454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198245.1|3069526_3069673_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_004152148.1|3069632_3069875_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3069855_3071037_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3071233_3071782_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
3071613:3071627	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|3071980_3073513_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3073729_3074491_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 8
NZ_CP054780	Klebsiella pneumoniae strain KP20194a chromosome, complete genome	5448829	3107424	3159113	5448829	holin,transposase,protease,integrase	Enterobacteria_phage(29.41%)	60	3107206:3107221	3134471:3134486
3107206:3107221	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_002901815.1|3107424_3108096_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|3108282_3109110_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|3109185_3110451_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|3110452_3110872_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004178082.1|3110951_3112439_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001067855.1|3114348_3115053_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_062955100.1|3115089_3115377_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	95.4	4.4e-36
WP_004218565.1|3115373_3115913_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_024940884.1|3115909_3116209_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_000019473.1|3116364_3117345_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_022644626.1|3117887_3118934_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_004232548.1|3119159_3119849_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|3119848_3119989_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004218533.1|3119985_3120624_-	recombination protein NinG	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|3120616_3121285_-	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|3121281_3121449_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|3121429_3121897_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004243011.1|3122029_3122308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218530.1|3122417_3123446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|3123653_3123899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|3123954_3124257_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|3124253_3125102_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|3125098_3125959_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|3126044_3126266_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|3126306_3126534_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|3126645_3127344_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_004201109.1|3127631_3128708_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|3128789_3128993_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004219883.1|3129303_3129429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004135674.1|3129421_3129616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|3129704_3129989_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|3130004_3130850_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_088224434.1|3130846_3131134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201102.1|3131135_3131816_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|3131812_3132241_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|3132237_3132900_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004151900.1|3133107_3134325_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.9	8.6e-121
WP_004151901.1|3134471_3135362_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3134471:3134486	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|3135361_3136354_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3136355_3137165_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004151902.1|3137209_3138589_-	cytosine permease	NA	NA	NA	NA	NA
WP_004152967.1|3138836_3139379_+	HutD family protein	NA	NA	NA	NA	NA
WP_004140277.1|3139577_3140366_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_004151905.1|3140556_3141714_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_174892460.1|3141795_3143730_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
WP_002901786.1|3143888_3144068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002901785.1|3144139_3144889_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002901783.1|3145164_3145383_+	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_002901782.1|3145514_3145841_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_004151907.1|3145840_3146578_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_002901781.1|3146769_3147939_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_002901780.1|3147945_3148254_-	LapA family protein	NA	NA	NA	NA	NA
WP_002901779.1|3148389_3149157_-	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_002901778.1|3149320_3149923_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
WP_002901777.1|3149969_3152642_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_002901776.1|3153030_3153198_-	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_002901772.1|3153443_3154418_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_002901763.1|3154763_3157361_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
WP_002901761.1|3157767_3158019_+	YciN family protein	NA	NA	NA	NA	NA
WP_002901758.1|3158066_3159113_-|protease	protease SohB	protease	NA	NA	NA	NA
>prophage 9
NZ_CP054780	Klebsiella pneumoniae strain KP20194a chromosome, complete genome	5448829	3264837	3372722	5448829	portal,protease,tRNA,integrase,tail,holin,head,terminase,capsid	Klebsiella_phage(35.44%)	125	3291640:3291654	3373062:3373076
WP_002901088.1|3264837_3265338_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3265454_3265901_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_004140469.1|3265884_3266679_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014343001.1|3266786_3267962_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|3267993_3268686_-	CTP synthase	NA	NA	NA	NA	NA
WP_004150778.1|3268831_3269341_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_014343000.1|3269345_3269684_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_004150780.1|3269673_3269913_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004150781.1|3270213_3271227_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
WP_004150782.1|3271284_3271386_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_099119317.1|3271385_3271460_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3271577_3271703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|3271762_3272026_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|3272156_3272795_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|3272884_3273799_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150784.1|3274460_3275504_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004150785.1|3275806_3277015_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150787.1|3277088_3278873_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150788.1|3278879_3279770_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|3279890_3281399_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150789.1|3281432_3281597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|3281709_3282396_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004140501.1|3282793_3282973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|3283012_3283645_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|3284211_3284409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140509.1|3284524_3285535_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004150793.1|3285531_3286938_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140512.1|3286993_3287881_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|3287897_3288404_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150794.1|3288430_3288925_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3289015_3289201_-	general stress protein	NA	NA	NA	NA	NA
WP_004140529.1|3289822_3291016_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|3291128_3291356_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004225560.1|3291497_3291674_+	hypothetical protein	NA	NA	NA	NA	NA
3291640:3291654	attL	TGGCTGGCGTTCTTT	NA	NA	NA	NA
WP_004150797.1|3291792_3292116_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004150798.1|3292108_3292501_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150799.1|3292497_3293211_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|3293483_3293636_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_023328083.1|3293790_3295287_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	1.4e-125
WP_062955111.1|3295355_3308060_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.1	0.0e+00
WP_023328085.1|3308122_3308716_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.6	8.0e-80
WP_047666390.1|3308742_3309165_-	hypothetical protein	NA	J9Q806	Salmonella_phage	50.0	5.9e-29
WP_047666389.1|3309206_3309917_-	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	90.3	1.9e-136
WP_023328087.1|3309918_3310674_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.5	4.6e-125
WP_023328088.1|3310670_3311009_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	1.4e-57
WP_023328089.1|3311008_3314344_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.3	0.0e+00
WP_014228914.1|3314576_3314942_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_023328090.1|3314999_3315461_-	hypothetical protein	NA	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_168895379.1|3315492_3315885_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	93.8	7.1e-61
WP_017880258.1|3315890_3316280_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_023328092.1|3316260_3316599_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
WP_020317538.1|3316595_3316913_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_049010370.1|3316893_3317154_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	7.4e-22
WP_023328094.1|3317212_3318499_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	9.8e-216
WP_014907815.1|3318576_3319497_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_023279520.1|3319533_3320793_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
WP_017898992.1|3320792_3320972_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
WP_021462603.1|3320965_3322687_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
WP_012542168.1|3322686_3323121_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_014907818.1|3323369_3323801_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
WP_023297386.1|3323797_3324121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428746.1|3324072_3324435_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_163621077.1|3324418_3324709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094819074.1|3325352_3325622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016160650.1|3326571_3326922_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
WP_032432826.1|3326918_3327416_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.1e-77
WP_016160648.1|3327415_3327631_-|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	88.7	2.7e-30
WP_004147999.1|3328548_3328698_+	small membrane protein	NA	NA	NA	NA	NA
WP_004147997.1|3329435_3329639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025861432.1|3329882_3330485_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.1e-76
WP_062955112.1|3330501_3331533_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	4.7e-96
WP_025861428.1|3331732_3332125_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
WP_071531363.1|3332165_3332405_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	58.6	1.9e-16
WP_025368263.1|3332467_3332701_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	71.1	3.7e-25
WP_004178082.1|3332779_3334267_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_064155591.1|3334664_3334907_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	81.0	1.6e-31
WP_031592310.1|3334906_3335149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094818792.1|3335924_3336677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094818791.1|3336687_3338856_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	45.1	6.7e-100
WP_094818790.1|3338933_3342002_-	kinase	NA	A0A286S259	Klebsiella_phage	66.3	0.0e+00
WP_094818789.1|3341998_3342385_-	nitrite transporter	NA	H2BD94	Pseudomonas_phage	35.7	4.0e-16
WP_038433285.1|3342392_3342875_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	67.7	8.5e-56
WP_032420722.1|3342861_3343335_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	63.5	3.9e-53
WP_094818788.1|3343334_3346031_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	62.4	4.9e-201
WP_032420719.1|3346011_3346329_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	1.4e-19
WP_025714420.1|3346349_3346745_-|tail	phage tail protein	tail	M9NZD7	Enterobacteria_phage	27.5	1.9e-08
WP_023304948.1|3346787_3347270_-	hypothetical protein	NA	M9NYX0	Enterobacteria_phage	68.6	5.7e-60
WP_020804325.1|3347277_3347676_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	57.8	3.2e-40
WP_048291628.1|3347672_3348224_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	67.3	1.6e-53
WP_020317349.1|3348213_3348507_-	sugar ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_049186541.1|3348499_3348826_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	66.4	4.0e-33
WP_094818787.1|3348906_3350922_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	84.2	0.0e+00
WP_020317329.1|3350866_3352366_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.6	1.1e-247
WP_094818786.1|3352362_3352578_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	75.7	6.5e-24
WP_094818785.1|3352574_3354683_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	83.5	0.0e+00
WP_014228567.1|3354682_3355174_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	84.0	6.4e-67
WP_072002796.1|3355494_3355680_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	61.1	2.4e-11
WP_071606030.1|3355747_3356125_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004216876.1|3356234_3356480_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	3.0e-33
WP_116723292.1|3356869_3357058_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.8	6.3e-23
WP_094818783.1|3357008_3357284_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	46.7	8.6e-13
WP_094818782.1|3357280_3357628_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	78.3	3.0e-39
WP_019704505.1|3357624_3358164_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	5.7e-101
WP_024176410.1|3358160_3358460_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_040210598.1|3358629_3358869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094818781.1|3359019_3359598_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	2.2e-50
WP_094818780.1|3359611_3360592_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	67.5	2.7e-133
WP_065519871.1|3360604_3360982_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	3.9e-48
WP_094818779.1|3360991_3361801_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.9	5.9e-110
WP_094818778.1|3361797_3362712_-	conserved phage C-terminal domain-containing protein	NA	H2DE83	Erwinia_phage	60.6	1.8e-30
WP_023317571.1|3362668_3362881_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	72.7	2.2e-16
WP_004213338.1|3363118_3363580_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_024176406.1|3363605_3363815_-	cell division protein	NA	NA	NA	NA	NA
WP_019705289.1|3363909_3364554_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	40.7	8.2e-38
WP_094818777.1|3364853_3365777_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	62.9	1.5e-104
WP_040186300.1|3365862_3366162_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	47.8	1.0e-14
WP_094818776.1|3366161_3366947_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	1.3e-61
WP_094818775.1|3367074_3367566_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	53.4	5.1e-32
WP_064151808.1|3367562_3367826_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	78.0	1.1e-30
WP_094818774.1|3367818_3368463_+	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	42.8	1.1e-39
WP_004141386.1|3368462_3368675_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_038435237.1|3369470_3369689_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.7	3.0e-08
WP_000089156.1|3369989_3370226_+	excisionase	NA	NA	NA	NA	NA
WP_000741346.1|3370215_3371358_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	82.2	9.1e-173
WP_094818773.1|3371471_3372722_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
3373062:3373076	attR	AAAGAACGCCAGCCA	NA	NA	NA	NA
>prophage 10
NZ_CP054780	Klebsiella pneumoniae strain KP20194a chromosome, complete genome	5448829	3591230	3684181	5448829	portal,protease,tRNA,integrase,plate,tail,head,lysis,terminase,capsid	Salmonella_phage(58.62%)	94	3646756:3646774	3684256:3684274
WP_002898139.1|3591230_3592523_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3592613_3593957_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3593965_3594577_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3594699_3598953_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3599088_3599583_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_002898019.1|3600115_3601084_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|3601198_3602965_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3602965_3604687_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3604731_3605433_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3605786_3606005_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3606125_3608405_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3608435_3608753_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3609078_3609300_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3609376_3611317_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3611313_3612429_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3612575_3614234_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3614653_3615349_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3615464_3616364_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3616507_3618160_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3618170_3619139_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3619350_3619785_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3619936_3621655_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3621693_3622695_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3622705_3624148_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3624235_3625249_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3625245_3626076_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3626107_3627247_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3628124_3628640_+	lipoprotein	NA	NA	NA	NA	NA
WP_032419144.1|3628866_3629595_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3629615_3630347_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3630353_3631070_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3631069_3631738_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3631921_3632653_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3632695_3634168_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3634164_3634881_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3634959_3636087_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3636128_3636617_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3636674_3637520_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3637516_3638470_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3638480_3639614_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3639777_3640890_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3641238_3641718_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3641806_3642709_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3643530_3643818_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3644020_3644284_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3644290_3644674_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_004179131.1|3644940_3646626_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3646756:3646774	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3646845_3647064_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3647155_3648256_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3648252_3648738_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_014342962.1|3648734_3651128_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.0	1.1e-106
WP_002896220.1|3651354_3651474_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3651488_3651788_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3651840_3652356_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3652365_3653538_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3653676_3654753_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|3654782_3654986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3654982_3655714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019724930.1|3655717_3656452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150856.1|3658670_3659270_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3659262_3660171_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_032441567.1|3660157_3660520_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
WP_002896177.1|3660516_3661089_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|3661183_3661876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3661872_3662319_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3662311_3662743_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896170.1|3662705_3662852_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896168.1|3662838_3663267_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3663263_3663647_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3663651_3664161_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3664141_3664357_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3664360_3664564_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3664563_3665028_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3665123_3665774_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3665777_3666836_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3666852_3667686_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3667828_3669595_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3669594_3670620_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3670681_3672424_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3672699_3673377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3673491_3673725_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3673735_3673924_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|3674077_3676492_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3676488_3677346_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3677342_3677570_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3677569_3677803_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3677870_3678212_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3678175_3678376_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3678383_3678893_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3678925_3679147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3679292_3680171_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3680182_3681127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|3681225_3682713_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_014342959.1|3683200_3684181_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
3684256:3684274	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 11
NZ_CP054780	Klebsiella pneumoniae strain KP20194a chromosome, complete genome	5448829	4337165	4348818	5448829	integrase	Enterobacteria_phage(70.0%)	13	4337615:4337629	4360671:4360685
WP_004144574.1|4337165_4338269_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4337615:4337629	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4338279_4339533_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4339885_4341076_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4341063_4342014_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4342013_4342439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152202.1|4343006_4343573_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|4343590_4343836_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_062956184.1|4343832_4344570_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.9e-70
WP_002889915.1|4345111_4345378_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4345374_4345932_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4345928_4346156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4346152_4346473_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4346484_4348818_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4360671:4360685	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 12
NZ_CP054780	Klebsiella pneumoniae strain KP20194a chromosome, complete genome	5448829	4819455	4828980	5448829	transposase	Enterobacteria_phage(85.71%)	11	NA	NA
WP_004152207.1|4819455_4821789_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|4821803_4822124_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|4822120_4822348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153681.1|4822344_4822893_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_000556592.1|4822889_4823156_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004152204.1|4823716_4824454_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4824450_4824696_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4824713_4825280_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152201.1|4826020_4827100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152200.1|4827100_4827637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|4827999_4828980_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 1
NZ_CP054781	Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p1, complete sequence	195031	15236	41367	195031	integrase,transposase	Salmonella_phage(50.0%)	21	NA	NA
WP_004213558.1|15236_16166_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.4	5.6e-72
WP_004213560.1|16310_17090_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.4	6.0e-51
WP_004213562.1|17086_17908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014343465.1|18407_18869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|18825_19056_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|19052_19469_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004206609.1|19542_21105_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000361404.1|21089_22112_+	helicase UvrD	NA	NA	NA	NA	NA
WP_000405672.1|24737_25172_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004213585.1|25257_27663_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	46.1	1.0e-141
WP_000118563.1|27659_28736_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_004213590.1|28865_29423_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	2.6e-48
WP_004213592.1|29425_32395_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.3	0.0e+00
WP_000427619.1|32473_33478_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_004213594.1|33763_34258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|34466_35447_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004225014.1|35691_36660_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	2.2e-172
WP_048333570.1|36681_37152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048333569.1|38695_39139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040217257.1|39159_39948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074428168.1|40398_41367_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.0	1.6e-170
>prophage 2
NZ_CP054781	Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p1, complete sequence	195031	81518	150120	195031	protease,transposase	Escherichia_phage(17.65%)	57	NA	NA
WP_000019473.1|81518_82499_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004213615.1|83933_84155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213613.1|84297_85200_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004213611.1|85272_85824_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004213609.1|86204_86837_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000019473.1|87262_88243_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_011251259.1|88578_89232_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_094818822.1|91847_92414_-	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_004225014.1|92525_93494_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	2.2e-172
WP_004213252.1|94193_95021_+	ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.4	2.2e-11
WP_004213250.1|95042_95999_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004902166.1|95998_97003_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_004902162.1|98827_100027_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_004902159.1|100124_100511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213915.1|100747_101065_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_004145290.1|101614_102124_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	8.8e-19
WP_004213918.1|102984_103179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023302795.1|103876_105076_-	MFS transporter	NA	NA	NA	NA	NA
WP_004213920.1|105232_106957_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_004213921.1|106957_107905_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_004213922.1|107904_109638_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_004213923.1|109641_110919_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_004213924.1|111000_113202_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_004213925.1|113868_114129_+	DUF1471 domain-containing protein	NA	A0A1B2IE60	Erwinia_phage	51.0	1.1e-06
WP_004213927.1|114170_114731_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004902152.1|114768_115197_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_004213932.1|115280_115556_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_011251327.1|115618_116110_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_004213934.1|116158_117079_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004213072.1|119869_120313_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004213073.1|120309_120540_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004213075.1|121147_122281_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_004213076.1|122296_122590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213077.1|122579_122786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213078.1|123137_123428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004225022.1|123417_124317_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_004215174.1|124365_126591_-	exclusion suppressor FxsA	NA	NA	NA	NA	NA
WP_004215173.1|126592_127495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004225020.1|127578_127761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004215188.1|127779_128241_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004215186.1|128356_129304_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004225018.1|129639_130635_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.7	3.1e-20
WP_004210218.1|130840_131854_-	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	26.0	5.8e-06
WP_077250518.1|132507_135465_+|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	22.8	2.3e-50
WP_004144375.1|136306_137167_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.7	9.0e-08
WP_011251321.1|138898_139534_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_011251320.1|139870_141112_-	VWA domain-containing protein	NA	A0A2D1GNA9	Pseudoalteromonas_phage	27.2	2.2e-10
WP_000301240.1|141196_141772_-	tellurium resistance cAMP binding protein TerE	NA	K4JRX3	Caulobacter_phage	41.6	9.6e-30
WP_004026609.1|141858_142437_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
WP_004026607.1|142475_143516_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.8e-71
WP_004026604.1|143539_143995_-	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_011251319.1|144017_145169_-	tellurium resistance system protein TerA	NA	NA	NA	NA	NA
WP_004196925.1|145165_145750_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	29.4	2.0e-11
WP_011251317.1|146060_147119_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_004181731.1|147130_148273_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.5	3.7e-33
WP_004181732.1|148265_149039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026596.1|149040_150120_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	1.7e-40
>prophage 3
NZ_CP054781	Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p1, complete sequence	195031	186873	194302	195031	transposase	Stx2-converting_phage(33.33%)	6	NA	NA
WP_004213807.1|186873_187842_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
WP_004902302.1|188169_189762_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
WP_004189161.1|189792_190143_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_004215130.1|190139_190580_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
WP_094818816.1|192164_193136_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_004211841.1|193135_194302_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	2.0e-223
>prophage 1
NZ_CP054782	Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence	133771	1796	55954	133771	transposase,protease	Escherichia_phage(37.5%)	51	NA	NA
WP_000616807.1|1796_2450_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|2542_2800_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|2732_3134_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|4444_5149_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013188475.1|5659_6535_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_013362812.1|6569_7538_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_001067855.1|9288_9993_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_174900808.1|11103_11808_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.5e-138
WP_000957857.1|12485_12674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064441864.1|12765_13302_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.8e-84
WP_000027057.1|13484_14345_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_012372818.1|14514_15270_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_015059004.1|15350_15632_-	sodium/hydrogen exchanger	NA	NA	NA	NA	NA
WP_001333089.1|18364_18646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361389.1|18768_19119_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_000959884.1|19121_20084_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_032146011.1|20230_20524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085883.1|20600_21284_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.6e-29
WP_001104881.1|21284_21506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274503.1|21519_21954_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001383963.1|22004_22781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001198928.1|23198_23624_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271762.1|23670_24093_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027493.1|24089_24281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012372796.1|24594_26262_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.3	1.7e-164
WP_000218642.1|27661_27892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170695.1|27943_29305_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_015059007.1|29351_29915_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	6.1e-21
WP_000290834.1|30757_31285_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	6.0e-47
WP_000006003.1|31342_31576_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000845953.1|33728_34163_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276217.1|34159_34879_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001312861.1|35158_35317_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001272251.1|36231_36528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234445.1|36638_37460_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	3.4e-44
WP_015059008.1|37756_38404_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_000124981.1|38680_39064_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_001067855.1|39344_40049_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004151610.1|41682_42585_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_002210513.1|42846_43608_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|43628_44489_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001138014.1|44729_47696_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001161490.1|47699_48260_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_013213990.1|49802_50081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013213989.1|50191_50617_+	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	37.3	5.3e-17
WP_013213988.1|50744_50900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013213987.1|50945_51242_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_004199234.1|52476_53358_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_013213985.1|53633_54614_-|transposase	IS481-like element ISKpn27 family transposase	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
WP_014343468.1|54736_55210_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
WP_001067855.1|55249_55954_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP054782	Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence	133771	93442	104601	133771		Escherichia_phage(50.0%)	10	NA	NA
WP_004118283.1|93442_94309_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_011977818.1|95418_96624_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
WP_011977819.1|96623_97598_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
WP_013214011.1|97679_98951_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	7.5e-152
WP_001568036.1|98950_99382_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_004178082.1|99788_101276_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152353.1|101524_102496_+	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_013214012.1|102498_103170_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001568040.1|103232_103463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568041.1|103899_104601_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
>prophage 1
NZ_CP054783	Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p3, complete sequence	87095	30100	61823	87095	transposase,integrase	Escherichia_phage(33.33%)	29	34534:34593	47820:48641
WP_004178082.1|30100_31588_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_045325066.1|31665_32091_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.3	3.7e-31
WP_108970993.1|32090_32870_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	51.0	3.7e-69
WP_053897648.1|33017_34574_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.1e-83
34534:34593	attL	AGGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGC	NA	NA	NA	NA
WP_001067855.1|34598_35303_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_094818827.1|35336_35861_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	48.4	1.2e-31
WP_000845048.1|36253_37267_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|37422_37896_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001067855.1|38142_38847_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000427619.1|40743_41748_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|41929_42106_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|42435_43251_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_071881958.1|43533_43785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|43815_45309_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|45519_45744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001446887.1|45740_46478_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001044210.1|46963_47104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|47109_47814_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_174892462.1|47893_48394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001011939.1|48543_49185_+	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
47820:48641	attR	GCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTGTTTAGAGTACTATATGCGCCTGCAACAGTGGGCCACCGAAAATATTAAAAAACTGCTTTATCTCGCGGGGGATGACGCGGTGATTAATTACGGGAAAATGCGGCTGGAATTTTTGCAGAAAGCACTGGCGCAGGATACCTCCGGTGACTTCTGCTTTCGTGTGCTGCATCCGGAAGTGTCTGGCCCGCCGGATATGAAAAAGGCTTCCGCCGGGTACCGTGACTTTATTATCGGTAACAGAGCGTTGCTGGATCTGGTGAATTCAGCCGGTGAAGGGGCTCCGGTTGCGCGTTATTCCGCTGATGAAATTCAGTCATTATTTTCGGCACAAATACAGGGGTCGGTGGATAAATACGGCGATAGTTTCCTGACGGATGATCCGTATGTGCTGGCGGAAGACAAGCTGCAAACCTGTCAGATGGAAATTGATTTAATGGCGGATGTGCTGAGAGCACCGCCCCGTGAATCCGCAGAACTGATCCGCTATGTATTTGCGGATGAGTGGCCGGAATAAATAAAACCGGGCTTAATACAGATTAAGCCCGTATCGGGTATTATTACTGAATACCAGACAGCTTACGGAGGACGGAATGTTACCCATTGAGACAACCAGACTGCCTTCTGATTATTAATATTTTTCACTATTAATCAGAAGGAATAACCATGAATTTTACCCGGATTGACCTGAATACCTGGAATCGCAGGGAACATTTTGCCCTTTATCGTCAGCAGATTAAATGCGGATTCAGCCTGACCACCAA	NA	NA	NA	NA
WP_001067855.1|49328_50033_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000164043.1|50210_50861_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804064.1|50966_52166_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|52197_53082_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001214976.1|53219_53627_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_040212993.1|55373_56477_+	peptidoglycan synthetase FtsI	NA	NA	NA	NA	NA
WP_012477595.1|56541_57399_+	class A beta-lactamase LAP-2	NA	Q1MVP3	Enterobacteria_phage	61.1	2.0e-92
WP_001516695.1|58995_59652_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001493761.1|60431_61823_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
