The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053614	Proteus mirabilis strain MPE0108 chromosome, complete genome	4029664	304791	314306	4029664	transposase	Klosneuvirus(14.29%)	8	NA	NA
WP_060557541.1|304791_306009_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.0	1.0e-25
WP_004246870.1|306126_306702_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.1	6.8e-68
WP_175212404.1|306958_308167_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.8	1.8e-187
WP_175212405.1|308189_308606_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	3.4e-45
WP_004246869.1|308822_309395_-	peptidylprolyl isomerase A	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	35.1	1.8e-12
WP_060556807.1|309669_310293_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_060556806.1|310762_311281_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	38.0	4.2e-16
WP_060556813.1|311507_314306_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.7	1.2e-72
>prophage 2
NZ_CP053614	Proteus mirabilis strain MPE0108 chromosome, complete genome	4029664	517695	526226	4029664	capsid	Cronobacter_phage(33.33%)	9	NA	NA
WP_012368586.1|517695_518730_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	41.3	2.5e-65
WP_135092165.1|519764_519983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167755263.1|520513_520669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135003225.1|520658_520823_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	64.5	1.8e-05
WP_152118458.1|521173_523876_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	31.9	9.0e-62
WP_152118457.1|523872_524103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152118459.1|524099_524588_-	host cell division inhibitor Icd-like protein	NA	A0A1W6JPK3	Morganella_phage	62.0	1.6e-38
WP_036918681.1|524679_525213_-|capsid	GPO family capsid scaffolding protein	capsid	A5X9H4	Aeromonas_virus	55.7	1.9e-32
WP_152118456.1|525209_526226_-|capsid	P2 family phage major capsid protein	capsid	F1BUM2	Cronobacter_phage	49.3	4.7e-80
>prophage 3
NZ_CP053614	Proteus mirabilis strain MPE0108 chromosome, complete genome	4029664	562234	626695	4029664	integrase,transposase,tRNA	Escherichia_phage(26.67%)	49	609629:609645	631301:631317
WP_060556649.1|562234_563263_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_060556648.1|563303_563978_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004249861.1|564095_564719_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.5	6.4e-64
WP_060556647.1|565087_567046_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.1	3.7e-89
WP_060556646.1|567210_567522_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_060556645.1|567518_569174_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_060556644.1|569496_571128_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_060556643.1|571146_571839_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_060556642.1|571842_573261_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_060556641.1|573251_573989_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004249867.1|580023_580710_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_175212410.1|580790_582188_+	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
WP_060556638.1|582272_583199_-	ribokinase	NA	NA	NA	NA	NA
WP_060556637.1|583479_584979_+	ATPase RavA	NA	A0A0N9PBE1	Sulfolobus_monocaudavirus	37.3	8.6e-22
WP_060556636.1|584986_586444_+	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_004246604.1|586444_587437_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.5	1.3e-50
WP_004246603.1|587597_588059_+	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_060556635.1|588158_588599_+	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_060556634.1|588978_590877_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_060556633.1|590873_591500_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_004246598.1|592114_592492_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_004246597.1|592523_593348_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_004246596.1|593393_593633_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_004246595.1|593694_594165_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_004246594.1|594177_594711_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_060556632.1|594725_596267_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_004246591.1|596324_597188_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_004246589.1|597222_598605_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_004246588.1|598626_599043_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_060556631.1|599193_600567_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	32.3	9.6e-28
WP_060556630.1|600723_602550_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1I9J5	Paramecium_bursaria_Chlorella_virus	44.6	2.1e-131
WP_001029679.1|602709_603531_+	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000267723.1|603517_605626_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001276994.1|605622_607290_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_071538080.1|608092_609667_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	99.4	2.8e-87
609629:609645	attL	GGCACTGTTGCAAATAG	NA	NA	NA	NA
WP_001067855.1|609691_610396_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000052512.1|610845_612321_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|612376_613261_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_121523926.1|613450_613684_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000018329.1|614689_615505_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|615655_616360_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000344784.1|616850_617711_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000287615.1|617761_619306_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
WP_001324342.1|619428_620952_+|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000983249.1|620938_621724_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	3.3e-33
WP_000376623.1|622258_622759_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000679427.1|623717_624065_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|624287_624740_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000845054.1|625681_626695_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
631301:631317	attR	GGCACTGTTGCAAATAG	NA	NA	NA	NA
>prophage 4
NZ_CP053614	Proteus mirabilis strain MPE0108 chromosome, complete genome	4029664	631352	688164	4029664	integrase,transposase	Escherichia_phage(26.67%)	46	640801:640815	691476:691490
WP_171265581.1|631352_632057_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.3	5.5e-120
WP_001447541.1|632981_633866_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214122.1|634088_635303_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001255015.1|635330_635636_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015344975.1|635747_637241_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_172767591.1|637271_637514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175233693.1|638138_638630_-	AAC(3) family N-acetyltransferase	NA	O64018	Bacillus_phage	53.0	3.8e-27
WP_000742814.1|638635_639661_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
640801:640815	attL	ATTTTCAGCGTGACA	NA	NA	NA	NA
WP_004201164.1|642264_643077_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|643080_643446_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|643450_644089_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|644099_645131_-	protein-disulfide reductase DsbD N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004201171.1|645135_645465_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_004201172.1|645658_645949_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_004201176.1|646004_647645_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
WP_015056391.1|649572_649857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376616.1|652786_652990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|653117_653957_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|653950_654298_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|654520_654973_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_063840321.1|655069_655624_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_000845054.1|655915_656929_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_000454193.1|657131_657482_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|657607_658168_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001067784.1|661588_662293_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_175233679.1|664439_665537_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	29.3	1.4e-16
WP_001255015.1|665564_665870_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172767591.1|667500_667743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172767592.1|667690_668446_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_001442844.1|668867_669350_-	phosphotransferase	NA	NA	NA	NA	NA
WP_175233680.1|669354_669891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001199192.1|670119_670896_-	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_004201164.1|672490_673303_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|673306_673672_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|673676_674315_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201172.1|675883_676174_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_015056391.1|679789_680074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|680834_681539_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000184001.1|681644_682850_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|683005_683209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000679427.1|684166_684514_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206316.1|684677_685469_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000777554.1|685485_685959_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_070342364.1|685955_686801_-	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
WP_000071896.1|687186_687723_+|integrase	class 2 integron integrase IntI2	integrase	A0A1P8DJJ6	Virus_Rctr41k	34.4	6.9e-14
WP_000497519.1|687837_688164_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	52.0	2.1e-18
691476:691490	attR	ATTTTCAGCGTGACA	NA	NA	NA	NA
>prophage 5
NZ_CP053614	Proteus mirabilis strain MPE0108 chromosome, complete genome	4029664	1825723	1834253	4029664		Mycobacterium_phage(28.57%)	9	NA	NA
WP_060556952.1|1825723_1826923_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.1	1.3e-28
WP_060556953.1|1827532_1828501_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.3	2.4e-134
WP_072196779.1|1828526_1830653_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.2e-205
WP_060556954.1|1830681_1831086_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	2.8e-12
WP_004246071.1|1831097_1831322_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_060556955.1|1831603_1832077_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246068.1|1832274_1832484_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_004246061.1|1832787_1833276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246058.1|1833878_1834253_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
>prophage 6
NZ_CP053614	Proteus mirabilis strain MPE0108 chromosome, complete genome	4029664	2044818	2123367	4029664	protease,plate,tRNA	Bacillus_phage(17.65%)	57	NA	NA
WP_060557068.1|2044818_2045133_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.2e-13
WP_060557069.1|2045163_2047458_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.0e-170
WP_004244560.1|2047577_2047796_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_060557070.1|2048115_2048808_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_060557071.1|2048809_2050561_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.3e-18
WP_060557072.1|2050563_2052333_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.9	1.7e-21
WP_060557073.1|2052474_2053434_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.8	1.5e-64
WP_004244566.1|2053976_2054471_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_175233682.1|2054598_2058420_+	DNA translocase FtsK 4TM domain-containing protein	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
WP_175212431.1|2058532_2059138_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_060557161.1|2059148_2060498_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.3	6.9e-79
WP_060557076.1|2060630_2061920_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.0	9.2e-97
WP_081045311.1|2062101_2062434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060557077.1|2062834_2063884_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_060557078.1|2063956_2064853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060557079.1|2065213_2065954_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.4	1.4e-20
WP_060557080.1|2066061_2068344_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	7.9e-160
WP_004244577.1|2068398_2069253_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_060557081.1|2069923_2071681_-	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
WP_060557082.1|2071908_2072946_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_060557083.1|2073021_2074287_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_060557084.1|2074421_2075855_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	24.7	1.5e-07
WP_060557085.1|2075991_2077080_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.0	4.4e-84
WP_060557086.1|2077276_2078563_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004244585.1|2078851_2079529_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_004244586.1|2079710_2081384_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004244587.1|2081448_2081736_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
WP_060557087.1|2082153_2084523_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	31.6	1.9e-23
WP_004244589.1|2084559_2086305_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	8.4e-61
WP_060557088.1|2086301_2087303_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004247631.1|2087799_2088015_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004244593.1|2088429_2088609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244594.1|2088613_2089375_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_175212432.1|2089483_2090329_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_004244596.1|2090708_2091482_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_004244597.1|2091491_2092814_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_060557090.1|2092794_2093523_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_060557091.1|2093519_2097977_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_060557092.1|2098278_2098932_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	78.3	8.4e-99
WP_004247637.1|2099354_2100068_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_060557093.1|2100403_2102119_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004244605.1|2102451_2103000_+	YcbK family protein	NA	NA	NA	NA	NA
WP_049208325.1|2103043_2103694_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004244607.1|2103786_2104260_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_060557094.1|2104350_2106087_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_060557095.1|2106079_2107435_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_060557096.1|2107472_2111021_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_060557097.1|2111023_2112487_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_060557098.1|2112492_2113143_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_004244614.1|2113144_2113933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060557099.1|2113936_2116648_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	9.0e-86
WP_060557100.1|2116656_2117412_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_060557101.1|2117404_2118763_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004244619.1|2118764_2119316_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_060557163.1|2119317_2120586_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_060557102.1|2120590_2121628_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_060557103.1|2121591_2123367_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 7
NZ_CP053614	Proteus mirabilis strain MPE0108 chromosome, complete genome	4029664	2203092	2245276	4029664	integrase,terminase,lysis,plate,head	Burkholderia_phage(21.95%)	57	2203898:2203922	2227310:2227334
WP_004247034.1|2203092_2203506_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	40.3	1.4e-19
WP_060557166.1|2203552_2203738_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	54.2	8.4e-12
2203898:2203922	attL	CGGTCAGCATTCACAACTGACTTAT	NA	NA	NA	NA
WP_060557150.1|2204580_2206167_+	hypothetical protein	NA	P79669	Escherichia_phage	88.3	3.8e-278
WP_060557151.1|2206404_2207580_-|integrase	site-specific integrase	integrase	A0A2D1GN00	Marinobacter_phage	32.2	5.5e-32
WP_020945460.1|2207581_2207794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_170936158.1|2208038_2208209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020945461.1|2208208_2208379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250516.1|2208406_2208586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020945462.1|2208633_2209134_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	57.0	3.6e-41
WP_087740825.1|2209133_2211101_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	39.5	6.4e-118
WP_004250523.1|2211113_2211374_-	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	45.3	7.9e-08
WP_004250525.1|2211373_2211706_-	hypothetical protein	NA	H9C158	Pectobacterium_phage	39.2	1.6e-05
WP_060556278.1|2211963_2212164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060556279.1|2212160_2212541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087740824.1|2212891_2213584_-	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	48.8	2.4e-51
WP_049219173.1|2213690_2213936_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020945464.1|2213984_2214440_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	55.4	9.9e-30
WP_004250533.1|2214457_2214682_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	55.4	9.5e-18
WP_036895394.1|2214683_2215535_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	60.4	8.0e-33
WP_036895392.1|2215527_2216121_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	47.6	1.1e-44
WP_175212434.1|2216113_2217487_+	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	45.4	1.9e-100
WP_060556541.1|2217635_2219045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060556540.1|2219152_2219746_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	54.2	5.6e-57
WP_060556640.1|2219757_2220069_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	68.8	1.3e-33
WP_087740823.1|2220103_2220652_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	44.9	8.2e-31
WP_175212380.1|2220779_2221100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250554.1|2221234_2221432_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	65.4	1.1e-09
WP_155195676.1|2221574_2222621_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	71.4	2.4e-143
WP_004250558.1|2222889_2223159_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	47.8	3.3e-17
WP_060557316.1|2223158_2223629_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	59.2	8.9e-50
WP_162837620.1|2223610_2223769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060557317.1|2223771_2224239_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	48.0	6.0e-22
WP_060557318.1|2224269_2224506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087740821.1|2224639_2225668_+|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	38.6	1.1e-36
WP_060556612.1|2225856_2227254_+|terminase	phage terminase large subunit	terminase	A0A2K9V3I6	Faecalibacterium_phage	40.3	5.6e-84
WP_087740820.1|2227258_2228761_+	DUF1073 domain-containing protein	NA	A0A2H4P6S9	Pseudomonas_phage	42.6	2.1e-100
2227310:2227334	attR	CGGTCAGCATTCACAACTGACTTAT	NA	NA	NA	NA
WP_087741162.1|2228798_2229512_+|head	phage head morphogenesis protein	head	A0A2H5BG15	Pseudoalteromonas_phage	35.7	1.4e-33
WP_087740819.1|2229508_2230768_+	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	51.3	1.6e-45
WP_036908136.1|2230767_2231265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087740818.1|2231264_2232332_+	DUF2184 domain-containing protein	NA	A0A088C493	Shewanella_sp._phage	39.3	8.8e-53
WP_060556539.1|2232401_2232743_+	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	35.5	1.2e-08
WP_080047799.1|2232745_2233177_+	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	32.4	3.3e-11
WP_004250581.1|2233176_2233635_+	hypothetical protein	NA	Q6IWU9	Burkholderia_phage	37.6	3.2e-12
WP_004250582.1|2233634_2234006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060557411.1|2233992_2234508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087740817.1|2234516_2236004_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	38.1	6.6e-83
WP_004250586.1|2236014_2236467_+	hypothetical protein	NA	I7ATP4	Escherichia_phage	38.1	5.8e-22
WP_004250588.1|2236507_2236966_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	6.7e-26
WP_087740816.1|2237049_2239401_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	28.8	2.6e-17
WP_087740815.1|2239402_2239930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020945489.1|2239929_2240247_+	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	32.3	3.3e-08
WP_087740814.1|2240212_2241028_+	hypothetical protein	NA	A1Z005	Burkholderia_virus	26.3	1.1e-10
WP_175212435.1|2241030_2241723_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	39.4	9.1e-35
WP_004250600.1|2241719_2242064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087740813.1|2242056_2243244_+|plate	baseplate J/gp47 family protein	plate	Q6IWQ3	Burkholderia_phage	40.3	1.1e-69
WP_004250603.1|2243240_2243897_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	40.3	7.5e-39
WP_087740812.1|2243902_2245276_+	hypothetical protein	NA	Q6IWQ6	Burkholderia_phage	38.0	2.2e-16
>prophage 8
NZ_CP053614	Proteus mirabilis strain MPE0108 chromosome, complete genome	4029664	2322714	2360177	4029664	integrase,terminase,portal,lysis,tail,tRNA,protease,capsid,head	Morganella_phage(25.81%)	48	2322371:2322389	2343824:2343842
2322371:2322389	attL	AGATATTTTTTGTGATAAA	NA	NA	NA	NA
WP_060556849.1|2322714_2323818_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004247118.1|2323923_2324376_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_060556848.1|2324368_2324998_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004251822.1|2325136_2326390_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.8e-20
WP_104836382.1|2326499_2327633_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	72.2	1.4e-154
WP_087803552.1|2327607_2327859_-	excisionase	NA	NA	NA	NA	NA
WP_049219749.1|2327944_2328469_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	61.0	2.3e-54
WP_175212437.1|2328614_2328758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081353450.1|2328990_2329422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071233779.1|2329411_2331286_-	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	26.7	5.4e-13
WP_103004815.1|2331382_2332039_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNY2	Morganella_phage	73.5	1.3e-86
WP_103004814.1|2332134_2332362_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	50.0	7.9e-12
WP_104836383.1|2332400_2332877_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	60.4	1.8e-45
WP_017628377.1|2333138_2333318_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	3.4e-10
WP_104836862.1|2333875_2334391_+	hypothetical protein	NA	U5P0A0	Shigella_phage	44.2	3.5e-23
WP_098943240.1|2334412_2335219_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	62.1	4.0e-90
WP_115370361.1|2335215_2336241_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	46.8	1.9e-84
WP_104836385.1|2336268_2336667_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	53.5	1.6e-31
WP_004244726.1|2337007_2337220_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	81.4	3.1e-26
WP_104836386.1|2337551_2338010_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_104836387.1|2338622_2340176_+	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	26.4	2.4e-19
WP_175212448.1|2341084_2341297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836388.1|2341777_2342200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046334538.1|2342265_2342535_+	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	2.7e-19
WP_104836389.1|2342534_2343005_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	61.8	8.9e-50
WP_104836390.1|2343147_2343609_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	47.2	4.8e-24
WP_036937625.1|2343881_2344085_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
2343824:2343842	attR	AGATATTTTTTGTGATAAA	NA	NA	NA	NA
WP_036937622.1|2344911_2345424_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	65.7	1.9e-58
WP_036976739.1|2345505_2345913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036937620.1|2345909_2346248_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	68.8	8.3e-42
WP_017628364.1|2346365_2346833_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	1.6e-43
WP_017628363.1|2346786_2348520_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.6	3.1e-148
WP_017628362.1|2348519_2349788_+|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.4	1.8e-201
WP_004242476.1|2349805_2350474_+|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.8	6.6e-83
WP_017628361.1|2350477_2351644_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.5	1.6e-169
WP_017628360.1|2351682_2351982_+|head,tail	phage head-tail connector protein	head,tail	K7PKV5	Enterobacterial_phage	65.3	5.7e-34
WP_017628359.1|2351981_2352311_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_017628358.1|2352300_2352774_+	HK97 gp10 family phage protein	NA	A0A0R6PHU8	Moraxella_phage	30.2	8.2e-11
WP_017628357.1|2352779_2353121_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017628356.1|2353130_2353796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628355.1|2353860_2354277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628354.1|2354273_2354552_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_004242485.1|2354576_2354768_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_017628353.1|2354894_2358170_+|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	46.7	2.9e-54
WP_017628352.1|2358170_2358767_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.3	1.6e-51
WP_017628351.1|2358766_2359348_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.5	8.1e-53
WP_049219722.1|2359364_2359700_+	hypothetical protein	NA	Q775B6	Bordetella_phage	35.3	3.7e-10
WP_049219720.1|2359778_2360177_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	46.2	7.1e-32
>prophage 9
NZ_CP053614	Proteus mirabilis strain MPE0108 chromosome, complete genome	4029664	2605938	2615953	4029664		Escherichia_phage(66.67%)	8	NA	NA
WP_060559196.1|2605938_2607996_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.7	5.7e-32
WP_060559194.1|2608007_2609708_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_060559192.1|2610051_2610738_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_060559190.1|2610737_2611199_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	35.3	5.3e-15
WP_060559188.1|2611266_2611878_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	38.3	7.3e-28
WP_060559186.1|2612017_2612878_-	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	35.9	3.7e-25
WP_004242892.1|2612879_2613497_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
WP_060559184.1|2613508_2615953_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.5	1.9e-220
>prophage 10
NZ_CP053614	Proteus mirabilis strain MPE0108 chromosome, complete genome	4029664	3126107	3145030	4029664	holin,plate,lysis	Escherichia_phage(28.57%)	21	NA	NA
WP_114078355.1|3126107_3128546_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.6	1.0e-261
WP_004243609.1|3128557_3129175_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
WP_060558511.1|3129178_3129955_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.4	1.1e-41
WP_060558509.1|3130071_3130614_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.2	3.2e-19
WP_017628013.1|3131179_3131359_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_060558505.1|3132794_3133451_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	40.4	1.3e-35
WP_175212387.1|3133447_3134635_-|plate	baseplate J/gp47 family protein	plate	A0A2H5BG53	Pseudoalteromonas_phage	37.4	1.9e-72
WP_060558501.1|3134627_3134972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060558493.1|3134968_3135661_-	hypothetical protein	NA	A1Z003	Burkholderia_virus	37.1	2.7e-34
WP_060558491.1|3135663_3136476_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.6	3.1e-42
WP_060558490.1|3136444_3136765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060558488.1|3136777_3137266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060558486.1|3137268_3139572_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	24.9	1.0e-18
WP_060558484.1|3139654_3140113_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.1e-25
WP_060554762.1|3140172_3140625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060558476.1|3140635_3142123_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.5	1.4e-77
WP_004248364.1|3142131_3142644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060558474.1|3142680_3143130_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_060558473.1|3143126_3143531_-	hypothetical protein	NA	A0A0A0RQM4	Escherichia_phage	48.6	1.7e-25
WP_060558471.1|3143533_3143833_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	5.0e-22
WP_060558469.1|3144214_3145030_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	2.7e-54
>prophage 11
NZ_CP053614	Proteus mirabilis strain MPE0108 chromosome, complete genome	4029664	3644334	3678708	4029664	capsid,terminase,holin,tail	Cronobacter_phage(23.08%)	48	NA	NA
WP_124725226.1|3644334_3645579_-	hypothetical protein	NA	A0A291AXF7	Shigella_phage	54.8	1.5e-43
WP_060556902.1|3645636_3648105_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	51.8	1.2e-251
WP_060556903.1|3648091_3648484_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	57.9	1.4e-43
WP_060556904.1|3648480_3648951_-	DUF1833 family protein	NA	F1C5F1	Cronobacter_phage	51.3	2.6e-41
WP_060556905.1|3648950_3649427_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	71.6	9.6e-60
WP_155195932.1|3649430_3652607_-	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	39.9	1.4e-82
WP_060556273.1|3652674_3653397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155195948.1|3653519_3654272_-	Rha family transcriptional regulator	NA	A0A2I7RX10	Vibrio_phage	42.8	6.4e-42
WP_155195934.1|3655030_3655201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172767708.1|3655298_3655622_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_060556627.1|3655694_3656387_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	71.9	1.2e-90
WP_060556626.1|3656436_3657192_-	Ig-like domain-containing protein	NA	A0A1W6JNT1	Morganella_phage	68.5	1.8e-92
WP_060556625.1|3657265_3657634_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	30.3	1.1e-10
WP_049257616.1|3657630_3657999_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	68.9	1.2e-41
WP_060556624.1|3658000_3658339_-	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	53.4	3.2e-25
WP_060556623.1|3658338_3658737_-	hypothetical protein	NA	I6S619	Salmonella_phage	76.5	2.5e-53
WP_060556622.1|3658793_3658967_-	hypothetical protein	NA	Q5G8X9	Enterobacteria_phage	50.0	1.2e-07
WP_060556621.1|3658976_3660071_-	hypothetical protein	NA	G0ZND9	Cronobacter_phage	68.6	1.5e-145
WP_060556620.1|3660083_3660533_-	hypothetical protein	NA	I6S1Q2	Salmonella_phage	67.8	2.2e-45
WP_060556619.1|3660532_3661807_-	hypothetical protein	NA	G0ZND7	Cronobacter_phage	64.2	9.5e-155
WP_060556618.1|3661810_3662740_-|capsid	minor capsid protein	capsid	A0A1V0E5Q2	Salmonella_phage	56.0	1.0e-89
WP_060556617.1|3662690_3664046_-	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	63.7	5.0e-162
WP_060556616.1|3664045_3665296_-|terminase	terminase	terminase	A0A1V0E5Q3	Salmonella_phage	78.4	1.0e-201
WP_060556615.1|3665279_3665705_-	hypothetical protein	NA	A0A068CGC1	Acinetobacter_phage	63.6	1.1e-33
WP_124725282.1|3665721_3665907_-	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	75.4	1.5e-21
WP_036905461.1|3665937_3666297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036905457.1|3666277_3667060_-	KilA-N domain-containing protein	NA	K7PH51	Enterobacterial_phage	43.4	4.2e-52
WP_081045303.1|3667498_3667753_-	peptidase	NA	NA	NA	NA	NA
WP_060556604.1|3667640_3668042_-	hypothetical protein	NA	A0A1P8DTG0	Proteus_phage	43.9	1.1e-08
WP_060556605.1|3668038_3668443_-	structural protein	NA	A0A2I7RXE2	Vibrio_phage	50.8	1.2e-26
WP_036970165.1|3668435_3668723_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_004916901.1|3668719_3669109_-	membrane protein	NA	S4TRS4	Salmonella_phage	35.0	4.2e-13
WP_060556606.1|3669243_3670011_-	KilA-N domain-containing protein	NA	G9BW66	Planktothrix_phage	34.3	1.5e-17
WP_060556907.1|3670487_3671327_-	antitermination protein	NA	H6WRZ1	Salmonella_phage	45.6	5.3e-61
WP_060556908.1|3671323_3671524_-	NinH	NA	A5VW84	Enterobacteria_phage	50.0	1.6e-08
WP_060556909.1|3671513_3672107_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	92.9	2.0e-94
WP_060556914.1|3672218_3672443_-	DUF3310 domain-containing protein	NA	A0A0A6Z5B6	Enterobacter_phage	75.4	6.1e-25
WP_155195940.1|3672448_3672895_-	recombination protein NinB	NA	A0A1W6JNZ4	Morganella_phage	57.3	6.3e-37
WP_131728024.1|3673305_3673533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060556611.1|3673529_3673754_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_152964332.1|3673804_3673972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060556819.1|3673991_3674903_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	60.9	2.2e-97
WP_060556820.1|3674913_3675600_-	DNA replication protein	NA	A0A1P8DTF3	Proteus_phage	87.7	4.7e-108
WP_060556821.1|3675596_3676535_-	replication protein	NA	A0A1P8DTG2	Proteus_phage	53.2	9.3e-83
WP_060556822.1|3676531_3677227_-	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	71.3	1.2e-82
WP_060556823.1|3677248_3677581_-	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	97.3	5.1e-52
WP_036895075.1|3677716_3677902_-	hypothetical protein	NA	A4KWW0	Enterobacteria_phage	58.3	2.3e-09
WP_060556824.1|3677997_3678708_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	61.7	7.3e-80
>prophage 12
NZ_CP053614	Proteus mirabilis strain MPE0108 chromosome, complete genome	4029664	3682169	3689180	4029664	integrase	Salmonella_phage(25.0%)	12	3681520:3681535	3697947:3697962
3681520:3681535	attL	CGCATTGAAACAGAAT	NA	NA	NA	NA
WP_060558095.1|3682169_3682847_+	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	31.8	3.6e-20
WP_060558093.1|3682839_3683457_+	ERF family protein	NA	A0A1W6JP21	Morganella_phage	69.8	1.7e-72
WP_060558092.1|3683456_3683987_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	61.4	2.5e-56
WP_049210558.1|3684037_3684256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060558090.1|3684286_3684574_+	hypothetical protein	NA	A0A1B0UY37	Roseobacter_phage	41.9	5.3e-13
WP_060558088.1|3684573_3684843_+	hypothetical protein	NA	A0A1U9ZAB3	Proteus_phage	40.9	9.0e-07
WP_049211072.1|3684835_3685081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060558087.1|3685239_3685605_+	DUF2528 family protein	NA	NA	NA	NA	NA
WP_060558086.1|3685608_3685836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060558085.1|3685822_3686425_+	DNA methyltransferase	NA	A0A248SKY3	Klebsiella_phage	52.0	1.5e-54
WP_060558083.1|3686860_3688018_+|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	74.9	5.2e-176
WP_060554830.1|3688307_3689180_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.8	5.7e-34
3697947:3697962	attR	CGCATTGAAACAGAAT	NA	NA	NA	NA
>prophage 13
NZ_CP053614	Proteus mirabilis strain MPE0108 chromosome, complete genome	4029664	3885253	3996866	4029664	portal,terminase,integrase,tail,tRNA,holin,protease,capsid,plate,head	Cronobacter_phage(44.23%)	107	3918867:3918883	3968309:3968325
WP_060557654.1|3885253_3885907_+|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_060557653.1|3886151_3886952_-	co-chaperone DjlA	NA	NA	NA	NA	NA
WP_060557652.1|3887377_3889744_+	LPS assembly protein LptD	NA	NA	NA	NA	NA
WP_072196800.1|3889791_3891129_+	peptidylprolyl isomerase SurA	NA	NA	NA	NA	NA
WP_060557650.1|3891118_3892120_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_004245541.1|3892112_3892931_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_004245543.1|3892960_3893338_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_060557649.1|3893340_3894162_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH	NA	A0A2R4ALY4	Aeromonas_phage	45.6	9.5e-07
WP_060557648.1|3894537_3895023_-	type 3 dihydrofolate reductase	NA	A0A1I9S5V6	Bacillus_phage	43.8	1.1e-31
WP_060557647.1|3895711_3896893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060557646.1|3896999_3900257_-	autotransporter Pta	NA	NA	NA	NA	NA
WP_060557645.1|3900717_3902139_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_060557644.1|3902493_3903243_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_060557643.1|3903307_3906265_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	28.9	1.9e-81
WP_060557642.1|3906298_3908194_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	36.1	2.3e-96
WP_060557641.1|3908301_3908892_-	esterase YqiA	NA	NA	NA	NA	NA
WP_060557640.1|3908895_3909735_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_060557639.1|3909966_3910596_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	36.6	5.6e-23
WP_060557638.1|3910809_3912207_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_004249472.1|3912532_3913261_+	DUF1190 family protein	NA	A0A060ACJ9	Cronobacter_phage	36.1	2.0e-24
WP_060557637.1|3913268_3914432_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	44.8	3.7e-89
WP_060557636.1|3914685_3915471_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_004245565.1|3915646_3916300_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.0	2.3e-43
WP_060557635.1|3916785_3917094_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_036905068.1|3917404_3918829_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.2	5.1e-40
3918867:3918883	attL	AATACCATAACTTGTTA	NA	NA	NA	NA
WP_060557634.1|3918929_3921764_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_060557633.1|3921788_3922712_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_060557632.1|3922931_3923552_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_060557631.1|3923579_3924803_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	46.4	3.8e-92
WP_004245575.1|3924828_3925179_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_004245577.1|3925283_3925940_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_060557630.1|3926311_3927010_+	RraA family protein	NA	NA	NA	NA	NA
WP_060557629.1|3927029_3927554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245582.1|3927624_3928023_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_060557628.1|3928081_3929488_+	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_060557627.1|3929553_3930582_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	4.6e-107
WP_001144069.1|3930924_3931140_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_060557626.1|3931253_3933002_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.1	2.3e-74
WP_004245586.1|3933192_3935049_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.2	1.6e-33
WP_175233683.1|3935786_3936167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175233684.1|3936223_3936424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175233685.1|3936923_3938570_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	55.2	6.5e-148
WP_060557704.1|3938556_3939117_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	52.2	6.2e-42
WP_060557620.1|3939127_3939850_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	32.3	1.9e-35
WP_175233686.1|3939846_3941763_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	61.3	3.7e-110
WP_049212312.1|3941766_3942324_-	protein phage	NA	F1BUK5	Cronobacter_phage	64.1	2.8e-66
WP_175233687.1|3942316_3943501_-|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	65.8	2.7e-151
WP_060557617.1|3943490_3943826_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	69.0	5.4e-33
WP_175233688.1|3943836_3946353_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	44.6	2.3e-128
WP_165544879.1|3946352_3946496_-	hypothetical protein	NA	A5X9I8	Aeromonas_virus	60.9	3.9e-09
WP_049220759.1|3946540_3946810_-|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	48.2	2.8e-16
WP_175233689.1|3946918_3947293_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	52.3	2.8e-22
WP_060557615.1|3947292_3947625_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	73.3	4.7e-37
WP_036907276.1|3947621_3947915_-|holin	phage holin family protein	holin	S4TP56	Salmonella_phage	51.2	1.1e-16
WP_036907273.1|3947929_3948382_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	62.6	1.2e-48
WP_060557614.1|3948381_3949500_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	64.9	1.8e-133
WP_175233690.1|3949515_3950214_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	58.9	8.0e-63
WP_060557611.1|3950210_3950699_-|tail	phage tail protein	tail	Q94MZ1	Haemophilus_virus	26.6	1.6e-06
WP_036907264.1|3950695_3951148_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	53.3	2.4e-36
WP_175233691.1|3951482_3952187_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	53.5	6.6e-65
WP_060557607.1|3952186_3953218_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	73.2	2.9e-138
WP_060557606.1|3953244_3954039_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	38.8	9.8e-33
WP_060557703.1|3954204_3955995_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	65.4	2.0e-222
WP_060557605.1|3955995_3957021_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	63.1	6.1e-128
WP_036907246.1|3957017_3957326_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	60.4	2.1e-28
WP_036907243.1|3957327_3957510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131728034.1|3957601_3958093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036907238.1|3958098_3958299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175233692.1|3958285_3960415_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	54.3	5.2e-182
WP_049212279.1|3960416_3960668_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_109407776.1|3960744_3961092_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	40.9	1.6e-16
WP_060557598.1|3961256_3961766_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	49.1	8.4e-38
WP_049212271.1|3961798_3962029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060557597.1|3962176_3962767_+	phage repressor protein CI	NA	F1BUN8	Cronobacter_phage	34.3	1.9e-28
WP_060557596.1|3962786_3963740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060557595.1|3963726_3964782_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	61.1	3.8e-117
WP_164484803.1|3965098_3965203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060557702.1|3966306_3966780_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_060557594.1|3966820_3967147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060557593.1|3967139_3967937_-	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_004245589.1|3969232_3970150_+	hypothetical protein	NA	NA	NA	NA	NA
3968309:3968325	attR	AATACCATAACTTGTTA	NA	NA	NA	NA
WP_012368332.1|3970231_3970411_-	DUF2474 domain-containing protein	NA	NA	NA	NA	NA
WP_060557592.1|3970388_3971396_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_060557591.1|3971395_3972748_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_060557590.1|3973410_3975696_+	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_060557589.1|3975763_3976675_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060557588.1|3976886_3978407_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.6	6.1e-07
WP_060557587.1|3978562_3980131_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	1.6e-10
WP_060557586.1|3980531_3981212_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245603.1|3981302_3981878_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_060557585.1|3981954_3982533_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.0	3.2e-33
WP_004245605.1|3982600_3983626_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004245607.1|3983660_3984116_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_060557584.1|3984140_3985289_-	TerD family protein	NA	NA	NA	NA	NA
WP_004245609.1|3985289_3985874_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_060557583.1|3986264_3987410_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	1.6e-31
WP_060557582.1|3987402_3988173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060557581.1|3988175_3989252_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	32.5	2.0e-36
WP_060557580.1|3989251_3990196_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_004245615.1|3990469_3990937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060557579.1|3991073_3991481_-	TonB family protein	NA	NA	NA	NA	NA
WP_060557701.1|3991577_3992291_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004245618.1|3992443_3993460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060557578.1|3993463_3994408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060557700.1|3994404_3995028_-	tetracycline resistance transcriptional repressor TetR(J)	NA	NA	NA	NA	NA
WP_060557577.1|3995118_3996315_+	tetracycline efflux MFS transporter Tet(J)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.0	5.1e-09
WP_004249433.1|3996575_3996866_-|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	44.7	7.5e-15
