The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT599498	Propionibacterium freudenreichii isolate PFRJS22-genome chromosome I	2633661	130615	149105	2633661	integrase,transposase	Mycobacterium_phage(33.33%)	18	144670:144687	147684:147701
WP_013162114.1|130615_131923_+|transposase	ISL3-like element ISPfr6 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	73.0	1.8e-188
WP_013162107.1|132964_133546_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	37.4	7.7e-19
WP_013162108.1|133542_134322_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_013162109.1|134318_134651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041704881.1|135019_135493_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_041704882.1|135751_136210_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_080516165.1|136366_138334_-	KUP/HAK/KT family potassium transporter	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	31.2	6.3e-73
WP_013162114.1|138566_139874_-|transposase	ISL3-like element ISPfr6 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	73.0	1.8e-188
WP_155642810.1|140076_140535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013162098.1|140559_140988_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_097776078.1|141057_143196_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_013162095.1|143934_144237_-	DUF4193 domain-containing protein	NA	NA	NA	NA	NA
144670:144687	attL	GGTTATGTTGACCGGCTC	NA	NA	NA	NA
WP_060762298.1|144820_145762_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	24.2	1.4e-17
WP_129931493.1|145758_146106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013162093.1|146165_146690_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_172664066.1|148041_148326_-	hypothetical protein	NA	NA	NA	NA	NA
147684:147701	attR	GGTTATGTTGACCGGCTC	NA	NA	NA	NA
WP_013162090.1|148614_148791_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_027587608.1|148796_149105_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	59.1	3.5e-23
>prophage 2
NZ_LT599498	Propionibacterium freudenreichii isolate PFRJS22-genome chromosome I	2633661	2210107	2248947	2633661	holin,integrase,portal	Propionibacterium_phage(100.0%)	56	2209782:2209830	2249091:2249139
2209782:2209830	attL	TTCCCAAGCTAGACACGCGGGTTCGATTCCCGTCGCCCGCTCCATCTGT	NA	NA	NA	NA
WP_060762093.1|2210107_2210557_+	hypothetical protein	NA	A0A173G9I1	Propionibacterium_phage	89.9	8.4e-66
WP_060762094.1|2210626_2211067_+	hypothetical protein	NA	A0A1D8EUE4	Propionibacterium_phage	97.3	8.8e-76
WP_155642789.1|2211068_2211995_+	hypothetical protein	NA	A0A1D8EU84	Propionibacterium_phage	94.8	5.6e-173
WP_155642793.1|2212154_2212490_-|holin	holin	holin	A0A173G9G7	Propionibacterium_phage	93.7	1.6e-48
WP_060762095.1|2212510_2213362_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1D8ETE4	Propionibacterium_phage	85.9	1.1e-146
WP_060762096.1|2213412_2213688_-	hypothetical protein	NA	A0A1D8ETK8	Propionibacterium_phage	100.0	1.2e-49
WP_155642790.1|2213684_2214113_-	hypothetical protein	NA	A0A1D8EU35	Propionibacterium_phage	95.8	2.1e-74
WP_060762098.1|2214127_2215819_-	hypothetical protein	NA	A0A1D8EU26	Propionibacterium_phage	95.9	7.6e-293
WP_060762099.1|2215818_2216430_-	hypothetical protein	NA	A0A1D8EU77	Propionibacterium_phage	95.1	4.3e-105
WP_060762100.1|2216472_2216703_-	hypothetical protein	NA	A0A1D8ETJ3	Propionibacterium_phage	98.7	1.3e-33
WP_155642791.1|2216699_2217875_-	hypothetical protein	NA	A0A1D8EU72	Propionibacterium_phage	97.2	2.4e-213
WP_060762102.1|2217874_2218690_-	hypothetical protein	NA	A0A1D8EU13	Propionibacterium_phage	95.9	3.8e-149
WP_172664113.1|2218691_2222300_-	transglycosylase SLT domain-containing protein	NA	A0A1D8EU70	Propionibacterium_phage	89.8	1.1e-275
WP_060762201.1|2222812_2223181_-	hypothetical protein	NA	A0A1D8EU78	Propionibacterium_phage	95.1	1.7e-64
WP_060762200.1|2223180_2223534_-	hypothetical protein	NA	A0A1D8EU71	Propionibacterium_phage	98.3	1.8e-55
WP_060762199.1|2223631_2224495_-	hypothetical protein	NA	A0A1D8ETJ7	Propionibacterium_phage	98.6	4.2e-154
WP_060762198.1|2224504_2224873_-	hypothetical protein	NA	A0A1D8EU76	Propionibacterium_phage	95.1	2.4e-58
WP_060762197.1|2224869_2225118_-	hypothetical protein	NA	A0A1D8ETP5	Propionibacterium_phage	98.8	1.7e-39
WP_060762196.1|2225110_2225428_-	hypothetical protein	NA	A0A1D8EU74	Propionibacterium_phage	97.1	6.8e-54
WP_060762195.1|2225448_2225829_-	hypothetical protein	NA	A0A1D8ETI1	Propionibacterium_phage	96.0	5.7e-63
WP_060762194.1|2225815_2226016_-	hypothetical protein	NA	A0A1D8ETN7	Propionibacterium_phage	97.0	5.3e-28
WP_060762193.1|2226041_2227022_-	DUF5309 family protein	NA	A0A1D8ETU8	Propionibacterium_phage	99.7	7.0e-182
WP_060762192.1|2227038_2227671_-	hypothetical protein	NA	A0A1D8EU60	Propionibacterium_phage	100.0	8.1e-107
WP_060762191.1|2228000_2228765_-	hypothetical protein	NA	A0A1D8EU68	Propionibacterium_phage	99.6	5.3e-145
WP_060762190.1|2228751_2230263_-|portal	phage portal protein	portal	A0A1D8EU66	Propionibacterium_phage	99.4	1.9e-282
WP_060762189.1|2230259_2231714_-	hypothetical protein	NA	A0A1D8ETI8	Propionibacterium_phage	97.7	5.2e-274
WP_097776132.1|2231667_2231862_-	hypothetical protein	NA	A0A1D8ETG8	Propionibacterium_phage	98.4	9.7e-27
WP_060762187.1|2231979_2232474_-	hypothetical protein	NA	A0A1D8EU54	Propionibacterium_phage	99.2	5.3e-69
WP_081083056.1|2232728_2233067_-	HNH endonuclease	NA	A0A1D8ETU6	Propionibacterium_phage	100.0	4.4e-59
WP_155642680.1|2233063_2233240_-	hypothetical protein	NA	A0A1D8ETN0	Propionibacterium_phage	100.0	6.1e-28
WP_060762185.1|2233499_2233715_-	hypothetical protein	NA	A0A1D8ETT9	Propionibacterium_phage	100.0	1.4e-34
WP_060762184.1|2233819_2234536_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1D8ETN6	Propionibacterium_phage	100.0	8.5e-145
WP_155642803.1|2234569_2234800_-	hypothetical protein	NA	A0A1D8ETP3	Propionibacterium_phage	100.0	7.9e-36
WP_060762183.1|2234861_2235329_-	single-stranded DNA-binding protein	NA	A0A1D8ETY8	Propionibacterium_phage	88.9	3.7e-72
WP_060762182.1|2235325_2235673_-	hypothetical protein	NA	A0A1D8ETN9	Propionibacterium_phage	100.0	1.4e-63
WP_060762181.1|2235862_2236228_-	hypothetical protein	NA	A0A1D8ETL8	Propionibacterium_phage	100.0	5.3e-66
WP_060762180.1|2236227_2236608_-	hypothetical protein	NA	A0A1D8ETM4	Propionibacterium_phage	100.0	2.5e-66
WP_060762178.1|2236849_2238949_-	DNA cytosine methyltransferase	NA	A0A1D8ETM2	Propionibacterium_phage	100.0	0.0e+00
WP_060762177.1|2238945_2239197_-	hypothetical protein	NA	A0A1D8ETT2	Propionibacterium_phage	100.0	1.2e-42
WP_060762176.1|2239241_2239535_-	hypothetical protein	NA	A0A1D8ETM6	Propionibacterium_phage	100.0	5.0e-51
WP_155642802.1|2239531_2240062_-	hypothetical protein	NA	A0A1D8ETM9	Propionibacterium_phage	100.0	2.8e-100
WP_060762174.1|2240300_2240534_-	hypothetical protein	NA	A0A1D8ETS1	Propionibacterium_phage	100.0	3.7e-41
WP_155642801.1|2240530_2240755_-	hypothetical protein	NA	A0A1D8ETN3	Propionibacterium_phage	100.0	8.8e-40
WP_060762173.1|2240751_2241312_-	hypothetical protein	NA	A0A1D8ETK7	Propionibacterium_phage	99.5	5.2e-97
WP_060762172.1|2241308_2241641_-	WhiB family transcriptional regulator	NA	A0A1D8ETL1	Propionibacterium_phage	100.0	4.8e-58
WP_155642800.1|2241637_2241802_-	hypothetical protein	NA	A0A1D8ETL9	Propionibacterium_phage	100.0	5.8e-25
WP_060762171.1|2241798_2242638_-	hypothetical protein	NA	A0A1D8ETL0	Propionibacterium_phage	100.0	9.0e-154
WP_157763675.1|2242639_2243344_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A1D8ETS2	Propionibacterium_phage	100.0	8.7e-134
WP_060762169.1|2243487_2244129_-	hypothetical protein	NA	A0A1D8ETL6	Propionibacterium_phage	97.2	7.5e-84
WP_155642799.1|2244199_2244373_-	glycine zipper family protein	NA	NA	NA	NA	NA
WP_060762167.1|2245095_2245311_-	hypothetical protein	NA	A0A1D8ETR2	Propionibacterium_phage	100.0	5.1e-37
WP_060762166.1|2245386_2246190_-	phage antirepressor KilAC domain-containing protein	NA	A0A1D8ETL7	Propionibacterium_phage	100.0	8.4e-149
WP_060762165.1|2246252_2246492_-	helix-turn-helix domain-containing protein	NA	A0A1D8ETJ6	Propionibacterium_phage	100.0	3.8e-33
WP_060762164.1|2246585_2246840_+	helix-turn-helix transcriptional regulator	NA	A0A1D8ETK3	Propionibacterium_phage	100.0	3.0e-36
WP_155642798.1|2247111_2247564_+	hypothetical protein	NA	A0A1D8ETL2	Propionibacterium_phage	99.3	2.2e-45
WP_172664052.1|2247636_2248947_-|integrase	site-specific integrase	integrase	A0A1D8ETK2	Propionibacterium_phage	99.8	8.6e-252
2249091:2249139	attR	TTCCCAAGCTAGACACGCGGGTTCGATTCCCGTCGCCCGCTCCATCTGT	NA	NA	NA	NA
>prophage 3
NZ_LT599498	Propionibacterium freudenreichii isolate PFRJS22-genome chromosome I	2633661	2303638	2372985	2633661	integrase,transposase,tRNA	Mycobacterium_phage(18.75%)	53	2308293:2308309	2375845:2375861
WP_097776113.1|2303638_2304946_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	72.4	1.5e-187
WP_013162142.1|2305141_2305882_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013162141.1|2305904_2306825_-	oxidoreductase	NA	NA	NA	NA	NA
WP_013162140.1|2306848_2307733_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013162139.1|2307732_2308593_+	EamA family transporter	NA	NA	NA	NA	NA
2308293:2308309	attL	GCTCGTCGTCCAGGTCG	NA	NA	NA	NA
WP_036940446.1|2309220_2309904_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_036940449.1|2310060_2310294_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_036940452.1|2310380_2312348_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	39.0	3.3e-106
WP_013160168.1|2313018_2313342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060762127.1|2313407_2314199_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_080516180.1|2314160_2315114_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036942789.1|2315462_2318531_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	32.8	2.1e-139
WP_036942786.1|2318553_2319942_+	MFS transporter	NA	NA	NA	NA	NA
WP_013160161.1|2319987_2320983_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	33.2	1.6e-40
WP_036942782.1|2321224_2322532_+|transposase	ISL3-like element ISPfr4 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	77.2	7.4e-195
WP_060762126.1|2322678_2324097_+|transposase	IS30-like element ISPfr9 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.7	2.1e-33
WP_048733531.1|2324246_2325602_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	42.8	7.1e-92
WP_013161536.1|2326462_2327662_-|transposase	IS30-like element ISPfr14 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	1.7e-33
WP_080713575.1|2329136_2330504_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_048733818.1|2331056_2332499_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_129931506.1|2332502_2333243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036942026.1|2333401_2336797_+	PPi-type phosphoenolpyruvate carboxykinase	NA	NA	NA	NA	NA
WP_013160150.1|2337678_2338200_+	EXLDI protein	NA	NA	NA	NA	NA
WP_013160149.1|2338319_2339174_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_060761222.1|2339216_2339861_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	41.9	5.1e-40
WP_013160147.1|2339973_2340708_-	DUF881 domain-containing protein	NA	NA	NA	NA	NA
WP_013160146.1|2340886_2341174_+	cell division protein CrgA	NA	NA	NA	NA	NA
WP_060762140.1|2341489_2342524_+	DUF4862 family protein	NA	NA	NA	NA	NA
WP_060762139.1|2342748_2344098_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_013160143.1|2344108_2345083_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_036940063.1|2345079_2346192_-	pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_080774433.1|2346336_2347059_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_060762142.1|2347244_2348711_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	35.2	7.0e-69
WP_013160139.1|2348995_2350690_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	23.9	5.3e-20
WP_081084252.1|2350981_2351899_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_171035521.1|2351898_2352258_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_080969671.1|2352422_2353925_-	amino acid permease	NA	NA	NA	NA	NA
WP_048734652.1|2354177_2355068_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_097776133.1|2355164_2355839_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048734656.1|2355838_2357572_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.9	1.1e-33
WP_060762138.1|2357568_2359632_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.0	9.3e-59
WP_013160131.1|2359923_2360823_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_112317753.1|2360840_2361560_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_112317816.1|2361577_2362027_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013160128.1|2362438_2363011_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_013160127.1|2363007_2363673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013160126.1|2363746_2364190_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_147628971.1|2364193_2364658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147628972.1|2364698_2365085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013160123.1|2368766_2369366_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_013160122.1|2369379_2370690_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	23.9	1.4e-12
WP_013160120.1|2371170_2371665_+	transcriptional regulator	NA	A0A2H4PE70	Mycobacterium_phage	40.7	2.0e-07
WP_013160119.1|2371695_2372985_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	29.1	5.3e-36
2375845:2375861	attR	GCTCGTCGTCCAGGTCG	NA	NA	NA	NA
>prophage 4
NZ_LT599498	Propionibacterium freudenreichii isolate PFRJS22-genome chromosome I	2633661	2435445	2504505	2633661	holin,transposase,tRNA	Tupanvirus(13.33%)	54	NA	NA
WP_013160063.1|2435445_2436720_-|tRNA	serine--tRNA ligase	tRNA	A0A2K9L088	Tupanvirus	35.8	2.8e-66
WP_013160062.1|2436867_2438472_+	YegS/Rv2252/BmrU family lipid kinase	NA	NA	NA	NA	NA
WP_013160060.1|2439879_2440560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157763678.1|2440852_2441806_-	aminotransferase class IV	NA	NA	NA	NA	NA
WP_172664057.1|2441798_2443532_-	anthranilate synthase component I family protein	NA	A0A0B5J984	Pandoravirus	36.6	2.8e-64
WP_044657876.1|2443768_2444758_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_044657877.1|2444958_2446146_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_172664107.1|2446523_2447963_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.7e-14
WP_060762135.1|2448017_2449586_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.1	3.8e-105
WP_081084250.1|2449582_2450767_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_060762136.1|2450763_2453802_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_081014329.1|2454349_2455444_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_013160051.1|2455558_2456512_-	macro domain-containing protein	NA	A0A0K1L687	Scale_drop_disease_virus	43.9	7.9e-21
WP_013160035.1|2458517_2459324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013160036.1|2459501_2461037_-	gluconokinase	NA	NA	NA	NA	NA
WP_013160037.1|2461295_2462159_-	Fpg/Nei family DNA glycosylase	NA	NA	NA	NA	NA
WP_013160038.1|2462151_2462877_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_063493591.1|2463423_2465625_-	serine/threonine protein kinase	NA	A0A1M7XTW9	Cedratvirus	26.9	9.1e-12
WP_013160040.1|2465939_2466548_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1J0GVU2	Streptomyces_phage	44.1	1.2e-27
WP_044635867.1|2466760_2468065_-	citrate synthase	NA	NA	NA	NA	NA
WP_013160042.1|2468567_2469371_+	EcsC family protein	NA	NA	NA	NA	NA
WP_055346839.1|2469481_2470315_-	SdpI family protein	NA	NA	NA	NA	NA
WP_157761831.1|2470529_2472134_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_013160045.1|2472155_2473304_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.8	1.6e-31
WP_080713591.1|2473476_2474436_-	phosphopantothenoylcysteine decarboxylase	NA	Q9HH70	Methanothermobacter_phage	39.4	1.1e-25
WP_013160047.1|2475073_2475418_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_080516026.1|2475420_2476173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060762128.1|2476191_2477499_+|transposase	ISL3-like element ISPfr1 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	68.1	3.1e-169
WP_080516022.1|2477533_2478721_+	SPASM domain-containing protein	NA	NA	NA	NA	NA
WP_044636463.1|2479150_2480707_+	xylulose kinase	NA	NA	NA	NA	NA
WP_060762144.1|2480759_2481812_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_013160005.1|2481885_2482662_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.8	6.7e-18
WP_013160006.1|2483094_2484093_+	3-methyladenine DNA glycosylase	NA	NA	NA	NA	NA
WP_112317820.1|2484164_2485352_+	MFS transporter	NA	NA	NA	NA	NA
WP_080969631.1|2485380_2486808_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.1	1.4e-21
WP_013160009.1|2486804_2487500_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013160010.1|2487506_2488421_-	peptidase E	NA	NA	NA	NA	NA
WP_013160011.1|2488476_2488941_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_036940614.1|2488937_2489318_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_036940611.1|2489456_2490461_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_013160014.1|2490464_2491064_+	mismatch-specific DNA-glycosylase	NA	NA	NA	NA	NA
WP_013160015.1|2491347_2492136_+	oxidoreductase	NA	NA	NA	NA	NA
WP_044636457.1|2492102_2493458_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	72.6	6.9e-188
WP_036943364.1|2493381_2493636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013160018.1|2493682_2494777_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_013160019.1|2494839_2495403_-	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_081084284.1|2495586_2496696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044636453.1|2496963_2497386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036940428.1|2497499_2498264_-	slipin family protein	NA	A0A2K9L035	Tupanvirus	32.6	5.0e-26
WP_036940431.1|2499272_2501687_-	cbb3-type cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_013160028.1|2502416_2502614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097776136.1|2502701_2503911_+|transposase	IS3-like element ISPfr11 family transposase	transposase	U5P429	Shigella_phage	34.1	7.2e-35
WP_157763679.1|2503835_2504174_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_063493589.1|2504196_2504505_-|transposase	transposase	transposase	NA	NA	NA	NA
