The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LN890335	Achromobacter xylosoxidans isolate AX_NCIMB_11015_WG chromosome BN2877	6501194	94444	138094	6501194	transposase,tRNA,integrase,tail,plate,protease	Burkholderia_phage(35.29%)	45	90234:90253	110869:110888
90234:90253	attL	GCGTCCCGCCCGAGGAATTC	NA	NA	NA	NA
WP_054437210.1|94444_94975_-	hypothetical protein	NA	A0A2H4JFP9	uncultured_Caudovirales_phage	57.4	5.3e-43
WP_164497481.1|94964_95456_-	hypothetical protein	NA	A0A0U5LBV3	unidentified_phage	37.2	6.3e-14
WP_155864653.1|95611_96556_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JE37	uncultured_Caudovirales_phage	31.5	1.9e-19
WP_155864654.1|96558_96909_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_155864655.1|97148_98096_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	52.9	1.7e-15
WP_054496611.1|98110_98776_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	60.2	2.1e-73
WP_155864656.1|98777_99959_-|plate	baseplate J/gp47 family protein	plate	A9YX12	Burkholderia_phage	62.8	5.8e-130
WP_020924456.1|99955_100309_-	hypothetical protein	NA	A9YX11	Burkholderia_phage	66.7	6.1e-35
WP_054472039.1|100317_101061_-	hypothetical protein	NA	A9YX06	Burkholderia_phage	63.1	1.3e-82
WP_155864657.1|101095_102106_-	hypothetical protein	NA	A9YX04	Burkholderia_phage	52.9	9.7e-78
WP_006388474.1|102125_102425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155864658.1|102434_103034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155864659.1|103026_104700_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_006393814.1|104692_104851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024068262.1|104877_105327_-	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	36.5	1.1e-17
WP_006388470.1|105330_105771_-	DUF3277 family protein	NA	A0A0P0IKY2	Acinetobacter_phage	54.1	3.1e-36
WP_155864660.1|105784_107260_-	DUF3383 family protein	NA	A0A0P0I492	Acinetobacter_phage	45.2	5.7e-103
WP_006388468.1|107270_107864_-	hypothetical protein	NA	A9YX29	Burkholderia_phage	46.6	7.5e-46
WP_006388467.1|108355_108613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006388466.1|108922_109684_+	S24 family peptidase	NA	NA	NA	NA	NA
WP_054437265.1|109688_111506_+	DUF4153 domain-containing protein	NA	NA	NA	NA	NA
110869:110888	attR	GCGTCCCGCCCGAGGAATTC	NA	NA	NA	NA
WP_006388464.1|111579_111801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108913895.1|111969_113091_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_155864661.1|113248_113953_-	DUF3053 family protein	NA	NA	NA	NA	NA
WP_006388461.1|114116_114629_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026384180.1|114812_115172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006388458.1|115999_116281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155864662.1|116390_117083_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_155864663.1|117195_118562_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	53.4	2.7e-75
WP_155864664.1|118663_119122_-	cytochrome c	NA	NA	NA	NA	NA
WP_006388455.1|119178_120555_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.7	2.0e-110
WP_006388454.1|120716_121328_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_006388452.1|122329_123448_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_020924474.1|123460_124381_-	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	31.5	3.1e-30
WP_024068252.1|124572_125562_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_155864665.1|125632_126508_+	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_024068250.1|126693_127812_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_006388447.1|127816_128134_+	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_006388446.1|128130_129570_+	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_155864666.1|129664_130894_-	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_054515396.1|130899_132003_-	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_006388443.1|132015_133515_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_024068245.1|133782_135192_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_006388441.1|135290_136364_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	47.3	1.0e-77
WP_020924482.1|136633_138094_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 2
NZ_LN890335	Achromobacter xylosoxidans isolate AX_NCIMB_11015_WG chromosome BN2877	6501194	2527229	2583567	6501194	transposase,tail	Burkholderia_virus(29.41%)	47	NA	NA
WP_155864663.1|2527229_2528596_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	53.4	2.7e-75
WP_155865348.1|2529286_2530774_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_155865349.1|2530843_2534059_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.4	1.9e-05
WP_173361433.1|2534095_2535286_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_020926131.1|2535681_2536746_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006386240.1|2536924_2538046_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_006386241.1|2538158_2538926_+	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_024070553.1|2539130_2539958_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_047991993.1|2540009_2540912_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_155865350.1|2540948_2542724_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_024070550.1|2542728_2543817_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.6	6.2e-30
WP_006386246.1|2543839_2544922_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_049054099.1|2544961_2546389_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_024070549.1|2546609_2547758_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_155865351.1|2547776_2548583_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_054439076.1|2548597_2550043_-	MFS transporter	NA	NA	NA	NA	NA
WP_026382529.1|2550221_2551076_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024070545.1|2551155_2552052_+	DMT family transporter	NA	NA	NA	NA	NA
WP_080684395.1|2552540_2553020_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006385675.1|2553046_2553862_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_035199499.1|2553946_2554825_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	21.7	2.3e-06
WP_006385677.1|2554929_2555790_+	isocitrate lyase/phosphoenolpyruvate mutase family protein	NA	NA	NA	NA	NA
WP_155865352.1|2555833_2558710_-	WG repeat-containing protein	NA	NA	NA	NA	NA
WP_155865353.1|2558706_2561808_-	WG repeat-containing protein	NA	NA	NA	NA	NA
WP_054516409.1|2562226_2563639_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_024070539.1|2563780_2564974_+	MFS transporter	NA	NA	NA	NA	NA
WP_006385683.1|2565029_2565410_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_006385684.1|2565555_2565795_+	DUF3596 domain-containing protein	NA	A0A1W6JTA0	Pseudomonas_phage	55.7	7.0e-11
WP_006385685.1|2565791_2566340_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_076467935.1|2566527_2567985_+	DUF1254 domain-containing protein	NA	M1IA53	Paramecium_bursaria_Chlorella_virus	35.4	6.8e-64
WP_053497387.1|2568037_2568733_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_049055147.1|2568957_2569599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006385689.1|2569848_2570316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054497360.1|2570321_2570795_+|tail	phage tail protein	tail	A4JX08	Burkholderia_virus	44.4	1.8e-26
WP_006385691.1|2570794_2571085_+	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	50.0	9.1e-13
WP_054505332.1|2571142_2572429_+|tail	phage tail tape measure protein	tail	A0A1W6JP49	Morganella_phage	30.3	2.2e-13
WP_080684394.1|2572425_2572770_+|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	38.4	4.8e-21
WP_054499929.1|2572766_2574728_+|tail	tail fiber domain-containing protein	tail	A0A0K0KVF1	Prochlorococcus_phage	36.2	1.9e-13
WP_006385695.1|2574730_2575459_+|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	58.3	2.2e-71
WP_155865354.1|2575461_2576241_+	Mov34/MPN/PAD-1 family protein	NA	A4JX14	Burkholderia_virus	49.0	6.6e-66
WP_112957455.1|2576237_2576843_+|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	55.2	6.7e-50
WP_155865355.1|2576968_2580472_+	DUF1983 domain-containing protein	NA	Q3HQU5	Burkholderia_phage	45.9	2.5e-261
WP_054439116.1|2580477_2580849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149895560.1|2580829_2581066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026382513.1|2581062_2581659_+|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	53.5	3.3e-49
WP_155865356.1|2581800_2582730_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006385703.1|2582748_2583567_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	49.3	1.4e-10
>prophage 3
NZ_LN890335	Achromobacter xylosoxidans isolate AX_NCIMB_11015_WG chromosome BN2877	6501194	6284300	6311373	6501194	terminase,capsid,plate,tail	Burkholderia_phage(29.17%)	40	NA	NA
WP_155866421.1|6284300_6284828_-	hypothetical protein	NA	A0A0E3M0Y2	Rhodoferax_phage	39.0	1.1e-24
WP_155866422.1|6284824_6285319_-	hypothetical protein	NA	Q775E1	Bordetella_phage	70.6	5.6e-63
WP_155866423.1|6285315_6285648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155866424.1|6285780_6286167_-|tail	tail fiber assembly protein	tail	A5X9J5	Aeromonas_virus	44.6	6.7e-11
WP_155866425.1|6286169_6287210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155866426.1|6287210_6287861_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	38.7	2.8e-33
WP_155866427.1|6287857_6289048_-|plate	baseplate J/gp47 family protein	plate	Q6IWQ3	Burkholderia_phage	42.0	3.1e-67
WP_155866428.1|6289040_6289385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155866429.1|6289381_6290089_-	hypothetical protein	NA	A1Z003	Burkholderia_virus	43.6	4.2e-35
WP_150101668.1|6290073_6290898_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.7	2.0e-41
WP_155866430.1|6290890_6291199_-	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	34.3	8.5e-09
WP_155866431.1|6291195_6291738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155866432.1|6291737_6293354_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_155866433.1|6293444_6293900_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	50.4	1.5e-22
WP_063570010.1|6293909_6294359_-	hypothetical protein	NA	A0A2H4P6T4	Pseudomonas_phage	45.6	7.5e-30
WP_155866434.1|6294417_6295926_-	DUF3383 family protein	NA	A0A088C3U1	Shewanella_sp._phage	35.2	5.9e-71
WP_155866435.1|6295935_6296463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155866436.1|6296459_6296828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155866437.1|6296824_6297301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155866438.1|6297297_6297726_-	DUF4054 domain-containing protein	NA	A0A088C3T8	Shewanella_sp._phage	36.2	5.3e-17
WP_155866439.1|6297727_6298078_-	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	37.5	4.3e-09
WP_155866440.1|6298137_6299220_-	DUF2184 domain-containing protein	NA	Q6IWU6	Burkholderia_phage	34.6	5.2e-53
WP_054449246.1|6299235_6299718_-	hypothetical protein	NA	A0A2H5BG33	Pseudoalteromonas_phage	32.8	8.3e-11
WP_155866441.1|6299714_6300980_-	DUF2213 domain-containing protein	NA	A0A088C4R4	Shewanella_sp._phage	36.2	1.5e-38
WP_155866659.1|6300960_6301830_-|capsid	minor capsid protein	capsid	M4T3R2	Psychrobacter_phage	29.3	2.8e-17
WP_155866442.1|6301741_6303277_-	DUF1073 domain-containing protein	NA	W5S8I3	Pseudomonas_phage	47.2	3.3e-101
WP_155866660.1|6303273_6304512_-|terminase	PBSX family phage terminase large subunit	terminase	A0A125RNL7	Pseudomonas_phage	80.8	5.0e-201
WP_155866443.1|6304498_6304918_-|terminase	terminase small subunit	terminase	E5AGA2	Erwinia_phage	68.6	2.9e-36
WP_155866444.1|6304968_6305265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155866445.1|6305261_6305618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155866446.1|6305605_6305815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150101651.1|6305951_6306320_-	endonuclease	NA	NA	NA	NA	NA
WP_155866447.1|6306320_6307709_-	replicative DNA helicase	NA	O80281	Escherichia_phage	45.7	1.1e-95
WP_155866448.1|6307705_6308551_-	hypothetical protein	NA	A0A2H4J0Z7	uncultured_Caudovirales_phage	41.6	7.5e-15
WP_155866449.1|6308550_6308973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155866450.1|6309005_6309416_-	recombination protein NinB	NA	A0A0H5AUD0	Pseudomonas_phage	48.6	7.6e-21
WP_155866451.1|6309415_6309730_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_173361496.1|6309768_6309933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173361497.1|6309935_6310193_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_173361498.1|6310275_6311373_+	helix-turn-helix transcriptional regulator	NA	A0A1B0VRI7	Pseudomonas_phage	30.2	1.2e-07
>prophage 4
NZ_LN890335	Achromobacter xylosoxidans isolate AX_NCIMB_11015_WG chromosome BN2877	6501194	6319335	6325444	6501194		Bordetella_phage(33.33%)	12	NA	NA
WP_155866462.1|6319335_6319779_+	single-stranded DNA-binding protein	NA	R9TPS8	Aeromonas_phage	46.9	2.4e-20
WP_155866463.1|6319787_6320291_+	siphovirus Gp157 family protein	NA	A0A2I7RAE0	Vibrio_phage	28.8	1.1e-13
WP_155866464.1|6320524_6321073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155866465.1|6321075_6321309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173361499.1|6321312_6321495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173361500.1|6321491_6322457_+	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_155866467.1|6322449_6323115_+	hypothetical protein	NA	H2BDG4	Pseudomonas_virus	49.4	6.7e-51
WP_155866468.1|6323107_6323323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155866469.1|6323322_6323613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173361501.1|6323889_6324063_+	hypothetical protein	NA	A0A0K1YAW1	Cronobacter_phage	57.7	2.5e-10
WP_155866470.1|6324071_6324293_+	excisionase	NA	Q774Z6	Bordetella_phage	78.1	1.5e-20
WP_155866471.1|6324268_6325444_+	DUF3596 domain-containing protein	NA	Q774Z5	Bordetella_phage	66.5	9.7e-146
