The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT604074	Ligilactobacillus salivarius isolate LPM01 chromosome I	1788723	315985	325005	1788723		Streptococcus_phage(33.33%)	11	NA	NA
WP_003700662.1|315985_316978_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	30.9	2.6e-35
WP_003700663.1|317012_317639_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	51.0	6.9e-50
WP_011476227.1|317758_317998_-	YaaL family protein	NA	NA	NA	NA	NA
WP_003700665.1|318011_318611_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003700666.1|318637_318952_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_087118361.1|318969_320709_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	38.9	5.1e-58
WP_050754573.1|320914_321382_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003700669.1|321428_322040_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_081512492.1|322242_322473_+	glutaredoxin-like protein NrdH	NA	X2KRY7	Enterococcus_phage	40.3	2.7e-12
WP_003700671.1|322469_322853_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.7	5.8e-15
WP_003700672.1|322833_325005_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	63.9	3.5e-266
>prophage 2
NZ_LT604074	Ligilactobacillus salivarius isolate LPM01 chromosome I	1788723	581973	586026	1788723		Staphylococcus_phage(50.0%)	7	NA	NA
WP_081513994.1|581973_582732_-	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.2	4.1e-12
WP_003701248.1|582731_582959_-	DUF2829 domain-containing protein	NA	G3MBC9	Bacillus_virus	37.0	2.2e-06
WP_011476359.1|582972_583470_-	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	36.7	1.3e-14
WP_011476360.1|583970_584843_-	DegV family protein	NA	NA	NA	NA	NA
WP_011476361.1|584914_585259_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	37.1	5.6e-09
WP_011476362.1|585255_585645_-	CrcB family protein	NA	A0A2H4PQR0	Staphylococcus_phage	34.2	1.5e-05
WP_011476363.1|585702_586026_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	38.4	9.5e-19
>prophage 3
NZ_LT604074	Ligilactobacillus salivarius isolate LPM01 chromosome I	1788723	665962	726669	1788723	transposase,protease	Bacillus_phage(19.05%)	58	NA	NA
WP_087118312.1|665962_666481_+|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	36.5	5.1e-14
WP_157663091.1|666477_667380_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.8	1.1e-40
WP_172824490.1|667717_669259_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.2	1.5e-16
WP_011476408.1|669370_670291_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	34.1	4.8e-31
WP_003701150.1|670397_670994_+	lipase	NA	NA	NA	NA	NA
WP_172824491.1|671069_671795_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.8	9.9e-32
WP_011476410.1|671802_673302_-	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_087118416.1|673531_675022_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_003705442.1|675304_675628_+	MazG-like family protein	NA	NA	NA	NA	NA
WP_087118417.1|675631_676804_+	MFS transporter	NA	NA	NA	NA	NA
WP_011476413.1|676873_677521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087118418.1|677553_680514_-	KxYKxGKxW signal peptide domain-containing protein	NA	Q6SEC2	Lactobacillus_prophage	60.0	1.3e-40
WP_087118419.1|680729_682160_-	flippase	NA	NA	NA	NA	NA
WP_049165302.1|682162_683278_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	81.1	1.6e-174
WP_081561660.1|683447_684329_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_087118420.1|684357_685023_-	sugar transferase	NA	NA	NA	NA	NA
WP_087118421.1|685102_686074_-	LCP family protein	NA	NA	NA	NA	NA
WP_087118422.1|686093_686870_-	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_011476420.1|687221_687947_-	CpsD/CapB family tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	36.8	1.9e-27
WP_011476421.1|687964_688762_-	chain-length determining protein	NA	NA	NA	NA	NA
WP_049154406.1|688812_689265_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.0	3.9e-18
WP_087118423.1|689489_690311_-	LicD family protein	NA	A0A1V0SAS8	Catovirus	28.6	1.1e-05
WP_087118424.1|690331_691561_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_011476423.1|691596_692820_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_011476424.1|692839_694015_-	EpsG family protein	NA	NA	NA	NA	NA
WP_161799666.1|694034_694976_-	capsular biosynthesis protein	NA	A0A0E3FQH0	Synechococcus_phage	31.6	2.7e-13
WP_011476426.1|694932_696045_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_014568758.1|696047_697103_-	glycosyltransferase family 2 protein	NA	L7Y3U4	Megavirus	22.8	1.9e-07
WP_172824469.1|697130_698213_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011476431.1|700509_702549_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_011476432.1|702742_704140_-	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_011476433.1|704164_705001_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_087118426.1|705061_706165_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_011476435.1|706383_707220_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.9	5.6e-39
WP_087118427.1|707275_708307_-	dTDP-glucose 4,6-dehydratase	NA	H9NC62	Sphingomonas_phage	37.5	1.5e-54
WP_003701105.1|708318_708900_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	43.5	3.0e-31
WP_011476438.1|708902_709772_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	63.7	5.6e-106
WP_087118428.1|709897_710899_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011476440.1|710980_711793_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_011476441.1|712025_712667_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011476442.1|712701_713346_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	49.8	1.2e-49
WP_003701095.1|713361_714027_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_034982328.1|714116_715472_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_003701093.1|715643_715808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087118429.1|715886_716543_+	HD domain-containing protein	NA	A0A142CJL7	Brazilian_marseillevirus	32.1	5.4e-13
WP_087118430.1|716610_717000_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086200906.1|717045_717849_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_081561682.1|717884_718679_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_011476449.1|718748_719291_-	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_003705492.1|719530_720331_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_086200905.1|720323_720992_-	ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	29.2	4.7e-12
WP_003704329.1|720994_721861_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_086200904.1|722093_722975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157663091.1|723382_724285_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.8	1.1e-40
WP_087118312.1|724281_724800_-|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	36.5	5.1e-14
WP_086200924.1|725004_725691_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_157663088.1|725789_726449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157663089.1|726519_726669_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_LT604074	Ligilactobacillus salivarius isolate LPM01 chromosome I	1788723	735868	746679	1788723	transposase	Bacillus_phage(60.0%)	8	NA	NA
WP_087118433.1|735868_738514_-	HAD-IC family P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.8	2.7e-63
WP_087118434.1|738772_739309_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	28.2	6.2e-15
WP_087118312.1|739390_739909_+|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	36.5	5.1e-14
WP_157663091.1|739905_740808_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.8	1.1e-40
WP_003704336.1|740881_741451_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_011476464.1|741452_742082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087118435.1|742215_742884_-	class A sortase	NA	NA	NA	NA	NA
WP_087118436.1|742932_746679_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	32.2	3.7e-05
>prophage 5
NZ_LT604074	Ligilactobacillus salivarius isolate LPM01 chromosome I	1788723	898086	907970	1788723	transposase	Bacillus_phage(33.33%)	9	NA	NA
WP_003701429.1|898086_898950_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	26.8	7.2e-21
WP_087118493.1|899095_900109_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_049164330.1|900334_901117_+	M23 family metallopeptidase	NA	A0A7K9	Microcystis_virus	37.5	3.5e-06
WP_087118494.1|901356_903279_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A2K9L187	Tupanvirus	26.9	1.5e-26
WP_049154206.1|903379_903955_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_003701438.1|904130_904508_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_087118312.1|904602_905121_+|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	36.5	5.1e-14
WP_157663091.1|905117_906020_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.8	1.1e-40
WP_003701439.1|906083_907970_-	pyruvate oxidase	NA	A0A0P0BWC8	Ostreococcus_mediterraneus_virus	22.3	1.5e-10
>prophage 6
NZ_LT604074	Ligilactobacillus salivarius isolate LPM01 chromosome I	1788723	1155257	1231517	1788723	portal,capsid,terminase,tRNA,integrase,tail,protease,transposase,head,plate	Lactobacillus_phage(41.03%)	96	1165047:1165068	1206517:1206538
WP_014568129.1|1155257_1157285_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	38.3	1.4e-99
WP_081511685.1|1157418_1158189_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_087118715.1|1158199_1158757_+	ribonuclease M5	NA	NA	NA	NA	NA
WP_081511687.1|1158768_1159659_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003702215.1|1159746_1159980_+	Veg family protein	NA	NA	NA	NA	NA
WP_087118538.1|1160075_1160924_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_081511691.1|1160936_1162055_+	aminotransferase	NA	NA	NA	NA	NA
WP_003702207.1|1162098_1162569_+	arginine repressor	NA	NA	NA	NA	NA
WP_011475606.1|1162607_1163477_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_014568135.1|1163692_1165000_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	33.3	1.2e-38
1165047:1165068	attL	AAAGATTATAAATTAAGTTGTT	NA	NA	NA	NA
WP_087118539.1|1165211_1166357_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	35.1	1.2e-44
WP_087118540.1|1166623_1167523_-	Abi family protein	NA	NA	NA	NA	NA
WP_081561349.1|1167624_1167819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087118541.1|1167806_1168652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081537376.1|1168904_1169231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160993459.1|1169891_1170356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047035113.1|1170608_1171550_-	3'-5' exoribonuclease	NA	A0A1S5SFA9	Streptococcus_phage	37.8	5.7e-48
WP_047035114.1|1171552_1171882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052757118.1|1171904_1172330_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2P1JU12	Anoxybacillus_phage	31.8	1.6e-10
WP_047035115.1|1172341_1172737_-	helix-turn-helix transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	41.5	6.2e-20
WP_047035116.1|1172976_1173165_+	helix-turn-helix transcriptional regulator	NA	D2IZW2	Enterococcus_phage	50.0	2.0e-05
WP_087118542.1|1173168_1174137_+	Rha family transcriptional regulator	NA	A0A0A7DN29	Lactobacillus_phage	57.8	2.2e-50
WP_087118543.1|1174157_1174424_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_087118544.1|1174661_1174841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087118546.1|1175115_1175334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087118547.1|1175326_1176040_+	hypothetical protein	NA	D7RWH3	Brochothrix_phage	40.4	2.6e-29
WP_087118548.1|1176032_1177016_+	phage replisome organizer N-terminal domain-containing protein	NA	A0A1S5SAV1	Streptococcus_phage	48.6	4.0e-28
WP_011475628.1|1177012_1177216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003703552.1|1177219_1177486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003703564.1|1177466_1177883_+	replication terminator protein	NA	A0A097BY30	Enterococcus_phage	46.8	5.1e-25
WP_003703548.1|1178177_1178354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087118549.1|1178355_1178553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087118550.1|1178558_1178888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011475634.1|1178888_1179065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087118551.1|1179131_1179494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087118552.1|1179483_1179720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087118553.1|1179786_1180173_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_087118554.1|1180198_1180459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003703551.1|1180459_1180693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003703585.1|1181344_1181587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087118555.1|1181601_1182042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087118556.1|1182052_1182334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011475640.1|1182351_1182534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087118557.1|1182608_1183049_+	transcriptional regulator	NA	U3PIU0	Lactobacillus_phage	33.7	6.2e-05
WP_011475642.1|1183145_1183391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172824476.1|1183398_1183836_+	DUF2335 domain-containing protein	NA	S5WJ01	Leptospira_phage	33.9	1.9e-06
WP_160988124.1|1184116_1184737_+	DNA-packaging protein	NA	NA	NA	NA	NA
WP_081561769.1|1184779_1184932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087118558.1|1184933_1185464_+	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	61.3	5.7e-53
WP_003702110.1|1185636_1186098_+|terminase	phage terminase small subunit P27 family	terminase	A0A286QP74	Streptococcus_phage	56.2	7.9e-43
WP_087118559.1|1186097_1187981_+|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	69.6	2.6e-265
WP_087118560.1|1187970_1188165_+	DUF1056 family protein	NA	NA	NA	NA	NA
WP_087118561.1|1188164_1189340_+|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	56.3	2.4e-128
WP_087118562.1|1189320_1190040_+|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	61.8	1.4e-73
WP_087118563.1|1190029_1191229_+|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	66.1	5.1e-150
WP_081515674.1|1191240_1191564_+|head,tail	phage gp6-like head-tail connector protein	head,tail	F8HGT2	Streptococcus_phage	47.9	1.4e-17
WP_041822665.1|1191556_1191913_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	39.6	8.3e-16
WP_087118564.1|1191905_1192298_+	HK97 gp10 family phage protein	NA	Q6J1X9	Lactobacillus_phage	45.5	9.1e-16
WP_003702100.1|1192297_1192675_+	DUF806 family protein	NA	A0A0M7RE53	Lactobacillus_phage	35.0	1.1e-13
WP_087118565.1|1192676_1193381_+|tail	phage tail protein	tail	A0A0M7RF39	Lactobacillus_phage	43.8	7.3e-48
WP_087118566.1|1193430_1193829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087118567.1|1194085_1194499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087118568.1|1194554_1198280_+	tape measure protein	NA	A0A0M9JJ59	Lactobacillus_phage	37.6	2.5e-118
WP_087118569.1|1198292_1199120_+|tail	phage tail family protein	tail	E9LUJ3	Lactobacillus_phage	43.6	5.9e-57
WP_087118570.1|1199135_1201442_+|tail	phage tail protein	tail	E9LUJ4	Lactobacillus_phage	47.2	3.3e-65
WP_003702550.1|1201593_1201872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087118571.1|1201871_1202948_+|plate	BppU family phage baseplate upper protein	plate	O03968	Lactobacillus_phage	43.7	1.0e-48
WP_087118572.1|1203028_1203451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047035190.1|1203464_1203869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087118573.1|1203870_1204053_+	XkdX family protein	NA	NA	NA	NA	NA
WP_087118574.1|1204107_1204413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003704600.1|1204409_1204736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047035194.1|1204747_1206016_+	LysM peptidoglycan-binding domain-containing protein	NA	Q6EVN0	Oenoccocus_phage	55.9	2.0e-120
WP_003701659.1|1206521_1207904_-	argininosuccinate lyase	NA	NA	NA	NA	NA
1206517:1206538	attR	AAAGATTATAAATTAAGTTGTT	NA	NA	NA	NA
WP_003709272.1|1207927_1209139_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_003707035.1|1209700_1210876_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_087118575.1|1210891_1211881_+	D-2-hydroxyacid dehydrogenase	NA	Q89388	Paramecium_bursaria_Chlorella_virus	36.8	4.8e-45
WP_087118576.1|1211899_1212949_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_172824493.1|1213402_1216471_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_157663091.1|1216563_1217466_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.8	1.1e-40
WP_087118312.1|1217462_1217981_-|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	36.5	5.1e-14
WP_003702586.1|1218063_1219686_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	27.7	1.0e-52
WP_087118578.1|1219760_1220531_-	nucleoside phosphorylase	NA	F5CA76	Streptococcus_phi-m46.1-like_phage	47.5	5.7e-38
WP_003699642.1|1220673_1220910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087118579.1|1220915_1221755_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.1	1.1e-45
WP_087118580.1|1221905_1222430_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003699646.1|1222502_1223480_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	37.0	1.5e-43
WP_081511705.1|1223570_1224980_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	30.6	3.5e-25
WP_087118581.1|1225122_1226340_-	MFS transporter	NA	NA	NA	NA	NA
WP_003709294.1|1226471_1227311_-	pur operon repressor	NA	NA	NA	NA	NA
WP_087118582.1|1227479_1227752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087118583.1|1227751_1228288_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_087118584.1|1228299_1228707_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087118585.1|1228937_1230029_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_087118312.1|1230099_1230618_+|transposase	transposase	transposase	A0A1B1P776	Bacillus_phage	36.5	5.1e-14
WP_157663091.1|1230614_1231517_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.8	1.1e-40
>prophage 7
NZ_LT604074	Ligilactobacillus salivarius isolate LPM01 chromosome I	1788723	1263281	1275187	1788723		Moraxella_phage(12.5%)	13	NA	NA
WP_087118595.1|1263281_1264595_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.9	5.0e-50
WP_081536736.1|1264740_1265511_+	TIGR02452 family protein	NA	G3MBH6	Bacillus_virus	31.2	4.4e-22
WP_087118596.1|1265648_1267019_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_087118597.1|1267154_1268633_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.8	1.4e-64
WP_003704211.1|1268762_1269170_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_087118598.1|1269188_1270304_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	32.1	3.3e-34
WP_003699582.1|1270350_1270599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087118599.1|1270614_1270983_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A2P0ZKX3	Lactobacillus_phage	35.1	9.8e-12
WP_087118600.1|1271024_1271861_-	DUF72 domain-containing protein	NA	A0A1V0CNL1	Kaumoebavirus	29.6	5.9e-12
WP_087118601.1|1271878_1272970_-	phosphoesterase	NA	NA	NA	NA	NA
WP_003705736.1|1272983_1273394_-	peptide deformylase	NA	A0A2I7S809	Vibrio_phage	38.4	4.9e-12
WP_087118602.1|1273492_1274209_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_087118603.1|1274257_1275187_-	YegS/Rv2252/BmrU family lipid kinase	NA	A0A1V0SBJ0	Catovirus	26.6	5.5e-11
>prophage 8
NZ_LT604074	Ligilactobacillus salivarius isolate LPM01 chromosome I	1788723	1570298	1579070	1788723		Prochlorococcus_phage(33.33%)	9	NA	NA
WP_003702184.1|1570298_1570781_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	37.9	1.2e-22
WP_003702195.1|1570777_1571812_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_014568323.1|1572123_1572837_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	37.8	6.3e-39
WP_003703354.1|1572855_1573104_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003700039.1|1573103_1573778_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_087118650.1|1573779_1576005_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.9	3.5e-144
WP_003707943.1|1575980_1577432_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.6	1.5e-63
WP_081511976.1|1577432_1578470_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	42.5	5.9e-62
WP_081511977.1|1578482_1579070_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	37.1	1.5e-25
>prophage 9
NZ_LT604074	Ligilactobacillus salivarius isolate LPM01 chromosome I	1788723	1632777	1641530	1788723		Brevibacillus_phage(16.67%)	9	NA	NA
WP_087118665.1|1632777_1635252_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	27.0	7.2e-58
WP_087118666.1|1636816_1637419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_191980884.1|1637470_1638553_-	NINE protein	NA	A0A0A8WJ41	Clostridium_phage	30.7	3.5e-17
WP_034982467.1|1638620_1638818_-	hypothetical protein	NA	Q9T1Z0	Lactococcus_phage	64.5	1.1e-14
WP_081540921.1|1638823_1639387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087118667.1|1639433_1639964_-	PH domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	44.8	7.0e-27
WP_143455587.1|1639989_1640601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034982470.1|1640665_1641091_-	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	36.7	1.7e-07
WP_081540734.1|1641104_1641530_-	helix-turn-helix transcriptional regulator	NA	A0A2P1JU09	Anoxybacillus_phage	43.3	5.8e-24
>prophage 1
NZ_LT604075	Ligilactobacillus salivarius isolate LPM01 plasmid II	244638	52302	101971	244638	integrase,bacteriocin,transposase	Paenibacillus_phage(20.0%)	54	82114:82130	104901:104917
WP_157663096.1|52302_53151_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	4.9e-22
WP_087118739.1|53293_53980_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	38.1	1.4e-32
WP_157663097.1|54059_54875_+|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	47.2	1.8e-53
WP_087118741.1|55150_55468_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_087118742.1|56201_56867_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_087118743.1|57204_57420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087118744.1|57412_57613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087118745.1|57652_58654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087118746.1|58650_59145_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_003699162.1|59157_59370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003699163.1|59323_59731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087118747.1|59743_60859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087118748.1|60872_61886_-	replication initiator protein A	NA	NA	NA	NA	NA
WP_157663098.1|62341_62494_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_003708474.1|62627_62792_+	Arc family DNA-binding protein	NA	A0A0A8WG21	Clostridium_phage	54.7	3.4e-09
WP_087118750.1|63061_63262_-	DNA-binding protein	NA	A0A286QQ20	Streptococcus_phage	46.7	9.7e-06
WP_087118751.1|63468_63891_+	helix-turn-helix transcriptional regulator	NA	F0PIH1	Enterococcus_phage	41.4	6.2e-10
WP_087118752.1|64612_65383_-	Fic family protein	NA	NA	NA	NA	NA
WP_087118753.1|65645_65999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003702995.1|66588_66891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003699488.1|67146_68025_+	patatin family protein	NA	NA	NA	NA	NA
WP_003699487.1|68110_68947_-	pyruvate formate lyase-activating protein	NA	NA	NA	NA	NA
WP_087118754.1|68973_71241_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.2	3.1e-172
WP_081036621.1|71551_72136_-	VIT1/CCC1 transporter family protein	NA	NA	NA	NA	NA
WP_174633258.1|72328_73753_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_003706789.1|73724_74174_-	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_172824500.1|74170_75397_-	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	46.9	3.4e-109
WP_087118756.1|75383_76634_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_081531057.1|76646_77426_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	28.7	3.3e-09
WP_087118757.1|77687_79322_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_086201697.1|81120_81393_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
82114:82130	attL	TTATTTGCATAAATTTT	NA	NA	NA	NA
WP_004564415.1|82232_83282_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_004564416.1|83488_84484_+	D-2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	38.1	1.4e-44
WP_087118758.1|84925_85135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034982128.1|85157_85391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003708516.1|85425_85611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087118759.1|85625_86090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087118760.1|86160_86583_-	phage scaffolding protein	NA	NA	NA	NA	NA
WP_087118761.1|86681_86849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081535599.1|86841_87084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087118762.1|88104_89001_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_011476657.1|89105_91763_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_087118763.1|92606_93266_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_087118764.1|93328_95299_-	fructose-1,6-bisphosphatase	NA	NA	NA	NA	NA
WP_087118765.1|95643_96465_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_087118766.1|97064_97808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087118767.1|98152_98350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172824496.1|98642_98873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081535612.1|98909_99704_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_087118769.1|99717_101007_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_003703471.1|101006_101123_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_081510153.1|101242_101410_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003703485.1|101552_101759_-|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003703435.1|101776_101971_-|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
104901:104917	attR	TTATTTGCATAAATTTT	NA	NA	NA	NA
>prophage 2
NZ_LT604075	Ligilactobacillus salivarius isolate LPM01 plasmid II	244638	173801	220651	244638	integrase,tRNA,transposase	Streptococcus_phage(36.36%)	39	209614:209630	225934:225950
WP_087118795.1|173801_175202_+|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_099450961.1|175207_175537_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_081511023.1|175648_176959_+	proline reductase-associated electron transfer protein PrdC	NA	NA	NA	NA	NA
WP_081512927.1|176994_178026_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_087118796.1|178125_179298_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_003702854.1|179316_179562_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_087118797.1|179809_180037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087118798.1|180164_180455_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_087118799.1|180489_181170_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_087118800.1|181367_183083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157663102.1|183294_184278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087118801.1|184444_185371_-|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	45.7	2.0e-77
WP_087118802.1|185584_186142_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_087118803.1|186143_187532_+	N-6 DNA methylase	NA	A0A1X9I6H1	Streptococcus_phage	28.3	4.1e-26
WP_044005693.1|187550_187793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087118804.1|187943_189908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087118805.1|189894_190758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172399966.1|190741_191545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087118806.1|194300_196259_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_087118807.1|196251_197454_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_087118808.1|197521_198700_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_087118843.1|199022_201080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087118809.1|201076_201640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087118810.1|203330_204434_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_035149309.1|204823_205591_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_081512964.1|205654_206164_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_087118811.1|206312_207155_+	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	36.1	1.3e-43
WP_081512965.1|207342_207777_+	N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	48.6	5.3e-33
WP_087118812.1|207849_208803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003699254.1|208869_209145_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	62.9	4.1e-23
WP_087118813.1|209417_214010_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	31.2	5.2e-17
209614:209630	attL	AGAATAATGCGACAGCT	NA	NA	NA	NA
WP_003703258.1|214139_214499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003706971.1|214514_215327_+	SPFH domain-containing protein	NA	S4VT23	Pandoravirus	29.7	1.1e-15
WP_087118814.1|215661_216357_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003703269.1|216514_216946_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	46.5	2.3e-28
WP_087118815.1|217045_218323_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	35.9	1.5e-54
WP_003699242.1|218663_219236_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	42.6	6.6e-23
WP_087118816.1|219380_220085_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_157663103.1|220279_220651_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0C5AEA5	Paenibacillus_phage	52.1	4.0e-29
225934:225950	attR	AGAATAATGCGACAGCT	NA	NA	NA	NA
