The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT546645	Bordetella trematum strain H044680328 chromosome 1	4480141	143261	161592	4480141	terminase	Burkholderia_virus(69.23%)	17	NA	NA
WP_147297403.1|143261_145847_-	hypothetical protein	NA	T1S9I6	Salmonella_phage	41.8	1.7e-179
WP_082832905.1|145822_148330_-	transglycosylase SLT domain-containing protein	NA	Q6J1R1	Burkholderia_virus	38.0	4.0e-40
WP_063491371.1|148326_150498_-	hypothetical protein	NA	Q6J1R2	Burkholderia_virus	27.9	4.7e-29
WP_063491372.1|150500_151118_-	hypothetical protein	NA	Q6J1R3	Burkholderia_virus	48.8	2.1e-19
WP_082832906.1|151117_151528_-	hypothetical protein	NA	Q6J1R4	Burkholderia_virus	41.9	2.1e-26
WP_063491374.1|151539_153801_-	hypothetical protein	NA	Q6J1R5	Burkholderia_virus	52.5	1.3e-234
WP_063491375.1|153800_154388_-	hypothetical protein	NA	Q6J1R6	Burkholderia_virus	57.1	5.3e-52
WP_063491376.1|154400_154688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063491377.1|154692_155139_-	hypothetical protein	NA	K4NYY6	Pseudomonas_phage	56.4	5.9e-35
WP_063491378.1|155195_156209_-	hypothetical protein	NA	K4PA76	Pseudomonas_phage	49.0	1.8e-84
WP_063491379.1|156227_156974_-	hypothetical protein	NA	Q6J1S0	Burkholderia_virus	43.9	2.9e-34
WP_025517530.1|156957_157263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063491380.1|157259_158909_-	hypothetical protein	NA	Q6J1S2	Burkholderia_virus	51.5	5.7e-144
WP_127070876.1|158908_159118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127070878.1|159210_159690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491381.1|159679_161101_-	hypothetical protein	NA	Q6J1S4	Burkholderia_virus	75.8	1.6e-222
WP_082832907.1|161100_161592_-|terminase	terminase small subunit	terminase	A0A0M3LSU1	Mannheimia_phage	40.4	6.9e-13
>prophage 2
NZ_LT546645	Bordetella trematum strain H044680328 chromosome 1	4480141	286739	322643	4480141	protease,capsid,terminase,portal,integrase,tRNA,head,transposase,tail	Burkholderia_virus(16.67%)	51	279798:279857	319604:319706
279798:279857	attL	ATTGCAAATCCGTGTACGTCGGTTCGATTCCGGCTTGCGCCTCCAAGTACCGAAAGGCCC	NA	NA	NA	NA
WP_063491435.1|286739_287351_-|tail	tail assembly protein	tail	C7BGD3	Burkholderia_phage	46.0	1.2e-35
WP_063492526.1|287347_288124_-	C40 family peptidase	NA	Q8W6T2	Burkholderia_virus	49.2	8.0e-64
WP_063492527.1|288123_288870_-|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	51.5	5.0e-63
WP_063491436.1|288921_289245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063491437.1|289241_290447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063491438.1|290446_290785_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	52.7	6.2e-29
WP_063491439.1|290784_293763_-|tail	phage tail tape measure protein	tail	A0A0K1Y6G1	Rhodobacter_phage	33.1	1.5e-09
WP_063939966.1|293770_294028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063491441.1|294099_294435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063939967.1|294444_294942_-	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	35.3	3.7e-14
WP_063491443.1|294971_295343_-	DUF3168 domain-containing protein	NA	B5WZT0	Pseudomonas_phage	37.7	1.2e-09
WP_063491444.1|295342_295849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156507927.1|295845_296013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063492528.1|296009_296384_-|head,tail	head-tail adaptor protein	head,tail	H2BDB4	Pseudomonas_virus	54.0	8.1e-30
WP_063491445.1|296383_296713_-|head,tail	phage gp6-like head-tail connector protein	head,tail	H2BDB3	Pseudomonas_virus	58.3	9.3e-22
WP_063491446.1|296715_296940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063491447.1|296988_298167_-|capsid	phage major capsid protein	capsid	A0A2H4PI18	Pseudomonas_phage	53.8	6.6e-102
WP_063491448.1|298177_299047_-|protease	Clp protease ClpP	protease	A0A0U4B0F3	Pseudomonas_phage	53.1	5.8e-79
WP_063491449.1|299056_300355_-|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	63.4	5.3e-145
WP_063491450.1|300351_302076_-|terminase	terminase large subunit	terminase	A4JWZ7	Burkholderia_virus	71.7	3.2e-254
WP_063491451.1|302077_302557_-|terminase	phage terminase small subunit P27 family	terminase	A4JWZ6	Burkholderia_virus	61.1	6.3e-51
WP_082832911.1|302675_303056_-	HNH endonuclease	NA	H2BDK0	Pseudomonas_virus	48.8	1.3e-11
WP_063491453.1|303475_303748_+	BrnT family toxin	NA	K4NX81	Burkholderia_phage	49.4	4.1e-15
WP_063491454.1|303728_304007_+	BrnA antitoxin family protein	NA	A0A2H4J5Y5	uncultured_Caudovirales_phage	54.8	6.9e-10
WP_063491455.1|304499_305129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063492529.1|305130_305538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082832912.1|305746_306529_-	ATP-binding protein	NA	A0A067ZJ24	Vibrio_phage	40.4	4.2e-44
WP_063491457.1|306470_307403_-	replication protein	NA	K7PL20	Enterobacteria_phage	44.2	1.8e-14
WP_063491458.1|307399_307861_-	DUF1364 family protein	NA	NA	NA	NA	NA
WP_063491459.1|307857_308415_-	hypothetical protein	NA	E5FFF4	Burkholderia_phage	40.5	9.3e-06
WP_063491460.1|308408_308924_-	hypothetical protein	NA	B7SYH6	Stenotrophomonas_phage	42.3	8.0e-28
WP_115638855.1|309881_310589_+	transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	30.3	2.8e-07
WP_063491464.1|310610_311486_-|transposase	transposase	transposase	A0A0R6PHP9	Moraxella_phage	40.6	1.7e-46
WP_156507928.1|311850_312018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082832913.1|312054_312264_+	hypothetical protein	NA	B5UAR3	Ralstonia_phage	45.8	5.4e-07
WP_063491466.1|312251_312485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491467.1|312552_312963_+	hypothetical protein	NA	A0A192YAH3	Morganella_phage	62.7	1.3e-41
WP_063491468.1|313419_313638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082832914.1|313640_314054_+	single-stranded DNA-binding protein	NA	I6NRL7	Burkholderia_virus	67.0	4.2e-35
WP_063491469.1|314069_314966_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	34.1	2.4e-43
WP_063491470.1|315009_315345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491471.1|315387_316197_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	64.2	9.8e-89
WP_063491472.1|316186_317062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127070885.1|317058_317436_+	hypothetical protein	NA	A0A240F4V4	Ochrobactrum_phage	48.3	1.3e-27
WP_082832915.1|317435_317723_+	DUF4884 domain-containing protein	NA	NA	NA	NA	NA
WP_063491474.1|317726_318107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491475.1|318543_319515_+|integrase	site-specific integrase	integrase	B5WZU7	Pseudomonas_phage	30.3	2.9e-18
WP_063491476.1|319807_320365_+	DUF2946 family protein	NA	NA	NA	NA	NA
319604:319706	attR	ATTGCAAATCCGTGTACGTCGGTTCGATTCCGGCTTGCGCCTCCAAGTACCGAAAGGCCCACAGCAATGTGGGCCTTTTTCTTTTGCGGCGCTGTGTGGGGAT	NA	NA	NA	NA
WP_033535275.1|320395_321316_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025516841.1|321312_321894_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_025516842.1|321890_322643_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_LT546645	Bordetella trematum strain H044680328 chromosome 1	4480141	2339200	2428966	4480141	holin,protease,head,capsid,terminase,portal,integrase,tRNA,plate,transposase,tail	uncultured_Caudovirales_phage(15.38%)	84	2327759:2327774	2431581:2431596
2327759:2327774	attL	GCGCCTTCGATATTCC	NA	NA	NA	NA
WP_025518350.1|2339200_2339689_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_025518348.1|2339775_2340354_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_025518346.1|2340440_2340800_+	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025518341.1|2342618_2343011_+	VOC family protein	NA	NA	NA	NA	NA
WP_063492580.1|2343326_2344499_+	MFS transporter	NA	NA	NA	NA	NA
WP_063491934.1|2344697_2347361_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_063491935.1|2347364_2350760_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_025518334.1|2353162_2353489_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_025518332.1|2353522_2354125_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_033534140.1|2354182_2355433_+	CoA transferase	NA	NA	NA	NA	NA
WP_033534141.1|2355538_2356576_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_063491936.1|2356568_2357378_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.4	3.3e-12
WP_025518328.1|2357381_2358176_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_025518326.1|2358362_2359319_-	transaldolase	NA	A0A0E3HJ81	Synechococcus_phage	32.7	1.1e-09
WP_033534143.1|2359496_2360651_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.3	8.9e-51
WP_063491937.1|2360661_2363901_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_025518321.1|2363969_2364866_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	38.3	5.7e-37
WP_063491938.1|2364934_2365690_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_025518319.1|2365700_2366345_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_025518317.1|2366509_2366737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063491939.1|2366750_2367038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025518313.1|2367174_2368494_+	uracil transporter	NA	Q9KX94	Enterobacteria_phage	60.8	4.9e-130
WP_025518312.1|2368891_2369368_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_025518311.1|2369544_2370147_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_025518309.1|2370165_2370834_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_025518306.1|2371004_2372894_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	42.0	3.3e-111
WP_063491940.1|2372912_2373752_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	35.6	1.2e-28
WP_025518302.1|2373748_2375092_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	29.3	2.8e-08
WP_025518301.1|2375278_2376058_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_025518299.1|2376092_2377574_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_025518297.1|2377782_2379861_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_063491941.1|2379897_2382708_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_025518294.1|2383018_2384056_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	39.0	3.2e-52
WP_025518292.1|2384154_2385168_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_025518291.1|2385181_2386039_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_025518289.1|2386064_2386841_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.9	4.0e-15
WP_063491942.1|2387039_2387252_-	AlpA family phage regulatory protein	NA	Q7M299	Enterobacteria_phage	42.9	1.8e-05
WP_127070779.1|2387248_2387560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063491943.1|2387562_2387826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063491944.1|2387828_2390531_-	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	50.2	9.4e-261
WP_063491945.1|2390533_2390767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063491946.1|2390846_2391251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115638908.1|2391237_2391522_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_115638907.1|2391825_2392230_+	helix-turn-helix domain-containing protein	NA	A4JWR8	Burkholderia_virus	51.0	4.0e-14
WP_127070781.1|2392263_2392494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115638906.1|2392716_2393010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082833065.1|2393021_2394011_-	late control protein	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	47.7	4.9e-74
WP_063491950.1|2394121_2394577_-|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	52.7	1.1e-33
WP_063491951.1|2394589_2397799_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	44.0	1.1e-175
WP_082832976.1|2397805_2397919_-|tail	GpE family phage tail protein	tail	A0A1S5NR79	Burkholderia_phage	68.6	5.8e-08
WP_063491952.1|2397927_2398296_-|tail	phage tail assembly protein	tail	A4JWS5	Burkholderia_virus	47.6	1.3e-16
WP_063491953.1|2398317_2398833_-|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	57.9	3.3e-50
WP_063491954.1|2398893_2400072_-|tail	phage tail sheath protein	tail	A0A2H4JCP8	uncultured_Caudovirales_phage	63.5	8.2e-145
WP_082832977.1|2400247_2400859_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	31.5	2.1e-14
WP_167350357.1|2400871_2401678_-|tail	tail fiber protein	tail	A0A1W6JT73	Escherichia_phage	46.3	8.4e-24
WP_063491956.1|2403795_2404416_-|tail	phage tail protein I	tail	A0A077KER5	Ralstonia_phage	57.3	2.3e-53
WP_063491957.1|2404408_2405335_-|plate	baseplate J/gp47 family protein	plate	A0A077K9X9	Ralstonia_phage	56.3	2.0e-77
WP_063491958.1|2405336_2405678_-	GPW/gp25 family protein	NA	E5E3V5	Burkholderia_phage	51.4	1.1e-20
WP_063491959.1|2405689_2406316_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	44.1	1.6e-30
WP_063491960.1|2406376_2406841_-	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	51.7	1.1e-31
WP_063491961.1|2406837_2407344_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	44.5	1.4e-29
WP_063491962.1|2407439_2407865_-	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	39.1	6.2e-10
WP_063491963.1|2407861_2408671_-	N-acetylmuramidase family protein	NA	A0A2H4JGJ9	uncultured_Caudovirales_phage	57.7	9.9e-73
WP_063491964.1|2408663_2408960_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_063491965.1|2408956_2409331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063491966.1|2409336_2409543_-|tail	tail protein X	tail	E5FFI3	Burkholderia_phage	63.2	8.7e-18
WP_063491967.1|2409542_2410016_-|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	54.7	5.1e-37
WP_063491968.1|2410108_2410804_-	hypothetical protein	NA	A4PE31	Ralstonia_virus	41.6	5.2e-38
WP_063491969.1|2410806_2411817_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	60.1	1.3e-114
WP_063491970.1|2411862_2412714_-|capsid	GPO family capsid scaffolding protein	capsid	E5FFI7	Burkholderia_phage	56.2	1.6e-52
WP_063491971.1|2412858_2414613_+|terminase	terminase	terminase	A4JWU9	Burkholderia_virus	66.7	1.1e-225
WP_063491972.1|2414609_2415659_+|portal	phage portal protein	portal	E5E3X1	Burkholderia_phage	62.0	7.1e-124
WP_063491973.1|2415726_2416014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063491974.1|2416995_2417499_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_115638904.1|2417511_2418054_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_063491976.1|2418061_2418577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063939983.1|2418725_2420063_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYX8	uncultured_Caudovirales_phage	31.9	8.7e-50
WP_115638903.1|2420665_2421749_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	22.5	1.8e-05
WP_054428411.1|2422597_2423101_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_063492581.1|2423112_2424078_+	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_063492582.1|2424240_2426676_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_063491980.1|2426784_2427411_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_127070783.1|2427649_2428513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082833066.1|2428750_2428966_-|transposase	transposase	transposase	NA	NA	NA	NA
2431581:2431596	attR	GCGCCTTCGATATTCC	NA	NA	NA	NA
>prophage 4
NZ_LT546645	Bordetella trematum strain H044680328 chromosome 1	4480141	3307782	3327380	4480141	terminase,tail	Pseudomonas_phage(31.58%)	24	NA	NA
WP_063492199.1|3307782_3308724_+	AAA family ATPase	NA	A0A0U4B0G9	Pseudomonas_phage	36.9	1.1e-51
WP_063492200.1|3308720_3309374_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	47.1	8.3e-30
WP_127070812.1|3309370_3309622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063492202.1|3309818_3310262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063492203.1|3310846_3311296_+	helix-turn-helix domain-containing protein	NA	C7U0W1	Enterobacteria_phage	63.9	7.2e-41
WP_063492204.1|3311282_3312560_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	64.5	1.6e-149
WP_063492205.1|3312562_3313981_+	DUF4055 domain-containing protein	NA	R9TF43	Synechococcus_phage	41.4	4.1e-98
WP_082833074.1|3314009_3315062_+	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	50.3	1.5e-92
WP_063492207.1|3315066_3315309_+	hypothetical protein	NA	A0A0H5AUE5	Pseudomonas_phage	49.4	3.6e-15
WP_063492208.1|3315432_3316032_+	hypothetical protein	NA	R9TF81	Synechococcus_phage	45.0	3.9e-26
WP_063492209.1|3316058_3317027_+	hypothetical protein	NA	R9TJ64	Synechococcus_phage	74.5	2.6e-128
WP_063492210.1|3317036_3317261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063492616.1|3317322_3317805_+	hypothetical protein	NA	A0A088F6L9	Vibrio_phage	40.0	3.6e-14
WP_063492212.1|3318054_3318447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063492213.1|3318448_3318847_+	HK97 gp10 family phage protein	NA	A0A2H4J3F7	uncultured_Caudovirales_phage	38.0	2.4e-19
WP_063492214.1|3318843_3319266_+	DUF4128 domain-containing protein	NA	A0A0H5ARK5	Pseudomonas_phage	48.1	1.4e-25
WP_082833075.1|3319446_3319965_+|tail	phage tail protein	tail	A0A1B0VMG2	Pseudomonas_phage	35.9	2.4e-24
WP_063492216.1|3319977_3320307_+	hypothetical protein	NA	A0A0M7QCN0	Escherichia_phage	30.4	4.7e-05
WP_082833076.1|3320306_3320624_+	DUF1799 domain-containing protein	NA	A0A0S2SY90	Pseudomonas_phage	46.4	1.4e-11
WP_063492218.1|3320641_3323158_+|tail	phage tail tape measure protein	tail	A0A1V0E8B0	Vibrio_phage	30.5	5.4e-69
WP_063492219.1|3323154_3323649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063492220.1|3323638_3324154_+	DUF1833 family protein	NA	A0A1B1P9F1	Acinetobacter_phage	32.5	2.4e-16
WP_063492221.1|3324150_3324492_+	hypothetical protein	NA	A0A0D4DCJ1	Acinetobacter_phage	30.8	8.2e-05
WP_063492222.1|3324488_3327380_+	hypothetical protein	NA	A0A1B1P9G8	Acinetobacter_phage	30.7	4.4e-99
>prophage 5
NZ_LT546645	Bordetella trematum strain H044680328 chromosome 1	4480141	4128311	4149873	4480141	head	Pseudomonas_phage(70.0%)	20	NA	NA
WP_127070851.1|4128311_4131179_-	hypothetical protein	NA	H2BD96	Pseudomonas_phage	29.9	7.4e-14
WP_063492404.1|4131235_4133938_-	hypothetical protein	NA	A0A0H5ART3	Pseudomonas_phage	43.4	2.8e-204
WP_063492405.1|4133891_4134314_-	CHAP domain-containing protein	NA	B5WZT7	Pseudomonas_phage	41.8	1.2e-21
WP_063492406.1|4134310_4134796_-	DUF1833 family protein	NA	A0A0H5BBZ3	Pseudomonas_phage	47.5	4.7e-30
WP_063492407.1|4134792_4135260_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	48.4	2.3e-37
WP_063492408.1|4135256_4138424_-	tape measure protein	NA	A0A125RNN2	Pseudomonas_phage	40.0	1.7e-104
WP_063492409.1|4138439_4139015_-	hypothetical protein	NA	A0A125RNN1	Pseudomonas_phage	56.5	4.0e-52
WP_063492410.1|4139017_4139761_-	Ig-like domain-containing protein	NA	A0A125RNN0	Pseudomonas_phage	63.5	4.6e-69
WP_063492411.1|4139770_4140142_-	hypothetical protein	NA	J7I407	Pseudomonas_phage	48.4	3.1e-29
WP_063492412.1|4140134_4140530_-	hypothetical protein	NA	H2BD87	Pseudomonas_phage	61.9	1.8e-35
WP_063492413.1|4140538_4140859_-	hypothetical protein	NA	J7I4I8	Pseudomonas_phage	67.9	3.8e-36
WP_063492414.1|4140855_4141260_-	hypothetical protein	NA	J7HX89	Pseudomonas_phage	70.2	2.6e-50
WP_063492647.1|4141296_4141779_-	KilA-N domain-containing protein	NA	I6R977	Salmonella_phage	62.1	3.9e-24
WP_063492416.1|4142332_4143409_-	hypothetical protein	NA	J7I0Q9	Pseudomonas_phage	73.1	6.4e-152
WP_063492417.1|4143424_4143862_-	hypothetical protein	NA	A0A125RNM2	Pseudomonas_phage	72.5	3.4e-51
WP_063492418.1|4143865_4145140_-	hypothetical protein	NA	H6WRT2	Salmonella_phage	69.0	7.0e-158
WP_063492419.1|4145142_4146072_-|head	phage head morphogenesis protein	head	H2BD79	Pseudomonas_phage	65.8	6.1e-111
WP_063492420.1|4146185_4147541_-	DUF1073 domain-containing protein	NA	I6R9A1	Salmonella_phage	61.0	1.5e-145
WP_063492422.1|4147760_4149230_-	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	83.3	2.2e-240
WP_063492423.1|4149219_4149873_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	50.3	2.6e-39
>prophage 6
NZ_LT546645	Bordetella trematum strain H044680328 chromosome 1	4480141	4163295	4171820	4480141	integrase	Pseudomonas_phage(37.5%)	12	4163421:4163435	4181842:4181856
WP_063492442.1|4163295_4164396_+	hypothetical protein	NA	Q9MC69	Pseudomonas_phage	47.7	1.9e-34
4163421:4163435	attL	CCTGGGCCAGCCCGC	NA	NA	NA	NA
WP_063492443.1|4164403_4165159_+	ERF family protein	NA	B5WZW4	Pseudomonas_phage	58.8	3.0e-47
WP_063492444.1|4165158_4165794_+	YqaJ viral recombinase family protein	NA	R9TG13	Synechococcus_phage	35.6	3.8e-19
WP_063492445.1|4165796_4166243_+	single-stranded DNA-binding protein	NA	A0A0S2SXT5	Bacillus_phage	36.4	6.3e-05
WP_127070861.1|4166250_4166808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063492446.1|4166901_4167801_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	34.1	6.9e-43
WP_063492447.1|4167797_4168991_+	hypothetical protein	NA	A0A291L9X3	Bordetella_phage	60.7	1.8e-09
WP_063492448.1|4168990_4169254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063492449.1|4169253_4169757_+	class I SAM-dependent methyltransferase	NA	A0A0N7IRF6	Acinetobacter_phage	64.3	2.5e-58
WP_063492450.1|4169753_4170134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063492451.1|4170130_4170322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063492452.1|4170620_4171820_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	58.8	1.2e-127
4181842:4181856	attR	GCGGGCTGGCCCAGG	NA	NA	NA	NA
