The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053685	Proteus mirabilis strain MPE5203 chromosome, complete genome	3920300	380637	389493	3920300		Caulobacter_phage(50.0%)	9	NA	NA
WP_046334925.1|380637_382206_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
WP_012368337.1|382606_383287_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245603.1|383383_383959_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_004249446.1|384035_384614_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_049196995.1|384681_385707_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.0e-74
WP_004245607.1|385741_386197_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_104836741.1|386221_387370_-	TerD family protein	NA	NA	NA	NA	NA
WP_004250201.1|387370_387955_-	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_017827550.1|388347_389493_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	1.2e-31
>prophage 2
NZ_CP053685	Proteus mirabilis strain MPE5203 chromosome, complete genome	3920300	458883	477916	3920300	integrase,transposase	Escherichia_phage(44.44%)	22	467328:467387	478224:478285
WP_004574636.1|458883_460173_+|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.4	9.5e-86
WP_001261740.1|460352_461144_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_032084014.1|461228_462449_-	EreA family erythromycin esterase	NA	NA	NA	NA	NA
WP_032084013.1|462641_463115_-	trimethoprim-resistant dihydrofolate reductase DfrA32	NA	A0A1B2IBQ4	Erwinia_phage	33.1	6.5e-16
WP_001067855.1|464122_464827_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000184001.1|464980_466186_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|466341_466545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|466632_467337_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
467328:467387	attL	TGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTG	NA	NA	NA	NA
WP_124743826.1|467500_468340_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|468333_468681_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|468903_469356_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000186237.1|469440_470073_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001334766.1|470210_471041_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|471171_471726_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|471869_472574_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|472703_473519_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|473708_474413_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001038045.1|475245_475905_-	tetracycline resistance transcriptional repressor TetR(C)	NA	NA	NA	NA	NA
WP_053409934.1|475997_477188_+	tetracycline efflux MFS transporter Tet(C)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.0	8.1e-07
WP_002310911.1|477091_477430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071533317.1|477426_477612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000015696.1|477637_477916_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
478224:478285	attR	CACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAGG	NA	NA	NA	NA
>prophage 3
NZ_CP053685	Proteus mirabilis strain MPE5203 chromosome, complete genome	3920300	1435323	1474290	3920300	tRNA,transposase,protease	Salmonella_phage(22.22%)	36	NA	NA
WP_175215604.1|1435323_1436541_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.7	5.3e-187
WP_012368599.1|1436563_1436980_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	1.5e-45
WP_046334229.1|1437090_1438110_-	fimbrial protein	NA	NA	NA	NA	NA
WP_049197477.1|1438119_1440645_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_004246313.1|1440657_1441317_-	molecular chaperone	NA	NA	NA	NA	NA
WP_004246312.1|1441381_1441903_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_063108944.1|1442114_1442978_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041701521.1|1444274_1447610_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_004246309.1|1447632_1448544_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_004246308.1|1448632_1449691_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_004253041.1|1449806_1450352_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	39.5	1.3e-28
WP_060554997.1|1450951_1451278_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_020946610.1|1451283_1451553_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_004246297.1|1452500_1453655_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_004249636.1|1453876_1454344_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_175215605.1|1454357_1455674_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	33.3	6.2e-16
WP_004253034.1|1455695_1457705_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.0	3.3e-61
WP_004246293.1|1457673_1458615_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_004246291.1|1458724_1459015_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_060554999.1|1459108_1460392_+	GTPase HflX	NA	NA	NA	NA	NA
WP_004246289.1|1460484_1461759_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_004246288.1|1461761_1462766_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_004249629.1|1463217_1464516_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	34.5	1.4e-65
WP_004249627.1|1464941_1465370_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_004246285.1|1465408_1467898_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.9	1.5e-66
WP_170827695.1|1468013_1468745_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_004246283.1|1468905_1469301_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_004246282.1|1469309_1469627_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|1469631_1469859_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_175215606.1|1469902_1470352_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_046335070.1|1470450_1471110_-	opacity-associated protein OapA	NA	NA	NA	NA	NA
WP_004246279.1|1471480_1471729_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_004246277.1|1471740_1471866_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_004246276.1|1471869_1472517_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_175215607.1|1472642_1473059_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.0	2.0e-45
WP_175215608.1|1473081_1474290_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	81.0	2.1e-188
>prophage 4
NZ_CP053685	Proteus mirabilis strain MPE5203 chromosome, complete genome	3920300	2264449	2276415	3920300		Mycobacterium_phage(25.0%)	13	NA	NA
WP_046334484.1|2264449_2265649_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
WP_004247427.1|2266258_2267227_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	3.5e-133
WP_004252248.1|2267252_2269379_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.5e-205
WP_004246072.1|2269407_2269812_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
WP_004246071.1|2269823_2270048_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_004246069.1|2270329_2270803_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246068.1|2271000_2271210_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_162492994.1|2271394_2271535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246058.1|2272278_2272653_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
WP_004246057.1|2272668_2273634_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_004246056.1|2273735_2274380_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026090527.1|2274741_2275005_-	YbeD family protein	NA	NA	NA	NA	NA
WP_004246054.1|2275203_2276415_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.1	8.6e-105
>prophage 5
NZ_CP053685	Proteus mirabilis strain MPE5203 chromosome, complete genome	3920300	2473299	2551807	3920300	tRNA,plate,protease	Bacillus_phage(23.53%)	57	NA	NA
WP_004244558.1|2473299_2473614_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
WP_004244559.1|2473644_2475939_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.3e-170
WP_004244560.1|2476058_2476277_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004247616.1|2476596_2477289_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_175215708.1|2477290_2479042_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.0	1.0e-18
WP_017628444.1|2479044_2480814_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.5	3.0e-21
WP_004247618.1|2480955_2481915_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.8	1.2e-64
WP_004244566.1|2482457_2482952_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_175215709.1|2483079_2486874_+	DNA translocase FtsK 4TM domain-containing protein	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
WP_004244569.1|2486986_2487592_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_012367706.1|2487602_2488952_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.8e-79
WP_004244571.1|2489085_2490375_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	4.1e-97
WP_004252020.1|2490554_2490887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161682529.1|2491285_2492335_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_004244574.1|2492407_2493313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244575.1|2493671_2494412_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.3e-20
WP_004244576.1|2494519_2496802_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.0e-159
WP_004244577.1|2496856_2497711_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_046335159.1|2498381_2500139_-	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
WP_004244579.1|2500366_2501404_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_175215710.1|2501478_2502753_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_060554586.1|2502889_2504320_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	24.4	4.4e-07
WP_004244582.1|2504456_2505545_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.0	5.7e-84
WP_017628441.1|2505741_2507028_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004244585.1|2507316_2507994_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_004244586.1|2508175_2509849_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004244587.1|2509913_2510201_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
WP_175215711.1|2510615_2512985_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	29.7	9.4e-23
WP_004244589.1|2513021_2514767_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	8.4e-61
WP_046335154.1|2514763_2515765_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004247631.1|2516260_2516476_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004244593.1|2516890_2517070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244594.1|2517074_2517836_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_046335153.1|2517959_2518790_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_004244596.1|2519169_2519943_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_004244597.1|2519952_2521275_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_004247634.1|2521255_2521987_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_046335151.1|2521983_2526441_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_060554589.1|2526723_2527377_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	79.9	2.4e-101
WP_004247637.1|2527782_2528496_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_004244603.1|2528838_2530554_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004244605.1|2530885_2531434_+	YcbK family protein	NA	NA	NA	NA	NA
WP_004247640.1|2531483_2532134_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004244607.1|2532226_2532700_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_060554590.1|2532790_2534527_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004244609.1|2534519_2535875_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004244610.1|2535912_2539461_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_175215712.1|2539463_2540927_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004244612.1|2540932_2541583_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_004244614.1|2541584_2542373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175215713.1|2542376_2545088_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.7	4.9e-84
WP_004244617.1|2545096_2545852_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004247647.1|2545844_2547203_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004244619.1|2547204_2547756_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004247648.1|2547757_2549026_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_004244621.1|2549030_2550068_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_046334530.1|2550031_2551807_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 6
NZ_CP053685	Proteus mirabilis strain MPE5203 chromosome, complete genome	3920300	2599690	2656079	3920300	capsid,tail,lysis,terminase,integrase,holin	Morganella_phage(40.82%)	83	2596624:2596640	2655268:2655284
2596624:2596640	attL	AGATAAAAATATTTTTT	NA	NA	NA	NA
WP_175215720.1|2599690_2601742_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.4	5.1e-17
WP_004244689.1|2601746_2602205_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_004247691.1|2602344_2602758_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_004244691.1|2602822_2603143_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_046335282.1|2603342_2603627_+	acylphosphatase	NA	NA	NA	NA	NA
WP_004244693.1|2603629_2603959_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_071425905.1|2604401_2605586_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	57.3	2.8e-132
WP_063693452.1|2605589_2605796_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.8	8.7e-10
WP_175215721.1|2606084_2606630_-	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	60.9	1.8e-57
WP_175215722.1|2606635_2606827_-	hypothetical protein	NA	E9NIE1	Enterobacter_phage	66.1	1.4e-17
WP_175215723.1|2606819_2606996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161779823.1|2607202_2607781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161779824.1|2607843_2608122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161779825.1|2608184_2608640_-	ASCH domain-containing protein	NA	A0A077SLQ8	Escherichia_phage	48.5	9.6e-09
WP_105881171.1|2608674_2608833_-	hook protein	NA	NA	NA	NA	NA
WP_175215724.1|2608873_2609377_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	74.9	7.5e-55
WP_074924242.1|2609376_2609994_-	ERF family protein	NA	A0A1W6JP21	Morganella_phage	68.8	1.4e-71
WP_074924240.1|2609986_2610664_-	exodeoxyribonuclease X	NA	A0A1W5PTR6	Pseudoalteromonas_phage	31.4	6.2e-20
WP_074924238.1|2610665_2610986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164527031.1|2610982_2611135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094960321.1|2611131_2611386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166465079.1|2611393_2611549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063073721.1|2611620_2611854_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	54.5	8.9e-11
WP_001966870.1|2611888_2612128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071233777.1|2612329_2612611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049220845.1|2612582_2612819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004245994.1|2612833_2613151_-	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	52.3	7.1e-19
WP_081353450.1|2613572_2614004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071233779.1|2613993_2615868_-	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	26.7	5.4e-13
WP_175215725.1|2615943_2616627_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	98.2	6.7e-131
WP_004245989.1|2616709_2616919_+	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	98.6	3.3e-33
WP_175215726.1|2617082_2617430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175215727.1|2617532_2617877_+	hypothetical protein	NA	A0A088C4S1	Shewanella_sp._phage	41.8	4.0e-07
WP_071425630.1|2618120_2618570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071425631.1|2618572_2620210_+	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	68.1	2.8e-207
WP_063693405.1|2620172_2621129_+	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	55.0	2.0e-101
WP_071233457.1|2621148_2621352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143474649.1|2621607_2621817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143474648.1|2621813_2622206_+	HNH endonuclease	NA	E7EKU5	Edwardsiella_phage	64.7	3.4e-47
WP_175215728.1|2622230_2622674_+	recombination protein NinB	NA	A0A1P8DTD8	Proteus_phage	90.5	3.5e-32
WP_175215729.1|2622670_2623030_+	hypothetical protein	NA	A0A077KB17	Edwardsiella_phage	41.2	1.5e-09
WP_060556914.1|2623026_2623251_+	DUF3310 domain-containing protein	NA	A0A0A6Z5B6	Enterobacter_phage	75.4	6.1e-25
WP_175215730.1|2623362_2623983_+	recombination protein NinG	NA	A0A2I7RAC0	Vibrio_phage	53.6	1.3e-45
WP_143474642.1|2623982_2624174_+	hypothetical protein	NA	A0A1P8DTD3	Proteus_phage	95.2	5.0e-28
WP_036969493.1|2624170_2624674_+	DUF1133 family protein	NA	A0A1P8DTF1	Proteus_phage	88.0	4.0e-80
WP_004916901.1|2624981_2625371_+	membrane protein	NA	S4TRS4	Salmonella_phage	35.0	4.2e-13
WP_175215731.1|2625367_2625661_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_175215732.1|2625647_2625980_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	69.3	7.4e-35
WP_175215733.1|2625981_2626431_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	79.6	2.2e-50
WP_124743669.1|2626427_2626796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245979.1|2627840_2628047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170827691.1|2628043_2628202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161748292.1|2628232_2628370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170833832.1|2628380_2628983_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	69.6	3.3e-65
WP_175215734.1|2628985_2630470_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	89.1	5.5e-271
WP_159262634.1|2630471_2631848_+	DUF4055 domain-containing protein	NA	A0A1W6JNV0	Morganella_phage	78.8	5.4e-212
WP_017628801.1|2631856_2632921_+|capsid	minor capsid protein	capsid	A0A1W6JNT7	Morganella_phage	51.4	9.2e-103
WP_017628800.1|2632995_2633682_+	hypothetical protein	NA	A0A1W6JNU9	Morganella_phage	81.1	3.4e-74
WP_063693368.1|2633687_2634638_+	hypothetical protein	NA	A0A1W6JNV5	Morganella_phage	87.8	6.0e-154
WP_017628798.1|2634680_2635058_+	hypothetical protein	NA	A0A1W6JP09	Morganella_phage	71.2	5.8e-44
WP_049206412.1|2635059_2635401_+	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	80.5	3.1e-52
WP_063693365.1|2635403_2635772_+	hypothetical protein	NA	A0A1W6JNX7	Morganella_phage	83.6	3.3e-52
WP_063693362.1|2635768_2636140_+	hypothetical protein	NA	A0A1W6JNU7	Morganella_phage	70.7	3.3e-47
WP_036908275.1|2636204_2636960_+	Ig-like domain-containing protein	NA	A0A1W6JNT1	Morganella_phage	79.7	5.7e-107
WP_175215735.1|2637009_2637702_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	70.6	8.4e-89
WP_036908272.1|2637984_2638920_+	DUF4747 family protein	NA	NA	NA	NA	NA
WP_036908270.1|2638945_2639521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036971541.1|2639780_2640131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036971544.1|2640140_2640956_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	26.5	4.0e-13
WP_017827422.1|2641058_2641229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036908824.1|2642000_2642795_+	Rha family transcriptional regulator	NA	A0A2I7RX10	Vibrio_phage	42.7	8.0e-43
WP_135024820.1|2642917_2643226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175215736.1|2643290_2646626_+	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	45.6	6.5e-211
WP_175215737.1|2646641_2646902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905509.1|2646869_2647187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063109161.1|2647333_2647663_+|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	72.5	7.3e-43
WP_036971552.1|2647659_2648358_+|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	84.1	4.8e-116
WP_164527438.1|2648361_2649081_+	C40 family peptidase	NA	A0A1W6JNU8	Morganella_phage	74.5	2.8e-111
WP_049199070.1|2649017_2649584_+|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	77.4	1.4e-49
WP_175215738.1|2649583_2653366_+	DUF1983 domain-containing protein	NA	A0A1W6JNW2	Morganella_phage	63.5	0.0e+00
WP_175215739.1|2653382_2654795_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	54.2	4.6e-110
WP_049211401.1|2655583_2655775_-	hypothetical protein	NA	NA	NA	NA	NA
2655268:2655284	attR	AGATAAAAATATTTTTT	NA	NA	NA	NA
WP_164527442.1|2655848_2656079_-	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	90.8	3.4e-31
>prophage 7
NZ_CP053685	Proteus mirabilis strain MPE5203 chromosome, complete genome	3920300	3017020	3027012	3920300		Escherichia_phage(66.67%)	8	NA	NA
WP_004242885.1|3017020_3019078_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.1	4.8e-31
WP_060554653.1|3019089_3020790_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_004242887.1|3021125_3021812_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_004242888.1|3021811_3022273_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	34.6	7.0e-15
WP_004242890.1|3022325_3022937_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.1	7.3e-28
WP_017628119.1|3023076_3023937_-	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	35.5	1.3e-25
WP_004242892.1|3023938_3024556_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
WP_020945635.1|3024567_3027012_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.4	3.3e-220
>prophage 8
NZ_CP053685	Proteus mirabilis strain MPE5203 chromosome, complete genome	3920300	3557886	3575204	3920300	tail,lysis,plate,holin	Escherichia_phage(21.43%)	22	NA	NA
WP_004243609.1|3557886_3558504_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
WP_004243611.1|3558507_3559284_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_049221382.1|3559399_3559942_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.2	2.1e-18
WP_017628013.1|3560510_3560690_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_161683140.1|3560859_3561282_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_112843325.1|3561422_3561659_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	33.8	1.4e-06
WP_004243615.1|3562970_3563627_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.9	2.3e-35
WP_046334423.1|3563623_3564811_-|plate	baseplate J/gp47 family protein	plate	A0A2H5BG53	Pseudoalteromonas_phage	37.7	3.2e-72
WP_004243617.1|3564803_3565148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012368086.1|3565144_3565837_-	hypothetical protein	NA	A1Z003	Burkholderia_virus	37.1	1.6e-34
WP_004243622.1|3565839_3566652_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243623.1|3566620_3566941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243624.1|3566953_3567442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046334424.1|3567444_3569748_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.3	1.1e-15
WP_004243627.1|3569830_3570289_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_004243628.1|3570347_3570800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012368089.1|3570810_3572298_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	4.2e-77
WP_012368090.1|3572306_3572819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175215838.1|3572855_3573305_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_012368092.1|3573301_3573706_-	hypothetical protein	NA	A0A0A0RQM4	Escherichia_phage	47.9	1.7e-25
WP_004248367.1|3573708_3574008_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
WP_012368093.1|3574388_3575204_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.7	3.5e-54
