The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053681	Proteus mirabilis strain MPE0147 chromosome, complete genome	3970238	500572	519495	3970238	lysis,holin,plate	Escherichia_phage(28.57%)	21	NA	NA
WP_114078355.1|500572_503011_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.6	1.0e-261
WP_004243609.1|503022_503640_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
WP_060558511.1|503643_504420_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.4	1.1e-41
WP_060558509.1|504536_505079_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.2	3.2e-19
WP_017628013.1|505644_505824_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_060558505.1|507259_507916_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	40.4	1.3e-35
WP_175212387.1|507912_509100_-|plate	baseplate J/gp47 family protein	plate	A0A2H5BG53	Pseudoalteromonas_phage	37.4	1.9e-72
WP_060558501.1|509092_509437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060558493.1|509433_510126_-	hypothetical protein	NA	A1Z003	Burkholderia_virus	37.1	2.7e-34
WP_060558491.1|510128_510941_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.6	3.1e-42
WP_060558490.1|510909_511230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060558488.1|511242_511731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060558486.1|511733_514037_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	24.9	1.0e-18
WP_060558484.1|514119_514578_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.1e-25
WP_060554762.1|514637_515090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060558476.1|515100_516588_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.5	1.4e-77
WP_004248364.1|516596_517109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060558474.1|517145_517595_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_060558473.1|517591_517996_-	hypothetical protein	NA	A0A0A0RQM4	Escherichia_phage	48.6	1.7e-25
WP_060558471.1|517998_518298_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	5.0e-22
WP_060558469.1|518679_519495_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	2.7e-54
>prophage 2
NZ_CP053681	Proteus mirabilis strain MPE0147 chromosome, complete genome	3970238	1018797	1053171	3970238	tail,holin,capsid,terminase	Cronobacter_phage(23.08%)	48	NA	NA
WP_124725226.1|1018797_1020042_-	hypothetical protein	NA	A0A291AXF7	Shigella_phage	54.8	1.5e-43
WP_060556902.1|1020099_1022568_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	51.8	1.2e-251
WP_060556903.1|1022554_1022947_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	57.9	1.4e-43
WP_060556904.1|1022943_1023414_-	DUF1833 family protein	NA	F1C5F1	Cronobacter_phage	51.3	2.6e-41
WP_060556905.1|1023413_1023890_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	71.6	9.6e-60
WP_155195932.1|1023893_1027070_-	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	39.9	1.4e-82
WP_060556273.1|1027137_1027860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155195948.1|1027982_1028735_-	Rha family transcriptional regulator	NA	A0A2I7RX10	Vibrio_phage	42.8	6.4e-42
WP_155195934.1|1029493_1029664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172767708.1|1029761_1030085_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_060556627.1|1030157_1030850_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	71.9	1.2e-90
WP_060556626.1|1030899_1031655_-	Ig-like domain-containing protein	NA	A0A1W6JNT1	Morganella_phage	68.5	1.8e-92
WP_060556625.1|1031728_1032097_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	30.3	1.1e-10
WP_049257616.1|1032093_1032462_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	68.9	1.2e-41
WP_060556624.1|1032463_1032802_-	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	53.4	3.2e-25
WP_060556623.1|1032801_1033200_-	hypothetical protein	NA	I6S619	Salmonella_phage	76.5	2.5e-53
WP_060556622.1|1033256_1033430_-	hypothetical protein	NA	Q5G8X9	Enterobacteria_phage	50.0	1.2e-07
WP_060556621.1|1033439_1034534_-	hypothetical protein	NA	G0ZND9	Cronobacter_phage	68.6	1.5e-145
WP_060556620.1|1034546_1034996_-	hypothetical protein	NA	I6S1Q2	Salmonella_phage	67.8	2.2e-45
WP_060556619.1|1034995_1036270_-	hypothetical protein	NA	G0ZND7	Cronobacter_phage	64.2	9.5e-155
WP_060556618.1|1036273_1037203_-|capsid	minor capsid protein	capsid	A0A1V0E5Q2	Salmonella_phage	56.0	1.0e-89
WP_060556617.1|1037153_1038509_-	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	63.7	5.0e-162
WP_060556616.1|1038508_1039759_-|terminase	terminase	terminase	A0A1V0E5Q3	Salmonella_phage	78.4	1.0e-201
WP_060556615.1|1039742_1040168_-	hypothetical protein	NA	A0A068CGC1	Acinetobacter_phage	63.6	1.1e-33
WP_124725282.1|1040184_1040370_-	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	75.4	1.5e-21
WP_036905461.1|1040400_1040760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036905457.1|1040740_1041523_-	KilA-N domain-containing protein	NA	K7PH51	Enterobacterial_phage	43.4	4.2e-52
WP_081045303.1|1041961_1042216_-	peptidase	NA	NA	NA	NA	NA
WP_060556604.1|1042103_1042505_-	hypothetical protein	NA	A0A1P8DTG0	Proteus_phage	43.9	1.1e-08
WP_060556605.1|1042501_1042906_-	structural protein	NA	A0A2I7RXE2	Vibrio_phage	50.8	1.2e-26
WP_036970165.1|1042898_1043186_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_004916901.1|1043182_1043572_-	membrane protein	NA	S4TRS4	Salmonella_phage	35.0	4.2e-13
WP_060556606.1|1043706_1044474_-	KilA-N domain-containing protein	NA	G9BW66	Planktothrix_phage	34.3	1.5e-17
WP_060556907.1|1044950_1045790_-	antitermination protein	NA	H6WRZ1	Salmonella_phage	45.6	5.3e-61
WP_060556908.1|1045786_1045987_-	NinH	NA	A5VW84	Enterobacteria_phage	50.0	1.6e-08
WP_060556909.1|1045976_1046570_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	92.9	2.0e-94
WP_060556914.1|1046681_1046906_-	DUF3310 domain-containing protein	NA	A0A0A6Z5B6	Enterobacter_phage	75.4	6.1e-25
WP_155195940.1|1046911_1047358_-	recombination protein NinB	NA	A0A1W6JNZ4	Morganella_phage	57.3	6.3e-37
WP_131728024.1|1047768_1047996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060556611.1|1047992_1048217_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_152964332.1|1048267_1048435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060556819.1|1048454_1049366_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	60.9	2.2e-97
WP_060556820.1|1049376_1050063_-	DNA replication protein	NA	A0A1P8DTF3	Proteus_phage	87.7	4.7e-108
WP_060556821.1|1050059_1050998_-	replication protein	NA	A0A1P8DTG2	Proteus_phage	53.2	9.3e-83
WP_060556822.1|1050994_1051690_-	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	71.3	1.2e-82
WP_060556823.1|1051711_1052044_-	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	97.3	5.1e-52
WP_036895075.1|1052179_1052365_-	hypothetical protein	NA	A4KWW0	Enterobacteria_phage	58.3	2.3e-09
WP_060556824.1|1052460_1053171_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	61.7	7.3e-80
>prophage 3
NZ_CP053681	Proteus mirabilis strain MPE0147 chromosome, complete genome	3970238	1056632	1063643	3970238	integrase	Salmonella_phage(25.0%)	12	1055983:1055998	1072410:1072425
1055983:1055998	attL	CGCATTGAAACAGAAT	NA	NA	NA	NA
WP_060558095.1|1056632_1057310_+	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	31.8	3.6e-20
WP_060558093.1|1057302_1057920_+	ERF family protein	NA	A0A1W6JP21	Morganella_phage	69.8	1.7e-72
WP_060558092.1|1057919_1058450_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	61.4	2.5e-56
WP_049210558.1|1058500_1058719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060558090.1|1058749_1059037_+	hypothetical protein	NA	A0A1B0UY37	Roseobacter_phage	41.9	5.3e-13
WP_060558088.1|1059036_1059306_+	hypothetical protein	NA	A0A1U9ZAB3	Proteus_phage	40.9	9.0e-07
WP_049211072.1|1059298_1059544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060558087.1|1059702_1060068_+	DUF2528 family protein	NA	NA	NA	NA	NA
WP_060558086.1|1060071_1060299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060558085.1|1060285_1060888_+	DNA methyltransferase	NA	A0A248SKY3	Klebsiella_phage	52.0	1.5e-54
WP_060558083.1|1061323_1062481_+|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	74.9	5.2e-176
WP_060554830.1|1062770_1063643_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.8	5.7e-34
1072410:1072425	attR	CGCATTGAAACAGAAT	NA	NA	NA	NA
>prophage 4
NZ_CP053681	Proteus mirabilis strain MPE0147 chromosome, complete genome	3970238	1323637	1332485	3970238		Caulobacter_phage(50.0%)	9	NA	NA
WP_060557587.1|1323637_1325206_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	1.6e-10
WP_060557586.1|1325606_1326287_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245603.1|1326377_1326953_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_060557585.1|1327029_1327608_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.0	3.2e-33
WP_004245605.1|1327675_1328701_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004245607.1|1328735_1329191_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_060557584.1|1329215_1330364_-	TerD family protein	NA	NA	NA	NA	NA
WP_004245609.1|1330364_1330949_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_060557583.1|1331339_1332485_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	1.6e-31
>prophage 5
NZ_CP053681	Proteus mirabilis strain MPE0147 chromosome, complete genome	3970238	1679560	1689075	3970238	transposase	Klosneuvirus(14.29%)	8	NA	NA
WP_060557541.1|1679560_1680778_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.0	1.0e-25
WP_004246870.1|1680895_1681471_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.1	6.8e-68
WP_175212404.1|1681727_1682936_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.8	1.8e-187
WP_175212405.1|1682958_1683375_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	3.4e-45
WP_004246869.1|1683591_1684164_-	peptidylprolyl isomerase A	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	35.1	1.8e-12
WP_060556807.1|1684438_1685062_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_060556806.1|1685531_1686050_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	38.0	4.2e-16
WP_060556813.1|1686276_1689075_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.7	1.2e-72
>prophage 6
NZ_CP053681	Proteus mirabilis strain MPE0147 chromosome, complete genome	3970238	1892464	1900995	3970238	capsid	Cronobacter_phage(33.33%)	9	NA	NA
WP_012368586.1|1892464_1893499_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	41.3	2.5e-65
WP_135092165.1|1894533_1894752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167755263.1|1895282_1895438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135003225.1|1895427_1895592_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	64.5	1.8e-05
WP_152118458.1|1895942_1898645_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	31.9	9.0e-62
WP_152118457.1|1898641_1898872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152118459.1|1898868_1899357_-	host cell division inhibitor Icd-like protein	NA	A0A1W6JPK3	Morganella_phage	62.0	1.6e-38
WP_036918681.1|1899448_1899982_-|capsid	GPO family capsid scaffolding protein	capsid	A5X9H4	Aeromonas_virus	55.7	1.9e-32
WP_152118456.1|1899978_1900995_-|capsid	P2 family phage major capsid protein	capsid	F1BUM2	Cronobacter_phage	49.3	4.7e-80
>prophage 7
NZ_CP053681	Proteus mirabilis strain MPE0147 chromosome, complete genome	3970238	1937003	1995726	3970238	transposase,integrase,tRNA	Escherichia_phage(28.57%)	45	1936384:1936402	1985450:1985468
1936384:1936402	attL	AAACTATGCACTAAAAGCA	NA	NA	NA	NA
WP_060556649.1|1937003_1938032_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_060556648.1|1938072_1938747_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004249861.1|1938864_1939488_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.5	6.4e-64
WP_060556647.1|1939856_1941815_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.1	3.7e-89
WP_060556646.1|1941979_1942291_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_060556645.1|1942287_1943943_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_060556644.1|1944265_1945897_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_060556643.1|1945915_1946608_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_060556642.1|1946611_1948030_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_060556641.1|1948020_1948758_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004249867.1|1954795_1955482_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_175212410.1|1955562_1956960_+	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
WP_060556638.1|1957044_1957971_-	ribokinase	NA	NA	NA	NA	NA
WP_060556637.1|1958251_1959751_+	ATPase RavA	NA	A0A0N9PBE1	Sulfolobus_monocaudavirus	37.3	8.6e-22
WP_060556636.1|1959758_1961216_+	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_004246604.1|1961216_1962209_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.5	1.3e-50
WP_004246603.1|1962369_1962831_+	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_060556635.1|1962930_1963371_+	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_060556634.1|1963750_1965649_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_060556633.1|1965645_1966272_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_004246598.1|1966886_1967264_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_004246597.1|1967295_1968120_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_004246596.1|1968165_1968405_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_004246595.1|1968466_1968937_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_004246594.1|1968949_1969483_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_060556632.1|1969497_1971039_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_004246591.1|1971096_1971960_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_004246589.1|1971994_1973377_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_004246588.1|1973398_1973815_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_060556631.1|1973965_1975339_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	32.3	9.6e-28
WP_060556630.1|1975495_1977322_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1I9J5	Paramecium_bursaria_Chlorella_virus	44.6	2.1e-131
WP_001029679.1|1977481_1978303_+	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000267723.1|1978289_1980398_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001276994.1|1980394_1982062_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_071538080.1|1982864_1984439_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	99.4	2.8e-87
WP_001067855.1|1984463_1985168_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000052512.1|1985617_1987093_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
1985450:1985468	attR	TGCTTTTAGTGCATAGTTT	NA	NA	NA	NA
WP_000155092.1|1987148_1988033_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_121523926.1|1988222_1988456_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001067855.1|1988569_1989274_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|1989463_1990279_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|1990429_1991134_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000344784.1|1991624_1992485_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000287615.1|1992535_1994080_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
WP_001324342.1|1994202_1995726_+|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
>prophage 8
NZ_CP053681	Proteus mirabilis strain MPE0147 chromosome, complete genome	3970238	2000458	2032736	3970238	transposase,integrase	Escherichia_phage(33.33%)	33	1990452:1990466	2036048:2036062
1990452:1990466	attL	ATTTTCAGCGTGACA	NA	NA	NA	NA
WP_000845054.1|2000458_2001472_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_000454193.1|2001674_2002025_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|2002150_2002711_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_046788546.1|2005647_2006049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|2006133_2006838_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_001447541.1|2007762_2008647_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214122.1|2008869_2010084_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001255015.1|2010111_2010417_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015344975.1|2010528_2012022_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_172767591.1|2012052_2012295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172767592.1|2012242_2012998_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_000742814.1|2013419_2014445_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_001199192.1|2014673_2015450_-	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_001067855.1|2015563_2016268_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004201164.1|2017048_2017861_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|2017864_2018230_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|2018234_2018873_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|2018883_2019915_-	protein-disulfide reductase DsbD N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004201171.1|2019919_2020249_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_004201172.1|2020442_2020733_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_004201176.1|2020788_2022429_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
WP_015056392.1|2022617_2024147_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_015056391.1|2024357_2024642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|2025403_2026108_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000184001.1|2026213_2027419_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|2027574_2027778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|2027905_2028745_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|2028738_2029086_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206316.1|2029249_2030041_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000777554.1|2030057_2030531_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_070342364.1|2030527_2031373_-	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
WP_000071896.1|2031758_2032295_+|integrase	class 2 integron integrase IntI2	integrase	A0A1P8DJJ6	Virus_Rctr41k	34.4	6.9e-14
WP_000497519.1|2032409_2032736_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	52.0	2.1e-18
2036048:2036062	attR	ATTTTCAGCGTGACA	NA	NA	NA	NA
>prophage 9
NZ_CP053681	Proteus mirabilis strain MPE0147 chromosome, complete genome	3970238	3170436	3178966	3970238		Mycobacterium_phage(28.57%)	9	NA	NA
WP_060556952.1|3170436_3171636_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.1	1.3e-28
WP_060556953.1|3172245_3173214_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.3	2.4e-134
WP_072196779.1|3173239_3175366_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.2e-205
WP_060556954.1|3175394_3175799_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	2.8e-12
WP_004246071.1|3175810_3176035_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_060556955.1|3176316_3176790_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246068.1|3176987_3177197_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_004246061.1|3177500_3177989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246058.1|3178591_3178966_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
>prophage 10
NZ_CP053681	Proteus mirabilis strain MPE0147 chromosome, complete genome	3970238	3389536	3468073	3970238	protease,tRNA,plate	Bacillus_phage(17.65%)	57	NA	NA
WP_060557068.1|3389536_3389851_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.2e-13
WP_060557069.1|3389881_3392176_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.0e-170
WP_004244560.1|3392295_3392514_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_060557070.1|3392833_3393526_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_060557071.1|3393527_3395279_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.3e-18
WP_060557072.1|3395281_3397051_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.9	1.7e-21
WP_060557073.1|3397192_3398152_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.8	1.5e-64
WP_004244566.1|3398694_3399189_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_175212430.1|3399316_3403126_+	DNA translocase FtsK 4TM domain-containing protein	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
WP_175212431.1|3403238_3403844_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_060557161.1|3403854_3405204_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.3	6.9e-79
WP_060557076.1|3405336_3406626_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.0	9.2e-97
WP_081045311.1|3406807_3407140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060557077.1|3407540_3408590_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_060557078.1|3408662_3409559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060557079.1|3409919_3410660_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.4	1.4e-20
WP_060557080.1|3410767_3413050_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	7.9e-160
WP_004244577.1|3413104_3413959_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_060557081.1|3414629_3416387_-	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
WP_060557082.1|3416614_3417652_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_060557083.1|3417727_3418993_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_060557084.1|3419127_3420561_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	24.7	1.5e-07
WP_060557085.1|3420697_3421786_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.0	4.4e-84
WP_060557086.1|3421982_3423269_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004244585.1|3423557_3424235_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_004244586.1|3424416_3426090_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004244587.1|3426154_3426442_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
WP_060557087.1|3426859_3429229_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	31.6	1.9e-23
WP_004244589.1|3429265_3431011_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	8.4e-61
WP_060557088.1|3431007_3432009_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004247631.1|3432505_3432721_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004244593.1|3433135_3433315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244594.1|3433319_3434081_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_175212432.1|3434189_3435035_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_004244596.1|3435414_3436188_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_004244597.1|3436197_3437520_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_060557090.1|3437500_3438229_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_060557091.1|3438225_3442683_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_060557092.1|3442984_3443638_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	78.3	8.4e-99
WP_004247637.1|3444060_3444774_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_060557093.1|3445109_3446825_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004244605.1|3447157_3447706_+	YcbK family protein	NA	NA	NA	NA	NA
WP_049208325.1|3447749_3448400_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004244607.1|3448492_3448966_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_060557094.1|3449056_3450793_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_060557095.1|3450785_3452141_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_060557096.1|3452178_3455727_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_060557097.1|3455729_3457193_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_060557098.1|3457198_3457849_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_004244614.1|3457850_3458639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060557099.1|3458642_3461354_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	9.0e-86
WP_060557100.1|3461362_3462118_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_060557101.1|3462110_3463469_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004244619.1|3463470_3464022_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_060557163.1|3464023_3465292_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_060557102.1|3465296_3466334_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_060557103.1|3466297_3468073_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 11
NZ_CP053681	Proteus mirabilis strain MPE0147 chromosome, complete genome	3970238	3547798	3589982	3970238	head,lysis,integrase,terminase,plate	Burkholderia_phage(21.95%)	56	3548604:3548628	3572016:3572040
WP_004247034.1|3547798_3548212_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	40.3	1.4e-19
WP_060557166.1|3548258_3548444_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	54.2	8.4e-12
3548604:3548628	attL	CGGTCAGCATTCACAACTGACTTAT	NA	NA	NA	NA
WP_060557150.1|3549286_3550873_+	hypothetical protein	NA	P79669	Escherichia_phage	88.3	3.8e-278
WP_060557151.1|3551110_3552286_-|integrase	site-specific integrase	integrase	A0A2D1GN00	Marinobacter_phage	32.2	5.5e-32
WP_020945460.1|3552287_3552500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020945461.1|3552914_3553085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250516.1|3553112_3553292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020945462.1|3553339_3553840_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	57.0	3.6e-41
WP_087740825.1|3553839_3555807_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	39.5	6.4e-118
WP_004250523.1|3555819_3556080_-	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	45.3	7.9e-08
WP_004250525.1|3556079_3556412_-	hypothetical protein	NA	H9C158	Pectobacterium_phage	39.2	1.6e-05
WP_060556278.1|3556669_3556870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060556279.1|3556866_3557247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087740824.1|3557597_3558290_-	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	48.8	2.4e-51
WP_049219173.1|3558396_3558642_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020945464.1|3558690_3559146_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	55.4	9.9e-30
WP_004250533.1|3559163_3559388_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	55.4	9.5e-18
WP_036895394.1|3559389_3560241_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	60.4	8.0e-33
WP_036895392.1|3560233_3560827_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	47.6	1.1e-44
WP_175212434.1|3560819_3562193_+	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	45.4	1.9e-100
WP_060556541.1|3562341_3563751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060556540.1|3563858_3564452_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	54.2	5.6e-57
WP_060556640.1|3564463_3564775_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	68.8	1.3e-33
WP_087740823.1|3564809_3565358_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	44.9	8.2e-31
WP_175212380.1|3565485_3565806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250554.1|3565940_3566138_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	65.4	1.1e-09
WP_155195676.1|3566280_3567327_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	71.4	2.4e-143
WP_004250558.1|3567595_3567865_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	47.8	3.3e-17
WP_060557316.1|3567864_3568335_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	59.2	8.9e-50
WP_162837620.1|3568316_3568475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060557317.1|3568477_3568945_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	48.0	6.0e-22
WP_060557318.1|3568975_3569212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087740821.1|3569345_3570374_+|terminase	terminase small subunit	terminase	C5IHM0	Burkholderia_virus	38.6	1.1e-36
WP_060556612.1|3570562_3571960_+|terminase	phage terminase large subunit	terminase	A0A2K9V3I6	Faecalibacterium_phage	40.3	5.6e-84
WP_087740820.1|3571964_3573467_+	DUF1073 domain-containing protein	NA	A0A2H4P6S9	Pseudomonas_phage	42.6	2.1e-100
3572016:3572040	attR	CGGTCAGCATTCACAACTGACTTAT	NA	NA	NA	NA
WP_087741162.1|3573504_3574218_+|head	phage head morphogenesis protein	head	A0A2H5BG15	Pseudoalteromonas_phage	35.7	1.4e-33
WP_087740819.1|3574214_3575474_+	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	51.3	1.6e-45
WP_036908136.1|3575473_3575971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087740818.1|3575970_3577038_+	DUF2184 domain-containing protein	NA	A0A088C493	Shewanella_sp._phage	39.3	8.8e-53
WP_060556539.1|3577107_3577449_+	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	35.5	1.2e-08
WP_080047799.1|3577451_3577883_+	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	32.4	3.3e-11
WP_004250581.1|3577882_3578341_+	hypothetical protein	NA	Q6IWU9	Burkholderia_phage	37.6	3.2e-12
WP_004250582.1|3578340_3578712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060557411.1|3578698_3579214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087740817.1|3579222_3580710_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	38.1	6.6e-83
WP_004250586.1|3580720_3581173_+	hypothetical protein	NA	I7ATP4	Escherichia_phage	38.1	5.8e-22
WP_004250588.1|3581213_3581672_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	6.7e-26
WP_087740816.1|3581755_3584107_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	28.8	2.6e-17
WP_087740815.1|3584108_3584636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020945489.1|3584635_3584953_+	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	32.3	3.3e-08
WP_087740814.1|3584918_3585734_+	hypothetical protein	NA	A1Z005	Burkholderia_virus	26.3	1.1e-10
WP_175212435.1|3585736_3586429_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	39.4	9.1e-35
WP_004250600.1|3586425_3586770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087740813.1|3586762_3587950_+|plate	baseplate J/gp47 family protein	plate	Q6IWQ3	Burkholderia_phage	40.3	1.1e-69
WP_004250603.1|3587946_3588603_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	40.3	7.5e-39
WP_087740812.1|3588608_3589982_+	hypothetical protein	NA	Q6IWQ6	Burkholderia_phage	38.0	2.2e-16
>prophage 12
NZ_CP053681	Proteus mirabilis strain MPE0147 chromosome, complete genome	3970238	3667420	3704883	3970238	head,protease,lysis,capsid,integrase,tRNA,portal,terminase,tail	Morganella_phage(25.81%)	48	3667077:3667095	3688530:3688548
3667077:3667095	attL	AGATATTTTTTGTGATAAA	NA	NA	NA	NA
WP_060556849.1|3667420_3668524_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004247118.1|3668629_3669082_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_060556848.1|3669074_3669704_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004251822.1|3669842_3671096_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.8e-20
WP_104836382.1|3671205_3672339_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	72.2	1.4e-154
WP_087803552.1|3672313_3672565_-	excisionase	NA	NA	NA	NA	NA
WP_049219749.1|3672650_3673175_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	61.0	2.3e-54
WP_175212437.1|3673320_3673464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081353450.1|3673696_3674128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071233779.1|3674117_3675992_-	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	26.7	5.4e-13
WP_103004815.1|3676088_3676745_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNY2	Morganella_phage	73.5	1.3e-86
WP_103004814.1|3676840_3677068_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	50.0	7.9e-12
WP_104836383.1|3677106_3677583_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	60.4	1.8e-45
WP_017628377.1|3677844_3678024_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	3.4e-10
WP_104836862.1|3678581_3679097_+	hypothetical protein	NA	U5P0A0	Shigella_phage	44.2	3.5e-23
WP_098943240.1|3679118_3679925_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	62.1	4.0e-90
WP_115370361.1|3679921_3680947_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	46.8	1.9e-84
WP_104836385.1|3680974_3681373_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	53.5	1.6e-31
WP_004244726.1|3681713_3681926_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	81.4	3.1e-26
WP_104836386.1|3682257_3682716_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_104836387.1|3683328_3684882_+	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	26.4	2.4e-19
WP_175212448.1|3685790_3686003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836388.1|3686483_3686906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046334538.1|3686971_3687241_+	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	2.7e-19
WP_104836389.1|3687240_3687711_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	61.8	8.9e-50
WP_104836390.1|3687853_3688315_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	47.2	4.8e-24
WP_036937625.1|3688587_3688791_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
3688530:3688548	attR	AGATATTTTTTGTGATAAA	NA	NA	NA	NA
WP_036937622.1|3689617_3690130_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	65.7	1.9e-58
WP_036976739.1|3690211_3690619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036937620.1|3690615_3690954_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	68.8	8.3e-42
WP_017628364.1|3691071_3691539_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	1.6e-43
WP_017628363.1|3691492_3693226_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.6	3.1e-148
WP_017628362.1|3693225_3694494_+|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.4	1.8e-201
WP_004242476.1|3694511_3695180_+|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.8	6.6e-83
WP_017628361.1|3695183_3696350_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.5	1.6e-169
WP_017628360.1|3696388_3696688_+|head,tail	phage head-tail connector protein	head,tail	K7PKV5	Enterobacterial_phage	65.3	5.7e-34
WP_017628359.1|3696687_3697017_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_017628358.1|3697006_3697480_+	HK97 gp10 family phage protein	NA	A0A0R6PHU8	Moraxella_phage	30.2	8.2e-11
WP_017628357.1|3697485_3697827_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017628356.1|3697836_3698502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628355.1|3698566_3698983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628354.1|3698979_3699258_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_004242485.1|3699282_3699474_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_017628353.1|3699600_3702876_+|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	46.7	2.9e-54
WP_017628352.1|3702876_3703473_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.3	1.6e-51
WP_017628351.1|3703472_3704054_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.5	8.1e-53
WP_049219722.1|3704070_3704406_+	hypothetical protein	NA	Q775B6	Bordetella_phage	35.3	3.7e-10
WP_049219720.1|3704484_3704883_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	46.2	7.1e-32
>prophage 13
NZ_CP053681	Proteus mirabilis strain MPE0147 chromosome, complete genome	3970238	3950644	3960659	3970238		Escherichia_phage(66.67%)	8	NA	NA
WP_060559196.1|3950644_3952702_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.7	5.7e-32
WP_060559194.1|3952713_3954414_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_060559192.1|3954757_3955444_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_060559190.1|3955443_3955905_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	35.3	5.3e-15
WP_060559188.1|3955972_3956584_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	38.3	7.3e-28
WP_060559186.1|3956723_3957584_-	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	35.9	3.7e-25
WP_004242892.1|3957585_3958203_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
WP_060559184.1|3958214_3960659_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.5	1.9e-220
