The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_HG738868	Serratia marcescens SMB2099	5123091	501006	577402	5123091	transposase,integrase,tRNA	Enterobacteria_phage(18.75%)	58	537383:537403	562873:562893
WP_154067213.1|501006_501537_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	62.9	1.0e-57
WP_172841010.1|501844_502375_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_079656155.1|502447_504112_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_033636857.1|504179_505595_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_060428766.1|505724_506672_-	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_047569575.1|507095_509804_+	magnesium-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.7	1.0e-33
WP_048321253.1|510015_512409_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_048321254.1|512445_515433_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	30.3	1.6e-64
WP_004933379.1|515636_516023_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_033636863.1|516180_516645_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_033636864.1|516657_517593_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_048321255.1|517891_519460_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_048321256.1|519655_520675_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_025305115.1|520837_521263_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_015376459.1|521443_522208_+|tRNA	tRNA hydroxylase	tRNA	NA	NA	NA	NA
WP_033648629.1|522223_523831_-	GMC family oxidoreductase N-terminal domain-containing protein	NA	A0A1V0S9J5	Catovirus	30.3	1.9e-59
WP_033636872.1|524057_524561_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_033648627.1|524761_527638_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.0	3.0e-140
WP_033631663.1|527650_528100_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_033636874.1|528184_529696_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.4	1.3e-46
WP_041037661.1|529978_531073_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_033636876.1|531072_532143_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_079656156.1|532278_532995_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033636884.1|533777_535160_-	gluconate permease	NA	NA	NA	NA	NA
WP_049211803.1|535162_536128_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_033636886.1|536158_536926_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	46.4	2.5e-49
537383:537403	attL	GAGTCCGGCCTTCGGCACCAT	NA	NA	NA	NA
WP_079656157.1|537567_538827_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.3	3.3e-75
WP_079656159.1|539655_539919_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	53.8	4.2e-17
WP_079656160.1|539915_540131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079656161.1|540117_540663_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	56.2	2.6e-21
WP_046688297.1|540659_540923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033631431.1|540919_541255_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_079656162.1|541266_543600_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	59.6	1.2e-259
WP_079656163.1|543848_544955_-	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_079656164.1|544956_545511_-	3'-5' exonuclease	NA	A0A2L0UZL4	Agrobacterium_phage	30.0	8.1e-10
WP_079656165.1|545500_545989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079656166.1|545981_547205_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_079656167.1|547338_547623_-	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_079656956.1|548323_548791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079656168.1|550016_550541_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_079656169.1|550625_551171_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_079656170.1|551225_553772_+	outer membrane usher protein	NA	NA	NA	NA	NA
WP_079656171.1|553778_554525_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_079656172.1|554554_555208_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_079656173.1|555218_555716_+	fimbrial protein	NA	NA	NA	NA	NA
WP_079656174.1|555730_556207_+	fimbrial protein	NA	NA	NA	NA	NA
WP_079656175.1|556203_556743_+	fimbrial protein	NA	NA	NA	NA	NA
WP_079656176.1|556735_557722_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_079656178.1|559416_561111_+	O-antigen ligase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_079656179.1|561182_561740_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_125454227.1|564351_564420_-	hypothetical protein	NA	NA	NA	NA	NA
562873:562893	attR	GAGTCCGGCCTTCGGCACCAT	NA	NA	NA	NA
WP_079656180.1|564699_564984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079656181.1|565105_567976_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_079656182.1|567972_569580_-	site-specific DNA-methyltransferase	NA	A0A220NUF4	Escherichia_phage	43.2	2.1e-82
WP_079656183.1|569589_571980_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_079656184.1|571989_572970_-	ATP-binding protein	NA	Q677Q6	Lymphocystis_disease_virus	32.1	1.9e-17
WP_079656185.1|576266_577121_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.2	6.7e-80
WP_000537152.1|577117_577402_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_HG738868	Serratia marcescens SMB2099	5123091	2187228	2217455	5123091	coat,protease	Moraxella_phage(33.33%)	26	NA	NA
WP_079656465.1|2187228_2188164_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_172841012.1|2188184_2190605_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_033653896.1|2190672_2191437_-	molecular chaperone	NA	NA	NA	NA	NA
WP_086557004.1|2191461_2192010_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_072008406.1|2192015_2192519_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_033638282.1|2192521_2193061_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_033646334.1|2193334_2194771_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_033647432.1|2194872_2197503_-	PqiB family protein	NA	NA	NA	NA	NA
WP_041037977.1|2197471_2198719_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_079656466.1|2198974_2199472_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_033638287.1|2199568_2200279_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_033638289.1|2200298_2202347_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	5.7e-85
WP_049234238.1|2202655_2203534_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_049196133.1|2203585_2204980_-	MFS transporter	NA	NA	NA	NA	NA
WP_079656467.1|2205211_2206003_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_033653903.1|2206049_2206853_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_060427719.1|2206855_2207719_-	2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_152903836.1|2207720_2208857_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	34.2	2.6e-26
WP_049196135.1|2208853_2209864_-	2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_033638301.1|2210039_2210759_-	phosphonate utilization transcriptional regulator PhnR	NA	NA	NA	NA	NA
WP_079656468.1|2210914_2212018_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_049196137.1|2212027_2212837_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_033653910.1|2212900_2214292_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_033638305.1|2214473_2215022_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	35.8	6.4e-07
WP_033638306.1|2215444_2216110_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_033653912.1|2216174_2217455_-|protease	protease	protease	NA	NA	NA	NA
>prophage 3
NZ_HG738868	Serratia marcescens SMB2099	5123091	2234325	2249611	5123091	tRNA	Tupanvirus(40.0%)	15	NA	NA
WP_025159696.1|2234325_2236254_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	3.5e-132
WP_048233542.1|2236257_2236809_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	2.6e-16
WP_004931418.1|2236907_2237105_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004931417.1|2237148_2237505_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_151498502.1|2237571_2237667_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_004931416.1|2237913_2238897_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.9	2.2e-34
WP_033653918.1|2238911_2241299_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	25.0	1.8e-05
WP_004931414.1|2241303_2241600_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	3.2e-13
WP_039566415.1|2242149_2242566_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_033638330.1|2242744_2243752_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_041034862.1|2243797_2244349_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	35.0	1.5e-16
WP_033638333.1|2244354_2245110_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2H4PQG7	Staphylococcus_phage	28.2	2.8e-05
WP_033638335.1|2245507_2246662_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	25.2	1.2e-28
WP_049196145.1|2246648_2247629_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	B9UDL7	Salmonella_phage	32.4	3.1e-36
WP_033638761.1|2247628_2249611_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.4	1.1e-21
>prophage 4
NZ_HG738868	Serratia marcescens SMB2099	5123091	3451954	3472561	5123091	holin,tail	Klebsiella_phage(33.33%)	23	NA	NA
WP_079656658.1|3451954_3453976_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1I9SF20	Klebsiella_phage	41.3	1.2e-29
WP_079656659.1|3453972_3455133_-|tail	tail fiber domain-containing protein	tail	K7P7B1	Enterobacteria_phage	58.2	7.3e-45
WP_079656660.1|3455161_3458746_-	DUF1983 domain-containing protein	NA	F1C571	Cronobacter_phage	66.0	0.0e+00
WP_049195161.1|3458799_3459426_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	54.2	5.3e-50
WP_154067236.1|3459480_3459840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079656661.1|3459879_3460584_-	C40 family peptidase	NA	K7PJV6	Enterobacteria_phage	74.6	9.1e-107
WP_170929876.1|3460593_3461346_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	65.2	2.4e-97
WP_033639815.1|3461355_3461694_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	60.0	1.4e-33
WP_079656662.1|3461693_3463985_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	44.1	2.7e-14
WP_004935830.1|3463977_3464199_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	47.9	1.7e-11
WP_049195166.1|3464216_3464582_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	43.6	3.3e-20
WP_033652513.1|3464708_3465164_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	75.5	2.5e-57
WP_041036013.1|3465204_3465597_-	hypothetical protein	NA	Q7Y404	Yersinia_phage	46.0	1.4e-19
WP_049234585.1|3465593_3465983_-	hypothetical protein	NA	Q7Y405	Yersinia_phage	42.9	3.7e-25
WP_079656663.1|3466040_3466481_-	lysozyme	NA	A0A0M5M782	Salmonella_phage	61.6	1.7e-42
WP_041036019.1|3466467_3466788_-|holin	phage holin family protein	holin	F1C5D1	Cronobacter_phage	80.0	1.5e-40
WP_019453679.1|3467582_3467945_-	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	64.6	1.6e-38
WP_041036021.1|3468154_3468832_+	peptidase S24	NA	K7PK07	Enterobacteria_phage	44.6	7.9e-07
WP_033635291.1|3469258_3469588_-	osmotically-inducible lipoprotein OsmE	NA	NA	NA	NA	NA
WP_025303631.1|3469715_3470183_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_060388055.1|3470290_3470869_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060427713.1|3470862_3471279_-	VOC family protein	NA	NA	NA	NA	NA
WP_033635297.1|3471430_3472561_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	53.9	1.8e-104
>prophage 5
NZ_HG738868	Serratia marcescens SMB2099	5123091	4445147	4486088	5123091	integrase,tail,capsid,plate,terminase,tRNA,portal,lysis,head	Erwinia_phage(45.95%)	47	4451326:4451377	4487220:4487271
WP_079656816.1|4445147_4446161_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	9.7e-110
WP_001144069.1|4446486_4446702_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_025304325.1|4446838_4448587_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	6.6e-74
WP_043148030.1|4448744_4450586_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_033649053.1|4450660_4451149_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
4451326:4451377	attL	ACTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAATTTT	NA	NA	NA	NA
WP_071998163.1|4451529_4451760_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	64.5	3.2e-21
WP_079656817.1|4451850_4452999_-	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	64.9	1.4e-136
WP_079656818.1|4452995_4453481_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	64.9	7.3e-47
WP_079656819.1|4453485_4456320_-|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	50.7	1.2e-104
WP_023456045.1|4456312_4456435_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	72.5	1.5e-09
WP_015379104.1|4456467_4456749_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	70.1	1.8e-26
WP_079656820.1|4456802_4457312_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	76.7	3.4e-71
WP_079656821.1|4457327_4458497_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	81.7	3.1e-184
WP_079656822.1|4459224_4459443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079656823.1|4459611_4460157_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	44.7	2.9e-36
WP_079656824.1|4460158_4462786_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	53.5	1.8e-59
WP_079656825.1|4462795_4463329_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	75.4	9.1e-75
WP_079656826.1|4463321_4464230_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	68.9	4.3e-109
WP_079656827.1|4464234_4464585_-	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	66.4	1.1e-36
WP_079656828.1|4464581_4465211_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	73.6	3.3e-76
WP_079656829.1|4465342_4466404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079656830.1|4466418_4466865_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	58.5	1.0e-39
WP_079656831.1|4466851_4467325_-|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	61.2	4.4e-49
WP_079656832.1|4467420_4467849_-|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	35.9	1.6e-13
WP_079656833.1|4467845_4468358_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	66.3	2.5e-58
WP_031231709.1|4468341_4468551_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	43.5	2.0e-09
WP_015379118.1|4468555_4468759_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	68.7	2.4e-20
WP_079656834.1|4468758_4469247_-|head	head completion/stabilization protein	head	F1BUQ6	Erwinia_phage	53.1	4.3e-39
WP_079656835.1|4469340_4470000_-|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	69.4	4.0e-80
WP_079656836.1|4470002_4471214_-|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	78.8	6.7e-158
WP_079656837.1|4471256_4472072_-|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	53.1	4.6e-70
WP_079656838.1|4472214_4473987_+|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	81.7	9.1e-289
WP_079656839.1|4473986_4475021_+|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	80.7	1.6e-163
WP_154067247.1|4475051_4476350_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_079656998.1|4476392_4476734_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_079656841.1|4477486_4478899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079656843.1|4479599_4479824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079656844.1|4479862_4482079_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	58.0	5.7e-240
WP_079656845.1|4482075_4482357_-	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	50.0	7.7e-17
WP_079656846.1|4482479_4482704_-	TraR/DksA C4-type zinc finger protein	NA	Q6K1F5	Salmonella_virus	58.3	2.2e-14
WP_079656847.1|4482703_4482997_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_079656848.1|4483061_4483364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048322123.1|4483375_4483555_-	DUF2724 domain-containing protein	NA	F1BUS5	Erwinia_phage	51.0	1.1e-05
WP_079656849.1|4483565_4484075_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	54.2	4.2e-45
WP_079656850.1|4484106_4484370_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	90.8	3.0e-39
WP_079656851.1|4484502_4485078_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	66.0	5.2e-68
WP_079656852.1|4485077_4486088_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	97.0	8.5e-191
4487220:4487271	attR	ACTCATAATCGCTTGGTCGTTGGTTCAAACCCAACAGGGGCCACCAAATTTT	NA	NA	NA	NA
