The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT603683	Bacillus glycinifermentans isolate BGLY chromosome 1	4607442	357227	363632	4607442	protease	Caulobacter_phage(50.0%)	7	NA	NA
WP_046130876.1|357227_357830_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.9	3.7e-24
WP_046130877.1|357859_358441_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	39.9	4.8e-29
WP_046130878.1|358506_359085_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	37.2	8.1e-29
WP_046130879.1|359153_359927_+	TerC family protein	NA	S5MAL1	Bacillus_phage	63.5	3.3e-78
WP_046130880.1|360030_361218_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_046130881.1|361207_362530_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	28.1	3.9e-10
WP_046130882.1|362522_363632_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.5	6.1e-41
>prophage 2
NZ_LT603683	Bacillus glycinifermentans isolate BGLY chromosome 1	4607442	751292	761217	4607442		Synechococcus_phage(50.0%)	9	NA	NA
WP_046130447.1|751292_752588_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.0	4.5e-19
WP_046130446.1|752663_753380_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D8KNF0	Synechococcus_phage	43.7	9.7e-48
WP_046130445.1|753381_753636_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_046130444.1|753632_754316_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_046130443.1|754299_756528_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.5	9.7e-163
WP_046130442.1|756503_757934_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	1.7e-51
WP_046130441.1|758057_759098_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	46.3	2.7e-62
WP_046130440.1|759094_759682_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.5	8.3e-29
WP_046130439.1|759678_761217_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	52.0	9.6e-77
>prophage 3
NZ_LT603683	Bacillus glycinifermentans isolate BGLY chromosome 1	4607442	1324972	1375456	4607442	coat,portal,holin	uncultured_Caudovirales_phage(33.33%)	58	NA	NA
WP_046131188.1|1324972_1325425_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_046131187.1|1325586_1326069_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_046131186.1|1326200_1326707_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_046131185.1|1326774_1327131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046131184.1|1327178_1327565_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_082094112.1|1327679_1328093_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_046131182.1|1328387_1328597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052948531.1|1328677_1328827_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_046131181.1|1328957_1329215_+	sporulation protein	NA	NA	NA	NA	NA
WP_046131180.1|1329256_1331536_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	33.8	3.4e-86
WP_046131179.1|1331653_1331911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046131178.1|1331960_1332548_-	DedA family protein	NA	NA	NA	NA	NA
WP_046131177.1|1332642_1333629_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	37.2	7.3e-54
WP_046131176.1|1333625_1334516_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.1	4.7e-84
WP_046131175.1|1334544_1334937_-	GtrA family protein	NA	NA	NA	NA	NA
WP_046131174.1|1335135_1335564_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046131173.1|1335573_1336083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065894230.1|1336148_1336871_-	esterase family protein	NA	NA	NA	NA	NA
WP_046131171.1|1337442_1337874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046131170.1|1338219_1339338_+	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	26.4	9.0e-16
WP_046131169.1|1339334_1340513_+	cystathionine beta-lyase	NA	A0A0B5JD48	Pandoravirus	29.6	2.8e-20
WP_082094111.1|1341313_1341709_+	DUF3888 domain-containing protein	NA	NA	NA	NA	NA
WP_046131167.1|1342022_1342295_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_046131166.1|1342602_1343376_-	acetoin reductase	NA	NA	NA	NA	NA
WP_046131165.1|1344377_1344740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046131164.1|1344795_1345596_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_046131163.1|1346787_1346994_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_046131162.1|1348337_1348745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052948530.1|1349420_1349627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052948529.1|1349623_1350292_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046131161.1|1350424_1351348_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_046131160.1|1351373_1352540_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_046131320.1|1352597_1354217_-	APC family permease	NA	NA	NA	NA	NA
WP_046131159.1|1354444_1354657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046131158.1|1355097_1355985_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046131157.1|1356224_1358051_+	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_046131156.1|1358077_1359796_+	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_046131155.1|1359853_1360729_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046131154.1|1360830_1361709_+	DMT family transporter	NA	NA	NA	NA	NA
WP_046131153.1|1361773_1362151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046131152.1|1362195_1362741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046131151.1|1363126_1363897_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A217ER34	Bacillus_phage	68.2	2.3e-26
WP_046131149.1|1364639_1366061_-	multidrug efflux MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	24.9	2.2e-19
WP_046131148.1|1366062_1366644_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046131147.1|1366753_1367167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046131146.1|1367298_1367928_+	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	48.2	3.2e-47
WP_052948528.1|1367930_1368593_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	52.3	1.4e-40
WP_046131145.1|1368762_1369116_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	46.9	1.1e-17
WP_164918146.1|1369545_1369689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099047026.1|1369685_1369856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046131144.1|1369852_1370692_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	30.3	9.4e-26
WP_046131143.1|1370591_1371392_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	48.3	1.1e-60
WP_164918147.1|1371391_1371565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046131142.1|1371665_1372001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046131141.1|1371991_1372201_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	57.8	3.3e-12
WP_046131318.1|1374025_1374856_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_046131139.1|1374908_1375178_+	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	61.8	1.8e-23
WP_046131138.1|1375192_1375456_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	71.3	1.8e-28
>prophage 4
NZ_LT603683	Bacillus glycinifermentans isolate BGLY chromosome 1	4607442	1480119	1521443	4607442	protease	Bacillus_phage(44.74%)	59	NA	NA
WP_046132317.1|1480119_1482213_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	41.8	2.5e-128
WP_046132303.1|1482461_1483496_+	membrane protein	NA	NA	NA	NA	NA
WP_046132318.1|1483746_1484406_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	59.0	2.5e-66
WP_046132304.1|1484407_1484848_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_046132305.1|1484840_1485572_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	46.8	8.1e-58
WP_046132306.1|1485591_1486083_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	74.5	1.3e-56
WP_065894728.1|1486466_1487318_+	hypothetical protein	NA	A0A1P8CWU6	Bacillus_phage	39.5	3.2e-37
WP_065894242.1|1487331_1487823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046132611.1|1487819_1488254_+	helix-turn-helix domain-containing protein	NA	A0A2H4IZR0	uncultured_Caudovirales_phage	61.9	6.1e-37
WP_065894247.1|1488467_1488806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065894248.1|1488795_1489125_+	hypothetical protein	NA	A0A0N9SHL8	Paenibacillus_phage	33.0	3.2e-06
WP_167543082.1|1489154_1489298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065894250.1|1489321_1489684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065894252.1|1489698_1490118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065894254.1|1490101_1490476_+	hypothetical protein	NA	A0A2H4J134	uncultured_Caudovirales_phage	42.2	4.5e-20
WP_157678824.1|1491550_1491688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167543083.1|1491704_1491875_+	hypothetical protein	NA	F8WPM2	Bacillus_phage	84.9	1.1e-21
WP_065894257.1|1491871_1492075_+	hypothetical protein	NA	A0A1P8CX62	Bacillus_phage	63.2	5.2e-15
WP_065894263.1|1492093_1492861_+	DNA replication protein	NA	A0A0N7GFF0	Paenibacillus_phage	50.4	2.3e-63
WP_065894267.1|1493070_1493571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065894270.1|1493570_1494020_+	hypothetical protein	NA	S5MUL4	Brevibacillus_phage	42.5	1.9e-25
WP_065894273.1|1494019_1494223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065894275.1|1494219_1495584_+	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	51.2	6.7e-122
WP_065894277.1|1495718_1496732_+	DNA primase	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	45.7	2.1e-72
WP_065894280.1|1496825_1497248_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2SXM3	Bacillus_phage	62.3	2.5e-43
WP_065894282.1|1497257_1497686_-	helix-turn-helix transcriptional regulator	NA	Q5YAA4	Bacillus_phage	60.3	6.9e-41
WP_065894284.1|1498026_1498554_+	hypothetical protein	NA	A0A2H4J6V7	uncultured_Caudovirales_phage	31.7	2.0e-13
WP_164918143.1|1498696_1498849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065894285.1|1498845_1499370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065894286.1|1499617_1500397_+	hypothetical protein	NA	A0A2H4IZK6	uncultured_Caudovirales_phage	51.9	4.1e-60
WP_065894287.1|1500574_1501006_+	hypothetical protein	NA	A0A2H4IZM8	uncultured_Caudovirales_phage	40.3	2.6e-11
WP_065894289.1|1501005_1502061_+	hypothetical protein	NA	A0A142F1R1	Bacillus_phage	28.9	6.5e-16
WP_065894294.1|1502423_1504670_+	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	48.3	1.2e-171
WP_065894296.1|1504684_1505728_+	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	53.8	8.8e-82
WP_065894298.1|1505720_1506281_+	hypothetical protein	NA	A0A0N9ST03	Paenibacillus_phage	42.4	2.9e-07
WP_065894299.1|1506281_1506569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065894301.1|1506568_1506934_+	hypothetical protein	NA	A0A218KDD8	Bacillus_phage	39.3	2.6e-12
WP_048356259.1|1506938_1507196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065894302.1|1507192_1507393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048405729.1|1507389_1507578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065894304.1|1507717_1508080_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	54.9	3.6e-27
WP_083217247.1|1508086_1510186_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	78.1	0.0e+00
WP_083217248.1|1510211_1510550_+	DUF1140 family protein	NA	NA	NA	NA	NA
WP_065894307.1|1510588_1511557_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	79.1	2.5e-147
WP_046132574.1|1511607_1512162_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	54.7	8.0e-42
WP_046132573.1|1512161_1512389_+	hypothetical protein	NA	A0A1P8CX04	Bacillus_phage	62.5	2.1e-17
WP_046132730.1|1512404_1513163_+	FAD-dependent thymidylate synthase	NA	A0A142F1S2	Bacillus_phage	69.0	4.6e-88
WP_065894309.1|1513132_1513702_+	3D domain-containing protein	NA	A0A142F1S8	Bacillus_phage	60.4	4.9e-26
WP_046132570.1|1513889_1514345_+	methyltransferase domain-containing protein	NA	A8ATY8	Listeria_phage	75.3	1.9e-65
WP_046132569.1|1514361_1515327_+	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	43.5	1.6e-21
WP_065894311.1|1515323_1515884_+	dephospho-CoA kinase	NA	A0A0N9SJZ0	Paenibacillus_phage	46.1	5.1e-36
WP_052948565.1|1515896_1516979_+	DNA cytosine methyltransferase	NA	A0A1P8CX13	Bacillus_phage	70.2	2.4e-135
WP_065894313.1|1516967_1517354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046132728.1|1517456_1517846_+	DUF134 domain-containing protein	NA	NA	NA	NA	NA
WP_065894315.1|1517838_1518327_+	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	43.8	8.1e-22
WP_046132565.1|1518415_1519216_+	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	54.2	5.3e-71
WP_065894316.1|1519411_1520839_-	lipase	NA	NA	NA	NA	NA
WP_083217249.1|1520889_1521210_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_099047031.1|1521269_1521443_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	85.7	2.2e-22
>prophage 5
NZ_LT603683	Bacillus glycinifermentans isolate BGLY chromosome 1	4607442	1526642	1596845	4607442	terminase,tail,plate,holin,portal,transposase,integrase	Bacillus_phage(40.74%)	70	1529510:1529524	1564836:1564850
WP_065894327.1|1526642_1527197_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	45.1	9.9e-32
WP_065894331.1|1527905_1529342_+|terminase	phage terminase large subunit	terminase	A0A0N9RZA7	Paenibacillus_phage	52.0	7.7e-129
WP_065894333.1|1529408_1530893_+|portal	phage portal protein	portal	D9ZNC8	Clostridium_phage	21.7	7.7e-15
1529510:1529524	attL	AAAGCCGAAAGAAAT	NA	NA	NA	NA
WP_065894335.1|1530986_1531712_+	scaffolding protein	NA	Q4ZC70	Staphylococcus_virus	54.2	3.2e-06
WP_065894338.1|1531770_1532895_+	DUF5309 family protein	NA	NA	NA	NA	NA
WP_065894340.1|1532946_1533366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065894342.1|1533365_1533557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046132549.1|1533571_1533910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052948563.1|1533906_1534716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065894344.1|1534731_1535121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065894346.1|1535117_1535474_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_065894348.1|1535470_1535911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065894350.1|1535928_1536399_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_083217251.1|1536352_1536649_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	73.0	7.8e-28
WP_065894351.1|1536705_1537071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065894352.1|1537154_1537373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065894353.1|1537388_1540526_+|tail	phage tail tape measure protein	tail	A0A288WG88	Bacillus_phage	44.9	1.7e-80
WP_065894356.1|1540522_1541341_+|tail	phage tail family protein	tail	A6M962	Geobacillus_virus	53.0	8.2e-75
WP_099047032.1|1541352_1542702_+|tail	phage tail protein	tail	A6M966	Geobacillus_virus	35.7	1.1e-52
WP_065894358.1|1542717_1545282_+	peptidase G2	NA	D6R401	Bacillus_phage	65.9	0.0e+00
WP_065894360.1|1545294_1546662_+|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	52.2	1.4e-63
WP_048355856.1|1546676_1546961_+	hypothetical protein	NA	M4ZR44	Bacillus_phage	44.7	5.6e-15
WP_048407040.1|1546962_1547184_+	XkdX family protein	NA	NA	NA	NA	NA
WP_046132536.1|1547187_1547394_+	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	47.9	8.7e-10
WP_065894361.1|1547463_1548405_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	64.1	3.9e-97
WP_065894362.1|1548425_1548656_+|holin	phage holin	holin	A0A1D6Z272	Staphylococcus_phage	57.1	2.8e-17
WP_065894366.1|1548911_1549106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065894372.1|1549113_1549638_+	GNAT family N-acetyltransferase	NA	A0A0M3ULL7	Bacillus_phage	45.9	5.8e-34
WP_065894373.1|1549837_1550638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065894374.1|1550690_1550903_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065894380.1|1551064_1551844_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065894382.1|1552141_1553287_+|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	32.7	4.7e-44
WP_128748085.1|1553779_1553968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046132307.1|1554118_1554634_-	damage-inducible protein DinB	NA	NA	NA	NA	NA
WP_046132308.1|1554980_1555214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046132309.1|1555354_1555843_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046132310.1|1555874_1556216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046132311.1|1556597_1557530_+	DUF1672 family protein	NA	NA	NA	NA	NA
WP_046132312.1|1557545_1558721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046132313.1|1558729_1558963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128748087.1|1559096_1559648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006638423.1|1559762_1559951_-	DUF2187 family protein	NA	NA	NA	NA	NA
WP_046132315.1|1560120_1560315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046132316.1|1560546_1561149_+	cell wall hydrolase	NA	A0A172JHR8	Bacillus_phage	51.2	1.4e-26
WP_046132458.1|1562938_1564279_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_152654495.1|1564350_1564833_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_046132456.1|1565089_1566997_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.8	1.0e-112
1564836:1564850	attR	ATTTCTTTCGGCTTT	NA	NA	NA	NA
WP_099047033.1|1567072_1568432_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	72.5	1.9e-108
WP_046132442.1|1568573_1569668_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_046132443.1|1570007_1570979_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	23.4	3.6e-13
WP_096891708.1|1571046_1571943_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_046132445.1|1572163_1574263_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	42.0	8.1e-10
WP_006638411.1|1574354_1574621_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_046132446.1|1574620_1576339_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_046131854.1|1578124_1578352_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_046131855.1|1578421_1579450_+	spore photoproduct lyase	NA	NA	NA	NA	NA
WP_046131858.1|1579519_1580149_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046131856.1|1580293_1582261_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	53.4	1.6e-12
WP_046131859.1|1582360_1583146_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_046131857.1|1583158_1584031_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_065894138.1|1584062_1585493_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	50.0	5.3e-122
WP_046132426.1|1585624_1586353_-	hypothetical protein	NA	A0A0E3T7R5	Bacillus_phage	65.6	1.5e-40
WP_046132425.1|1586697_1588806_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_046132424.1|1588966_1590778_+	PAS domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.0	7.2e-07
WP_046132423.1|1590804_1591974_-	aminotransferase A	NA	NA	NA	NA	NA
WP_167543081.1|1592134_1592290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046132422.1|1592434_1592974_+	RDD family protein	NA	NA	NA	NA	NA
WP_099047034.1|1593049_1594369_+	MFS transporter	NA	NA	NA	NA	NA
WP_046132420.1|1594443_1595364_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	35.4	5.4e-51
WP_046131917.1|1595492_1596845_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	40.3	4.2e-84
>prophage 6
NZ_LT603683	Bacillus glycinifermentans isolate BGLY chromosome 1	4607442	1889880	1900515	4607442	holin	Bacillus_phage(100.0%)	10	NA	NA
WP_065894416.1|1889880_1890978_+	RapH N-terminal domain-containing protein	NA	A0A1P8CWN8	Bacillus_phage	27.9	1.9e-39
WP_164918151.1|1890977_1891115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048354003.1|1891906_1892215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048354004.1|1892233_1892515_-|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	44.1	2.4e-10
WP_021837858.1|1892533_1892920_-	hypothetical protein	NA	A0A1P8CWP1	Bacillus_phage	72.7	3.1e-40
WP_065894418.1|1893051_1894143_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	69.5	2.6e-113
WP_157759328.1|1894295_1894460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046132710.1|1894479_1897044_-	Pre-neck appendage protein	NA	D6R401	Bacillus_phage	40.6	2.2e-158
WP_046132709.1|1897062_1897860_-	hypothetical protein	NA	O64043	Bacillus_phage	59.7	5.5e-76
WP_046132708.1|1897875_1900515_-	hypothetical protein	NA	A0A1P8CWQ0	Bacillus_phage	51.3	5.8e-239
>prophage 7
NZ_LT603683	Bacillus glycinifermentans isolate BGLY chromosome 1	4607442	1920415	1946505	4607442	integrase	Bacillus_phage(79.17%)	29	1916169:1916184	1945175:1945190
1916169:1916184	attL	ATTTTCTTTTTCATAA	NA	NA	NA	NA
WP_052948571.1|1920415_1921495_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	39.1	9.5e-55
WP_046132743.1|1921487_1921985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006640209.1|1922128_1923130_-|integrase	site-specific integrase	integrase	A0A1P8CWP6	Bacillus_phage	85.9	1.3e-170
WP_046132695.1|1923144_1923564_-	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	54.9	5.7e-40
WP_046132694.1|1923563_1924046_-	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	34.6	1.3e-16
WP_046132693.1|1924084_1924276_-	XkdX family protein	NA	NA	NA	NA	NA
WP_046132692.1|1924272_1924590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046132691.1|1924602_1926258_-	hypothetical protein	NA	M4ZRP1	Bacillus_phage	60.3	6.0e-16
WP_046132690.1|1926260_1926626_-	hypothetical protein	NA	A0A1P8CWQ8	Bacillus_phage	47.7	1.2e-22
WP_046132689.1|1927197_1928004_-	hypothetical protein	NA	A0A0N7GFG4	Staphylococcus_phage	33.2	7.1e-31
WP_065894420.1|1928048_1928768_-	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	42.9	2.1e-50
WP_046132687.1|1928764_1929295_-	hypothetical protein	NA	O64060	Bacillus_phage	62.5	5.0e-57
WP_046132686.1|1929291_1929951_-	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	68.1	1.2e-79
WP_052948568.1|1929937_1930180_-	hypothetical protein	NA	A0A1P8CWS7	Bacillus_phage	49.4	1.0e-09
WP_046132685.1|1930176_1930575_-	hypothetical protein	NA	A0A1P8CWR5	Bacillus_phage	63.6	3.4e-42
WP_046132684.1|1930586_1931057_-	hypothetical protein	NA	A0A1P8CWS5	Bacillus_phage	80.1	8.5e-69
WP_046132683.1|1931091_1932108_-	hypothetical protein	NA	A0A1P8CWR9	Bacillus_phage	84.6	9.2e-161
WP_046132682.1|1932152_1932755_-	hypothetical protein	NA	A0A1P8CWS2	Bacillus_phage	84.1	2.0e-78
WP_046132681.1|1932780_1934220_-	hypothetical protein	NA	A0A1P8CWR1	Bacillus_phage	65.9	5.0e-176
WP_046132680.1|1934253_1935774_-	hypothetical protein	NA	O64068	Bacillus_phage	82.0	1.4e-245
WP_046132679.1|1935791_1937561_-	hypothetical protein	NA	O64069	Bacillus_phage	91.7	0.0e+00
WP_046132678.1|1937544_1938477_-	hypothetical protein	NA	A0A1P8CWS6	Bacillus_phage	76.3	8.3e-140
WP_046132677.1|1938757_1939948_-	metallophosphoesterase	NA	A0A0N9SK37	Staphylococcus_phage	38.0	7.0e-67
WP_046132676.1|1939960_1940152_-	YonK family protein	NA	A0A1P8CWT3	Bacillus_phage	88.9	8.9e-25
WP_046132675.1|1940796_1941312_-	hypothetical protein	NA	L0L915	Bacillus_phage	49.7	1.9e-37
WP_046132674.1|1941377_1941608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006640182.1|1942552_1942828_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	75.6	3.5e-30
WP_046132673.1|1942933_1943734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046132672.1|1943730_1946505_-	hypothetical protein	NA	H7BV05	unidentified_phage	29.4	2.3e-105
1945175:1945190	attR	ATTTTCTTTTTCATAA	NA	NA	NA	NA
>prophage 8
NZ_LT603683	Bacillus glycinifermentans isolate BGLY chromosome 1	4607442	1971392	1983428	4607442	integrase	Bacillus_phage(83.33%)	22	1964298:1964312	1974756:1974770
1964298:1964312	attL	AATTAAAAGTATAAA	NA	NA	NA	NA
WP_065894450.1|1971392_1972769_+	hypothetical protein	NA	A0A1P8CWX1	Bacillus_phage	32.9	6.8e-58
WP_065894452.1|1972786_1973791_+|integrase	site-specific integrase	integrase	O64101	Bacillus_phage	39.1	1.3e-58
WP_048356239.1|1974178_1974451_+	YopT family protein	NA	NA	NA	NA	NA
WP_046132647.1|1975239_1975977_+	hypothetical protein	NA	A0A0A8WIT2	Clostridium_phage	57.1	2.3e-68
1974756:1974770	attR	AATTAAAAGTATAAA	NA	NA	NA	NA
WP_065894454.1|1975973_1976321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065894458.1|1976348_1976597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065894459.1|1976625_1976913_+	hypothetical protein	NA	A0A0E3DEX0	Bacillus_phage	51.6	9.3e-18
WP_157759331.1|1976949_1977093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065894460.1|1977111_1977360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065894462.1|1977395_1977686_+	hypothetical protein	NA	A0A127AWI5	Bacillus_phage	46.7	1.7e-14
WP_048355015.1|1977855_1978074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048355017.1|1978334_1978535_+	hypothetical protein	NA	F8WPL5	Bacillus_phage	60.6	1.8e-15
WP_164918129.1|1978567_1978711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046132636.1|1979242_1979770_+	hypothetical protein	NA	U5PUK4	Bacillus_phage	57.5	3.1e-51
WP_046132634.1|1980094_1980298_+	hypothetical protein	NA	A0A217ER53	Bacillus_phage	54.8	3.2e-12
WP_046132633.1|1980364_1981177_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	74.0	1.2e-115
WP_046132632.1|1981269_1981494_+	hypothetical protein	NA	O64132	Bacillus_phage	66.2	1.7e-22
WP_046132631.1|1981490_1981853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065894466.1|1981910_1982189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065894468.1|1982201_1982381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065894470.1|1982565_1983015_+	hypothetical protein	NA	S5MUL4	Brevibacillus_phage	42.5	7.2e-25
WP_065894472.1|1983014_1983428_+	hypothetical protein	NA	O64129	Bacillus_phage	80.6	1.2e-58
>prophage 9
NZ_LT603683	Bacillus glycinifermentans isolate BGLY chromosome 1	4607442	1986827	1996671	4607442		Bacillus_phage(100.0%)	9	NA	NA
WP_065894474.1|1986827_1987160_+	hypothetical protein	NA	O64139	Bacillus_phage	48.2	1.2e-13
WP_065894479.1|1987409_1988321_+	hypothetical protein	NA	A0A1P8CX09	Bacillus_phage	68.3	3.1e-115
WP_046132621.1|1988375_1989347_+	ATP-binding protein	NA	A0A1P8CX29	Bacillus_phage	85.4	2.0e-157
WP_046132620.1|1989388_1989859_+	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	67.3	8.3e-56
WP_065894480.1|1989873_1991388_+	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	81.3	1.2e-236
WP_065894481.1|1991404_1992538_+	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	69.7	2.5e-159
WP_046132617.1|1992541_1994263_+	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	66.0	3.3e-219
WP_065894483.1|1994278_1995688_+	PHP domain-containing protein	NA	A0A1P8CX14	Bacillus_phage	85.8	4.0e-239
WP_052948566.1|1995738_1996671_+	helix-turn-helix domain-containing protein	NA	A7KV45	Bacillus_phage	36.4	4.8e-31
>prophage 10
NZ_LT603683	Bacillus glycinifermentans isolate BGLY chromosome 1	4607442	2005380	2023609	4607442	tRNA	Bacillus_phage(78.95%)	28	NA	NA
WP_065894495.1|2005380_2005725_+	antitoxin endoai	NA	O64171	Bacillus_phage	40.8	1.7e-13
WP_065894497.1|2005724_2006129_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	63.6	2.3e-38
WP_167543088.1|2006100_2009343_+	hypothetical protein	NA	A0A1P8CX40	Bacillus_phage	85.2	0.0e+00
WP_065894499.1|2009365_2009587_+	hypothetical protein	NA	A0A1P8CX04	Bacillus_phage	68.5	3.3e-23
WP_065894501.1|2009587_2010568_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4JMU8	Bacillus_phage	82.2	2.3e-148
WP_065894503.1|2010817_2011174_+|tRNA	peptidyl-tRNA hydrolase	tRNA	A0A1V0SFB5	Hokovirus	30.6	6.4e-08
WP_065894505.1|2011221_2011521_+	hypothetical protein	NA	A0A0A0RSF8	Bacillus_phage	38.0	5.7e-10
WP_065894514.1|2011540_2011975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065894516.1|2012018_2012453_+	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	84.5	1.6e-66
WP_167543085.1|2012563_2012728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046132827.1|2012770_2012959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046132828.1|2012951_2013260_+	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	52.1	2.6e-10
WP_046132829.1|2013249_2013807_+	hypothetical protein	NA	G3MBK8	Bacillus_virus	53.1	3.1e-49
WP_046132830.1|2013808_2014906_+	hypothetical protein	NA	G3MBL0	Bacillus_virus	51.8	4.0e-109
WP_046132831.1|2014918_2015758_+	thymidylate synthase	NA	U5J9N5	Bacillus_phage	42.0	1.4e-53
WP_046132832.1|2015946_2016312_+	hypothetical protein	NA	A0A1P8CX43	Bacillus_phage	45.3	1.2e-17
WP_046132833.1|2016547_2017030_+	hypothetical protein	NA	A0A076G5S9	Staphylococcus_phage	26.8	4.3e-07
WP_157759332.1|2017044_2017218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023856099.1|2017556_2017805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046132834.1|2017827_2018172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052948584.1|2018340_2018685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046132835.1|2018685_2019693_+	hypothetical protein	NA	R4JEY6	Bacillus_phage	38.2	4.1e-44
WP_046132836.1|2020022_2020223_-	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	82.5	3.7e-21
WP_065894518.1|2020311_2020827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046132838.1|2020855_2021683_+	metallophosphoesterase	NA	O64184	Bacillus_phage	84.7	1.6e-147
WP_046132839.1|2021698_2022055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065894743.1|2022336_2022786_+	NADAR family protein	NA	A0A172JI41	Bacillus_phage	64.7	4.4e-46
WP_046132843.1|2022997_2023609_+	hypothetical protein	NA	A0A1P8CX67	Bacillus_phage	80.8	1.1e-81
>prophage 11
NZ_LT603683	Bacillus glycinifermentans isolate BGLY chromosome 1	4607442	2624274	2636533	4607442	transposase	Staphylococcus_phage(50.0%)	15	NA	NA
WP_046129828.1|2624274_2624739_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	71.1	1.0e-45
WP_046129827.1|2624773_2625970_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.2	9.6e-117
WP_046129826.1|2625989_2626637_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	42.2	3.7e-38
WP_046129825.1|2626648_2627737_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	38.9	3.0e-56
WP_046129824.1|2628105_2628450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046129823.1|2629046_2629343_+	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_099047054.1|2629351_2629732_+|transposase	IS3 family transposase	transposase	A0A0N9S8A3	Staphylococcus_phage	31.6	5.4e-05
WP_099047055.1|2629713_2630232_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	50.0	5.4e-40
WP_046129822.1|2630288_2630726_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_046129821.1|2630857_2631106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046129820.1|2631095_2632226_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	46.3	3.6e-89
WP_046129819.1|2632462_2632900_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	45.5	2.4e-17
WP_046129818.1|2633180_2634077_+	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_046129817.1|2634131_2634935_-	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	51.1	6.4e-56
WP_046129816.1|2635102_2636533_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.1	3.7e-30
>prophage 12
NZ_LT603683	Bacillus glycinifermentans isolate BGLY chromosome 1	4607442	3159710	3245001	4607442	terminase,tail,tRNA,coat,holin,capsid,head,portal,protease	uncultured_Caudovirales_phage(34.15%)	98	NA	NA
WP_046132060.1|3159710_3162353_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.6	9.8e-162
WP_082094150.1|3162813_3163005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046132058.1|3163041_3164064_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_046132057.1|3164080_3165586_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_046132056.1|3165709_3167005_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_046132055.1|3167031_3168006_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_046132054.1|3168009_3168798_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_046132053.1|3168787_3169729_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_046132052.1|3169764_3170595_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_046132051.1|3170599_3171961_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_046132050.1|3172146_3172632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046132049.1|3172679_3173267_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_046132048.1|3173263_3175588_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	45.2	6.5e-186
WP_046132047.1|3175791_3177447_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	36.6	8.3e-18
WP_046132046.1|3177573_3178839_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.8	1.9e-147
WP_046132045.1|3179109_3180384_-	trigger factor	NA	NA	NA	NA	NA
WP_046132044.1|3180613_3181621_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_046132043.1|3181744_3182344_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_046132042.1|3182356_3183775_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_046132041.1|3183808_3184921_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_046132040.1|3184948_3186505_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.5	3.0e-09
WP_046132039.1|3186491_3187520_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_046132038.1|3187551_3188070_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_046132037.1|3188066_3189791_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.2	5.2e-63
WP_046132036.1|3190197_3191112_-	branched-chain-amino-acid transaminase	NA	NA	NA	NA	NA
WP_082094149.1|3191569_3191857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046132147.1|3191876_3193226_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_046132034.1|3194024_3194420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046132146.1|3195056_3195518_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_046132003.1|3198012_3198525_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_046132002.1|3198545_3199130_-	XTP/dITP diphosphatase	NA	A0A2H4UUV7	Bodo_saltans_virus	31.6	5.4e-12
WP_046132001.1|3199155_3199899_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_046132000.1|3200021_3201131_-	sporulation protein	NA	NA	NA	NA	NA
WP_082094146.1|3201290_3202115_-	glutamate racemase	NA	NA	NA	NA	NA
WP_046131998.1|3202122_3202566_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042631274.1|3202728_3202803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048354316.1|3202849_3204373_-	recombinase family protein	NA	A0A290FZV2	Caldibacillus_phage	52.9	7.1e-149
WP_065894759.1|3204554_3204875_+	YolD-like family protein	NA	O64030	Bacillus_phage	34.0	2.7e-10
WP_065894608.1|3204898_3205360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083217257.1|3205366_3205774_-	SocA family protein	NA	I6R0L8	Salmonella_phage	45.6	6.1e-23
WP_065894611.1|3206321_3206552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046131995.1|3206576_3207158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046131994.1|3207322_3208405_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	54.1	2.1e-46
WP_065894613.1|3208456_3208720_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	72.4	5.1e-31
WP_065894615.1|3208735_3209005_-	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	62.9	1.6e-24
WP_065894617.1|3209090_3209357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065894619.1|3209371_3209557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157759342.1|3209556_3209703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065894621.1|3209686_3210073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065894626.1|3210093_3213489_-|tail	phage tail protein	tail	Q5YA57	Bacillus_phage	45.3	9.4e-133
WP_046131988.1|3213501_3214266_-|tail	phage tail family protein	tail	A0A059T682	Listeria_phage	27.3	8.0e-08
WP_065894628.1|3214262_3219143_-	hypothetical protein	NA	Q4ZC60	Staphylococcus_virus	26.3	9.3e-33
WP_046131986.1|3219158_3219455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046131985.1|3219502_3220015_-	phage protein	NA	NA	NA	NA	NA
WP_082094145.1|3220098_3220425_-	fibronectin type III domain-containing protein	NA	R4JF61	Bacillus_phage	67.5	1.5e-24
WP_052948546.1|3220354_3220873_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_065894630.1|3220886_3221285_-	DUF3168 domain-containing protein	NA	W8EK61	Geobacillus_phage	45.4	6.4e-25
WP_065894632.1|3221300_3221720_-	HK97 gp10 family phage protein	NA	O48447	Bacillus_phage	59.1	9.4e-35
WP_065894634.1|3221712_3222057_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_065894636.1|3222056_3222365_-	hypothetical protein	NA	A0A1W6JQJ1	Staphylococcus_phage	40.2	5.7e-13
WP_065894638.1|3222377_3222650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065894640.1|3222651_3222990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065894643.1|3222993_3223914_-|capsid	phage major capsid protein	capsid	A0A2H4JCG0	uncultured_Caudovirales_phage	64.0	9.1e-107
WP_065894644.1|3223929_3224511_-	DUF4355 domain-containing protein	NA	A0A2H4J4P4	uncultured_Caudovirales_phage	56.0	2.2e-50
WP_157759343.1|3224621_3224780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046131976.1|3224908_3225232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164918166.1|3225224_3225380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065894646.1|3225381_3226305_-|head	phage head morphogenesis protein	head	A0A1Q1PVS0	Bacillus_phage	51.5	3.0e-81
WP_065894648.1|3226291_3227686_-|portal	phage portal protein	portal	A0A2H4J4Q7	uncultured_Caudovirales_phage	59.7	6.5e-149
WP_065894650.1|3227682_3228960_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	70.0	1.2e-154
WP_065894652.1|3228956_3229706_-	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	53.8	4.0e-60
WP_065894654.1|3230110_3230566_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	78.1	3.4e-62
WP_065894656.1|3231012_3231822_-	DNA adenine methylase	NA	U5P0W8	Brevibacillus_phage	59.4	1.8e-90
WP_065894658.1|3231803_3232820_-	DNA (cytosine-5-)-methyltransferase	NA	A8YQM6	Lactobacillus_phage	44.5	3.6e-64
WP_065894660.1|3232824_3233076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065894665.1|3233072_3233390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065894667.1|3233386_3233788_-	hypothetical protein	NA	S5MUL4	Brevibacillus_phage	47.1	4.0e-27
WP_048355005.1|3233784_3234231_-	phage YopX like protein	NA	A0A1B1P7V7	Bacillus_phage	37.4	8.0e-08
WP_048355006.1|3234265_3234472_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	60.0	5.3e-15
WP_167543086.1|3234547_3234712_-	hypothetical protein	NA	A0A2H4J4N7	uncultured_Caudovirales_phage	64.4	3.7e-11
WP_046131957.1|3234831_3235290_-	DUF1064 domain-containing protein	NA	A0A2H4J891	uncultured_Caudovirales_phage	70.0	7.8e-51
WP_164918168.1|3235383_3235527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052948543.1|3235539_3236322_-	ATP-binding protein	NA	A0A2H4J4P8	uncultured_Caudovirales_phage	70.4	1.2e-102
WP_046131956.1|3237450_3238302_-	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	78.9	2.3e-120
WP_046131955.1|3238303_3239254_-	YqaJ viral recombinase family protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	76.5	6.0e-138
WP_046131954.1|3239253_3239442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046131953.1|3239434_3239629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046131952.1|3240171_3240429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046131951.1|3240430_3240994_-	helix-turn-helix domain-containing protein	NA	A0A2H4J884	uncultured_Caudovirales_phage	54.0	8.7e-60
WP_046131950.1|3241060_3241750_-	antirepressor	NA	A0A1B1IMQ3	Lactococcus_phage	45.8	1.9e-32
WP_164918169.1|3241802_3241943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046131949.1|3242066_3242378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095267021.1|3242374_3242515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011197841.1|3242525_3242762_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046131948.1|3242896_3243265_+	helix-turn-helix transcriptional regulator	NA	A0A0B5CYL9	Listeria_phage	35.6	1.3e-11
WP_046131947.1|3243528_3243810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046131946.1|3243903_3244425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046131945.1|3244524_3245001_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	40.9	3.9e-29
>prophage 13
NZ_LT603683	Bacillus glycinifermentans isolate BGLY chromosome 1	4607442	3372402	3385820	4607442	plate,holin,transposase,tail	Bacillus_phage(81.82%)	13	NA	NA
WP_046130835.1|3372402_3372726_+	YolD-like family protein	NA	O64030	Bacillus_phage	29.4	1.7e-07
WP_046130817.1|3373139_3373850_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_046130816.1|3374054_3374906_+	DUF2202 domain-containing protein	NA	NA	NA	NA	NA
WP_046130815.1|3375059_3375653_+	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	67.6	6.4e-53
WP_046130814.1|3375773_3376715_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A141HSE6	Bacillus_phage	42.3	6.5e-60
WP_046130813.1|3376762_3377173_-|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	50.8	1.1e-24
WP_099047033.1|3377246_3378607_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	72.5	1.9e-108
WP_046131116.1|3378639_3378837_-	XkdX family protein	NA	A0EWM9	Staphylococcus_virus	45.8	7.3e-06
WP_046131115.1|3378833_3379136_-	phage protein	NA	O64053	Bacillus_phage	33.9	7.8e-07
WP_046131114.1|3379150_3380647_-|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	64.6	1.5e-63
WP_046131113.1|3380659_3383224_-	peptidase G2	NA	D6R401	Bacillus_phage	61.0	7.1e-311
WP_065894673.1|3383258_3384971_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	67.7	1.3e-223
WP_046131112.1|3384983_3385820_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	67.9	2.2e-107
>prophage 14
NZ_LT603683	Bacillus glycinifermentans isolate BGLY chromosome 1	4607442	3840380	3890484	4607442	terminase,tail,plate,holin,capsid,head,portal,transposase,protease,integrase	Bacillus_phage(38.46%)	65	3838312:3838331	3875305:3875324
3838312:3838331	attL	GTATGGAGACGGTGGGAGTC	NA	NA	NA	NA
WP_046129175.1|3840380_3841460_-	N-acetylmuramoyl-L-alanine amidase	NA	S6BFI4	Thermus_phage	49.8	2.1e-46
WP_046129174.1|3841511_3841775_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	74.7	3.0e-31
WP_046129173.1|3841790_3842060_-	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	60.7	1.7e-21
WP_082094024.1|3842134_3843745_-|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	58.2	2.5e-59
WP_046129171.1|3843760_3846328_-	peptidase G2	NA	D6R401	Bacillus_phage	58.9	5.4e-298
WP_046129170.1|3846346_3848233_-	autolysin	NA	D6R400	Bacillus_phage	30.6	2.7e-65
WP_046129169.1|3848247_3849075_-|tail	phage tail family protein	tail	M4ZS20	Bacillus_phage	37.5	1.5e-39
WP_167543089.1|3849071_3852248_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	44.1	8.4e-67
WP_043054118.1|3853594_3853957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046129168.1|3853956_3854589_-	hypothetical protein	NA	A0A2H4J8F3	uncultured_Caudovirales_phage	33.2	7.6e-20
WP_046129167.1|3854588_3854969_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_052948491.1|3854965_3855379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128748282.1|3855356_3855719_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	34.7	4.6e-06
WP_099047123.1|3855675_3855957_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	46.0	3.8e-16
WP_046129164.1|3855943_3857245_-|capsid	phage major capsid protein	capsid	A0A1C8E976	Bacillus_phage	54.2	7.1e-89
WP_046129163.1|3857241_3857832_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	56.4	2.4e-52
WP_046129162.1|3857824_3859003_-|portal	phage portal protein	portal	A0A2H4J9C7	uncultured_Caudovirales_phage	53.4	2.3e-107
WP_046129264.1|3859015_3860722_-|terminase	terminase large subunit	terminase	A0A1B0T685	Bacillus_phage	56.7	1.6e-189
WP_043054550.1|3860766_3861171_-	hypothetical protein	NA	A0A1C8E969	Bacillus_phage	44.9	9.4e-24
WP_046129161.1|3861248_3861620_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_046129160.1|3861616_3861826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046129159.1|3862131_3862761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046129158.1|3862748_3862994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046129157.1|3862996_3863221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043054107.1|3863582_3863765_+	type II toxin-antitoxin system HicA family toxin	NA	D6R431	Bacillus_phage	90.0	1.7e-25
WP_046129156.1|3863813_3864230_+	pilus assembly protein HicB	NA	D6R430	Bacillus_phage	88.3	3.8e-68
WP_164918132.1|3864359_3864515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046129154.1|3864734_3865277_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	61.1	2.5e-56
WP_046129153.1|3865276_3865717_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	50.4	1.5e-35
WP_046129152.1|3866143_3866953_-	DNA adenine methylase	NA	U5P0W8	Brevibacillus_phage	59.1	1.2e-89
WP_046129151.1|3867026_3867278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046129150.1|3867274_3867508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046129149.1|3867542_3867749_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	47.6	1.4e-07
WP_128748284.1|3867821_3867971_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_046129148.1|3868075_3868624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017475015.1|3868775_3868934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046129263.1|3868947_3869781_-	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	37.4	6.4e-35
WP_046129147.1|3869764_3870622_-	DNA damage-inducible protein DnaD	NA	A0A0U3TZZ4	Bacillus_phage	52.3	7.8e-60
WP_046129146.1|3870614_3870845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052948490.1|3870897_3871296_+	hypothetical protein	NA	R9VW35	Paenibacillus_phage	34.6	7.4e-05
WP_046129145.1|3871282_3871558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046129144.1|3871559_3871805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046129143.1|3871875_3872646_-	antirepressor	NA	A0A290FZK7	Caldibacillus_phage	73.5	4.9e-106
WP_046129142.1|3872642_3872849_-	helix-turn-helix transcriptional regulator	NA	A0A1B2APY7	Phage_Wrath	56.7	2.1e-11
WP_046129141.1|3872885_3873077_-	helix-turn-helix transcriptional regulator	NA	A0A2P1JU05	Anoxybacillus_phage	55.7	1.3e-12
WP_052948489.1|3873236_3873653_+	helix-turn-helix transcriptional regulator	NA	A0A2P1JU09	Anoxybacillus_phage	55.5	4.5e-29
WP_046129139.1|3873675_3874119_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	62.8	4.2e-49
WP_046129138.1|3874167_3875232_+|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	64.3	2.0e-134
WP_046129137.1|3875777_3876251_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	62.5	3.5e-46
3875305:3875324	attR	GTATGGAGACGGTGGGAGTC	NA	NA	NA	NA
WP_046129136.1|3876363_3878667_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	41.4	4.5e-94
WP_046129135.1|3878680_3879427_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_046129134.1|3879544_3879775_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_046129133.1|3879934_3880219_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A0K2CZ86	Paenibacillus_phage	50.0	3.2e-10
WP_096892181.1|3880247_3880433_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046129131.1|3880633_3881038_+	transcriptional regulator	NA	S6C481	Thermus_phage	65.3	7.7e-18
WP_046129130.1|3881194_3881593_+	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	60.3	4.6e-15
WP_046129261.1|3881639_3882317_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_046129129.1|3882337_3883255_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046129128.1|3883268_3883922_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_046129127.1|3883934_3885077_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	F2Y1V5	Organic_Lake_phycodnavirus	31.1	2.3e-14
WP_046129126.1|3885336_3885873_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_099047013.1|3885923_3887284_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	72.8	1.1e-108
WP_046132922.1|3887357_3887990_-	NAAT family transporter	NA	NA	NA	NA	NA
WP_046132923.1|3888138_3888918_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_065894138.1|3889053_3890484_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	50.0	5.3e-122
