The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT618783	Propionibacterium freudenreichii isolate PFRJS25 chromosome I	2666517	13249	81437	2666517	transposase	Mycobacterium_phage(40.0%)	60	NA	NA
WP_157761872.1|13249_14251_-|transposase	IS481-like element ISPfr17 family transposase	transposase	NA	NA	NA	NA
WP_097776242.1|14279_14555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129931495.1|14579_15038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013162114.1|15240_16548_+|transposase	ISL3-like element ISPfr6 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	73.0	1.8e-188
WP_157763655.1|16643_17189_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_055346098.1|18082_19390_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	71.0	5.5e-182
WP_044636448.1|19501_20779_+	MFS transporter	NA	NA	NA	NA	NA
WP_013162082.1|20817_21537_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013162081.1|21795_23514_+	dihydroxyacetone kinase family protein	NA	NA	NA	NA	NA
WP_044658421.1|23588_24341_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_055343601.1|24502_25333_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_044636444.1|25477_26161_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_036941495.1|26545_27751_-|transposase	IS481-like element ISPfr5 family transposase	transposase	NA	NA	NA	NA
WP_044658418.1|28344_28833_+	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_013162076.1|29311_30391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013162075.1|30450_31323_+	HAD-IIA family hydrolase	NA	NA	NA	NA	NA
WP_055343564.1|31354_32929_+	xylulose kinase	NA	NA	NA	NA	NA
WP_055343565.1|32941_34318_+	sn-glycerol-1-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_055343563.1|34555_36304_+	ribulokinase	NA	NA	NA	NA	NA
WP_055343562.1|36422_38489_+	transketolase	NA	NA	NA	NA	NA
WP_013162069.1|38617_38929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055343561.1|39105_41394_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	30.2	1.5e-113
WP_048770022.1|41478_42375_-	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_157761868.1|42489_43323_+	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_055343560.1|43315_44401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044636437.1|44401_45259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055343559.1|45431_46661_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_055343558.1|46657_47476_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_055343557.1|47646_48258_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_055343556.1|48375_49356_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L8D8	Tupanvirus	33.0	8.9e-36
WP_013162059.1|49439_50129_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_055343555.1|50154_51345_-	MFS transporter	NA	NA	NA	NA	NA
WP_013162057.1|51439_51784_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013162056.1|51866_52421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157761867.1|52491_52980_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_013162054.1|53165_53516_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_055343553.1|53512_55630_+	cation-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.2	1.4e-86
WP_044658413.1|55678_56170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157764710.1|56287_56893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036941556.1|56978_57758_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013162049.1|57830_58055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013162048.1|58200_58809_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_112317764.1|59018_59678_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_055343552.1|60416_60932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013162045.1|60931_61969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112317708.1|62316_63741_+	CpaF family protein	NA	NA	NA	NA	NA
WP_013162043.1|63737_64631_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_013162042.1|64623_65529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048734334.1|65637_65838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048734306.1|65878_66235_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_097838432.1|66459_66858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080713615.1|66854_70565_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_013162037.1|70575_71166_-	membrane protein	NA	NA	NA	NA	NA
WP_060759140.1|71165_72506_-	MFS transporter	NA	NA	NA	NA	NA
WP_013162033.1|72926_73892_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_013162031.1|74245_74908_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013162030.1|74941_76351_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_157764726.1|76814_77816_+|transposase	IS481-like element ISPfr17 family transposase	transposase	NA	NA	NA	NA
WP_055343666.1|77823_79530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036941495.1|80231_81437_+|transposase	IS481-like element ISPfr5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_LT618783	Propionibacterium freudenreichii isolate PFRJS25 chromosome I	2666517	1480346	1548338	2666517	integrase,protease,capsid,tRNA	Streptococcus_phage(21.43%)	59	1475824:1475845	1555634:1555655
1475824:1475845	attL	CTGCAGCGCCTGGACGGCCTTG	NA	NA	NA	NA
WP_097776265.1|1480346_1481570_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	31.9	3.8e-52
WP_081012822.1|1481755_1483063_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_055343805.1|1483051_1483801_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_055343804.1|1483797_1485006_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.7	2.2e-20
WP_013160783.1|1485018_1486029_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_036939389.1|1486286_1487063_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_080516071.1|1487140_1488145_-	DUF3097 domain-containing protein	NA	NA	NA	NA	NA
WP_013160780.1|1488116_1489316_-	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_080516070.1|1489318_1491208_-	elongation factor 4	NA	A0A1B0RXH7	Streptococcus_phage	26.3	2.7e-20
WP_048769601.1|1491483_1492104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013160776.1|1492358_1492619_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_055343802.1|1492752_1493415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080774476.1|1493428_1494577_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_055343801.1|1494509_1496831_-	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_013160772.1|1496949_1497927_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036939399.1|1498045_1499746_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_013160770.1|1499817_1501110_-	dihydroorotase	NA	NA	NA	NA	NA
WP_055343800.1|1501166_1503695_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.1	7.4e-183
WP_013160768.1|1504011_1505022_-	DUF4192 domain-containing protein	NA	NA	NA	NA	NA
WP_044636087.1|1505238_1505979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055343799.1|1506297_1507497_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_055343798.1|1507875_1508100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055343797.1|1508186_1508477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157761843.1|1508560_1510045_+	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_155489098.1|1510065_1510290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055343795.1|1510538_1511744_+|capsid	phage major capsid protein	capsid	A0A173G9U3	Propionibacterium_phage	37.5	1.2e-50
WP_097776266.1|1512775_1513378_+	Bro-N domain-containing protein	NA	A0A1D8EU39	Propionibacterium_phage	57.1	7.4e-17
WP_055343793.1|1514237_1514486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036939409.1|1514714_1515635_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_013160765.1|1515749_1516187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013160764.1|1516246_1516855_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_013160763.1|1516854_1517238_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_013160762.1|1517234_1518005_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_055343819.1|1518078_1519320_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	50.6	1.3e-100
WP_055343792.1|1519329_1519998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044658244.1|1520030_1521203_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.4	1.5e-66
WP_044658243.1|1521192_1522794_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_013160755.1|1522942_1523206_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_013160754.1|1523219_1523528_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_060761520.1|1523763_1526550_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_036939422.1|1526803_1527520_-	DUF2344 domain-containing protein	NA	NA	NA	NA	NA
WP_013160750.1|1527619_1528075_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013160749.1|1528289_1529546_+	TerC family protein	NA	I7HPH5	Enterobacteria_phage	32.5	2.3e-36
WP_171035504.1|1529542_1530643_+	ionic transporter y4hA	NA	NA	NA	NA	NA
WP_048769609.1|1530706_1532650_-	TIGR03960 family B12-binding radical SAM protein	NA	NA	NA	NA	NA
WP_171035505.1|1532726_1533956_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013160745.1|1534063_1534540_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	52.3	8.5e-32
WP_013160744.1|1534650_1536156_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_112317735.1|1536291_1536882_+	DoxX family protein	NA	NA	NA	NA	NA
WP_013160742.1|1536917_1537712_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_097776185.1|1537975_1538770_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_055343789.1|1538859_1541487_+|tRNA	valine--tRNA ligase	tRNA	A0A2K9KZB8	Tupanvirus	36.3	1.6e-159
WP_013160739.1|1541593_1542343_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_013160738.1|1542427_1543549_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_044658236.1|1543627_1545070_-	threonine synthase	NA	NA	NA	NA	NA
WP_036939438.1|1545188_1545503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013160735.1|1545614_1546892_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.2	4.4e-136
WP_162484287.1|1547013_1547649_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A248SJ97	Salicola_phage	38.7	1.2e-28
WP_162467436.1|1547726_1548338_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	45.6	9.8e-41
1555634:1555655	attR	CTGCAGCGCCTGGACGGCCTTG	NA	NA	NA	NA
>prophage 3
NZ_LT618783	Propionibacterium freudenreichii isolate PFRJS25 chromosome I	2666517	2030759	2184723	2666517	protease,transposase,tRNA	Mycobacterium_phage(16.0%)	108	NA	NA
WP_157761789.1|2030759_2031761_-|transposase	IS481-like element ISPfr17 family transposase	transposase	NA	NA	NA	NA
WP_055343938.1|2031858_2033133_-	threonine ammonia-lyase IlvA	NA	NA	NA	NA	NA
WP_055343939.1|2033665_2034865_+	type I-U CRISPR-associated protein Cas7	NA	NA	NA	NA	NA
WP_157764717.1|2034866_2036408_+	type I-U CRISPR-associated protein Cas5/Cas6	NA	NA	NA	NA	NA
WP_055343941.1|2036404_2039017_+	type I-U CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_055343942.1|2039013_2040012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055343943.1|2040001_2041603_+	CRISPR-associated endonuclease Cas4/Cas1	NA	NA	NA	NA	NA
WP_013160296.1|2041599_2041902_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_097838466.1|2045045_2046347_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	72.2	1.1e-179
WP_097776208.1|2049469_2050777_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	72.4	7.4e-187
WP_013160292.1|2052120_2052627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013160291.1|2052661_2053177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055343935.1|2053347_2054574_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_129931507.1|2055757_2055997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055343936.1|2056089_2056839_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_013160286.1|2057296_2057572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013160285.1|2057968_2059285_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_080774584.1|2059805_2062685_+	DUF3427 domain-containing protein	NA	A0A097BY72	Enterococcus_phage	27.0	1.2e-35
WP_097776207.1|2062685_2062985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157764727.1|2063266_2064268_+|transposase	IS481-like element ISPfr17 family transposase	transposase	NA	NA	NA	NA
WP_048735584.1|2064451_2064871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155269317.1|2065296_2065440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044658118.1|2065672_2065987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013160276.1|2066216_2066390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013160275.1|2066430_2067363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013160274.1|2067745_2068729_+	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_013160272.1|2068954_2069509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026138135.1|2070004_2071330_+|transposase	ISL3-like element ISPfr2 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	77.0	3.6e-197
WP_013160270.1|2071436_2072387_-	cation transporter	NA	A0A1V0SED0	Indivirus	32.2	2.2e-10
WP_013160269.1|2072503_2073898_-	amino acid permease	NA	NA	NA	NA	NA
WP_041704440.1|2074340_2075186_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_080898979.1|2075182_2076034_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_055343702.1|2076105_2076897_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_055343701.1|2076975_2078292_+	cytosine permease	NA	NA	NA	NA	NA
WP_048735593.1|2078379_2080077_-	AarF/ABC1/UbiB kinase family protein	NA	A0A2N9QVT9	Dishui_lake_phycodnavirus	30.2	5.0e-42
WP_055343700.1|2080119_2080692_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048735596.1|2081106_2081649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055343699.1|2081769_2083338_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_013160259.1|2083461_2084118_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_013160258.1|2084114_2085380_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.8	9.2e-33
WP_036943101.1|2085376_2086342_-	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013160256.1|2086892_2087621_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.3	9.6e-35
WP_055343698.1|2087601_2089467_+	HAMP domain-containing histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	35.2	1.8e-05
WP_055343697.1|2089731_2090724_-	ribokinase	NA	NA	NA	NA	NA
WP_055343696.1|2090993_2093765_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_013160252.1|2094265_2096923_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	37.2	4.2e-80
WP_036943092.1|2097131_2098025_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_036943148.1|2098536_2099478_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_048735606.1|2099704_2101027_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_013160247.1|2101135_2102125_+	methyltransferase	NA	NA	NA	NA	NA
WP_013160246.1|2102331_2103105_+	YwiC-like family protein	NA	NA	NA	NA	NA
WP_013160245.1|2103233_2104088_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	8.0e-57
WP_155489088.1|2104350_2104824_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_112317811.1|2105704_2106928_-	LssY C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_036943086.1|2107357_2108548_+	DUF1015 domain-containing protein	NA	NA	NA	NA	NA
WP_013160240.1|2108671_2110195_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_013160239.1|2110422_2111235_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	2.3e-13
WP_044635925.1|2111274_2112324_-	D-2-hydroxyacid dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	24.7	1.8e-05
WP_036943078.1|2112402_2113056_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_055346098.1|2113771_2115079_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	71.0	5.5e-182
WP_044635924.1|2116747_2117440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036941495.1|2117888_2119094_+|transposase	IS481-like element ISPfr5 family transposase	transposase	NA	NA	NA	NA
WP_013160233.1|2119350_2120148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013160214.1|2120616_2121144_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_097838468.1|2121301_2122333_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013160211.1|2122520_2122739_-	CsbD family protein	NA	NA	NA	NA	NA
WP_055343755.1|2122908_2123967_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_055343756.1|2123963_2125118_+	thiolase family protein	NA	NA	NA	NA	NA
WP_112317767.1|2125521_2126961_+	hexose-6-phosphate:phosphate antiporter	NA	NA	NA	NA	NA
WP_013160207.1|2126953_2127805_+	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_044636586.1|2128030_2129503_+	cytosine permease	NA	NA	NA	NA	NA
WP_055343765.1|2129550_2130504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055343757.1|2132005_2133664_+	DNA cytosine methyltransferase	NA	K4HZD0	Acidithiobacillus_phage	28.7	5.9e-40
WP_155489091.1|2134005_2135772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055343759.1|2135761_2137213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157761852.1|2137202_2142923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013160200.1|2142906_2143341_+	very short patch repair endonuclease	NA	V5UTF4	Oenococcus_phage	38.2	1.5e-11
WP_048735548.1|2143424_2143868_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_013160198.1|2143960_2144164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097776214.1|2144358_2145354_-|transposase	IS481-like element ISPfr19 family transposase	transposase	NA	NA	NA	NA
WP_013160197.1|2145569_2146988_-	MFS transporter	NA	NA	NA	NA	NA
WP_044635917.1|2147277_2148006_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	45.2	5.3e-17
WP_013160193.1|2148012_2149689_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_013160192.1|2149681_2151070_-	MFS transporter	NA	NA	NA	NA	NA
WP_081014668.1|2151471_2153871_-	glycoside hydrolase family 3 C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_081012738.1|2154195_2154888_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044635914.1|2154944_2155919_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	34.5	8.0e-45
WP_055343762.1|2156230_2157628_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_041704019.1|2157721_2158525_+	ROK family protein	NA	NA	NA	NA	NA
WP_013160186.1|2158703_2159699_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013160185.1|2159946_2161005_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_013160184.1|2161118_2162084_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_112317766.1|2162086_2162971_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.6	5.8e-10
WP_013160182.1|2163148_2164783_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L2F0	Tupanvirus	35.1	1.4e-81
WP_055343763.1|2164874_2166308_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	32.2	6.1e-49
WP_055343595.1|2166498_2167872_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_097776216.1|2167784_2168651_-	ABC transporter	NA	NA	NA	NA	NA
WP_157761853.1|2168864_2169554_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_055343451.1|2170013_2170931_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.4	8.7e-33
WP_155488384.1|2170988_2171792_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_055343452.1|2172035_2172872_+	mycofactocin-coupled SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	33.0	1.8e-08
WP_097838469.1|2173013_2174486_+	amidase	NA	NA	NA	NA	NA
WP_081012395.1|2174663_2176898_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	31.3	1.3e-58
WP_055343453.1|2176960_2178811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055343595.1|2179028_2180402_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_097838485.1|2180614_2181241_-	YdcF family protein	NA	NA	NA	NA	NA
WP_013160179.1|2181536_2183309_-	DEAD/DEAH box helicase	NA	I4AZM6	Saccharomonospora_phage	35.3	8.2e-80
WP_157761875.1|2183721_2184723_+|transposase	IS481-like element ISPfr17 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_LT618783	Propionibacterium freudenreichii isolate PFRJS25 chromosome I	2666517	2269482	2335341	2666517	transposase,tRNA	Staphylococcus_phage(15.38%)	47	NA	NA
WP_036941495.1|2269482_2270688_+|transposase	IS481-like element ISPfr5 family transposase	transposase	NA	NA	NA	NA
WP_013160077.1|2271646_2274235_+	LCP family protein	NA	NA	NA	NA	NA
WP_036942942.1|2274616_2275054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055343445.1|2275303_2276275_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_036943004.1|2276448_2277873_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	65.9	1.7e-43
WP_055343449.1|2278527_2280054_-	LCP family protein	NA	NA	NA	NA	NA
WP_013160072.1|2280437_2281184_+	NAD-dependent protein deacylase	NA	A0A068EPD4	Bacillus_phage	31.3	1.3e-26
WP_055343446.1|2281408_2281906_-	thiol peroxidase	NA	NA	NA	NA	NA
WP_055343447.1|2282156_2282804_+	CueP family metal-binding protein	NA	NA	NA	NA	NA
WP_013160069.1|2282865_2283987_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_041704379.1|2284151_2284829_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_013160067.1|2284867_2286262_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_097838486.1|2288617_2289508_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_055343664.1|2289648_2290329_-	GPP34 family phosphoprotein	NA	NA	NA	NA	NA
WP_044657874.1|2290449_2291724_-|tRNA	serine--tRNA ligase	tRNA	A0A2K9L088	Tupanvirus	35.8	2.8e-66
WP_013160062.1|2291871_2293476_+	YegS/Rv2252/BmrU family lipid kinase	NA	NA	NA	NA	NA
WP_013160060.1|2294827_2295508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157761606.1|2295800_2296754_-	aminotransferase class IV	NA	NA	NA	NA	NA
WP_172952497.1|2296746_2298480_-	anthranilate synthase component I family protein	NA	A0A0B5J984	Pandoravirus	36.2	6.8e-63
WP_044657876.1|2298716_2299706_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_055343662.1|2299906_2301094_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_172952508.1|2301471_2302923_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.7e-14
WP_055343660.1|2302977_2304546_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.0	3.8e-105
WP_081014646.1|2304542_2305667_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_055343658.1|2305663_2308702_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_081014648.1|2309249_2310350_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_081014645.1|2310842_2311418_-	macro domain-containing protein	NA	A0A0K1L687	Scale_drop_disease_virus	44.6	7.3e-22
WP_044635816.1|2311548_2312583_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_013160035.1|2313201_2314008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055346843.1|2314185_2315721_-	gluconokinase	NA	NA	NA	NA	NA
WP_013160037.1|2316011_2316875_-	Fpg/Nei family DNA glycosylase	NA	NA	NA	NA	NA
WP_044658304.1|2316867_2317593_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_097776144.1|2318068_2320249_-	serine/threonine protein kinase	NA	A0A1M7XTW9	Cedratvirus	26.9	9.0e-12
WP_044635868.1|2320563_2321172_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1J0GVU2	Streptomyces_phage	44.6	5.6e-28
WP_044658309.1|2321382_2322687_-	citrate synthase	NA	NA	NA	NA	NA
WP_044635866.1|2323206_2324010_+	EcsC family protein	NA	NA	NA	NA	NA
WP_055346839.1|2324120_2324954_-	SdpI family protein	NA	NA	NA	NA	NA
WP_157761831.1|2325168_2326773_-	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_013160045.1|2326794_2327943_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.8	1.6e-31
WP_080516175.1|2328141_2329101_-	phosphopantothenoylcysteine decarboxylase	NA	Q9HH70	Methanothermobacter_phage	39.4	1.4e-25
WP_013160047.1|2329738_2330083_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_080516026.1|2330085_2330838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055343632.1|2330856_2332164_+|transposase	ISL3-like element ISPfr1 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	67.8	3.1e-169
WP_157764719.1|2332200_2332509_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157761608.1|2332531_2332759_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080713571.1|2332777_2333722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055346098.1|2334033_2335341_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	71.0	5.5e-182
>prophage 5
NZ_LT618783	Propionibacterium freudenreichii isolate PFRJS25 chromosome I	2666517	2408251	2480523	2666517	transposase	Mycobacterium_phage(27.27%)	55	NA	NA
WP_157761872.1|2408251_2409253_-|transposase	IS481-like element ISPfr17 family transposase	transposase	NA	NA	NA	NA
WP_080774570.1|2409350_2410250_-	MFS transporter	NA	NA	NA	NA	NA
WP_157761871.1|2410204_2411011_-	MFS transporter	NA	NA	NA	NA	NA
WP_080516216.1|2411506_2412289_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_055343585.1|2412285_2413266_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_013162173.1|2413298_2414732_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_055343592.1|2415081_2416518_+	MFS transporter	NA	NA	NA	NA	NA
WP_013162175.1|2416646_2417099_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_013162176.1|2417110_2417350_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_055343586.1|2417451_2418018_-	single-stranded DNA-binding protein	NA	A0A173G9V2	Propionibacterium_phage	61.2	3.6e-53
WP_036942745.1|2418198_2418486_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_048735290.1|2418903_2419584_-	chlorite dismutase family protein	NA	NA	NA	NA	NA
WP_013162183.1|2419787_2420171_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_055343587.1|2420319_2421051_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_044636487.1|2421335_2424665_+	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_172952507.1|2424595_2425672_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_013162186.1|2425891_2427145_+	MFS transporter	NA	NA	NA	NA	NA
WP_013162187.1|2427236_2427863_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_055343588.1|2428244_2429453_+	RtcB family protein	NA	A0A1I9SAD2	Rhodococcus_phage	56.3	1.0e-121
WP_036942692.1|2429482_2430757_-	alpha-amylase	NA	NA	NA	NA	NA
WP_055343589.1|2430860_2432015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157764722.1|2432011_2433670_-	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_052809217.1|2433666_2435802_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_013162193.1|2435794_2436214_-	DUF5318 family protein	NA	NA	NA	NA	NA
WP_055343590.1|2436691_2437843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097776248.1|2437970_2439350_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_044636490.1|2439880_2440414_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_044636491.1|2440537_2441227_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_015069004.1|2441415_2441655_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_044636492.1|2441686_2443696_+	cation-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.3	6.9e-83
WP_044636493.1|2443640_2444129_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_055343591.1|2444151_2444526_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_044636924.1|2444661_2445732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097776278.1|2445733_2448478_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_015068998.1|2448474_2449104_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044636496.1|2449455_2450439_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_097776249.1|2450447_2451755_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	67.8	9.1e-169
WP_055343596.1|2452382_2453507_-	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_044636512.1|2453873_2454110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055343600.1|2454210_2455425_-	cytochrome P450	NA	NA	NA	NA	NA
WP_044636513.1|2455757_2456612_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	33.6	7.3e-42
WP_097776250.1|2456819_2457863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055344933.1|2460018_2460624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055343598.1|2461136_2463083_+	purine/pyrimidine permease	NA	Q9KX94	Enterobacteria_phage	26.9	2.5e-21
WP_081012520.1|2463181_2464183_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_055343599.1|2464711_2466379_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	28.1	1.1e-22
WP_036942712.1|2466519_2467968_-	catalase	NA	A0A2K9L572	Tupanvirus	41.3	6.0e-89
WP_013162208.1|2468072_2468990_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_048768584.1|2469551_2471504_+	AarF/ABC1/UbiB kinase family protein	NA	E5ERK4	Ostreococcus_lucimarinus_virus	31.6	2.1e-20
WP_036941495.1|2471968_2473174_-|transposase	IS481-like element ISPfr5 family transposase	transposase	NA	NA	NA	NA
WP_013162210.1|2473313_2474084_-	PLDc N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_013162211.1|2474167_2475424_-	chloride channel protein	NA	NA	NA	NA	NA
WP_055346098.1|2476956_2478264_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	71.0	5.5e-182
WP_157764723.1|2478246_2479200_-	MFS transporter	NA	NA	NA	NA	NA
WP_055346098.1|2479215_2480523_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	71.0	5.5e-182
>prophage 6
NZ_LT618783	Propionibacterium freudenreichii isolate PFRJS25 chromosome I	2666517	2506464	2556148	2666517	transposase	Mycobacterium_phage(22.22%)	33	NA	NA
WP_044635816.1|2506464_2507499_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_052809046.1|2508308_2511563_+	DEAD/DEAH box helicase	NA	E4WLZ5	Ostreococcus_tauri_virus	29.4	2.4e-40
WP_036940993.1|2511720_2512869_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_097776020.1|2512865_2513546_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	8.4e-25
WP_138427876.1|2513554_2514568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026138135.1|2515593_2516919_-|transposase	ISL3-like element ISPfr2 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	77.0	3.6e-197
WP_048734242.1|2517364_2517874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063493944.1|2519837_2522090_+	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_013160219.1|2522143_2522560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097776142.1|2522804_2524115_+|transposase	ISL3-like element ISPfr18 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	69.6	1.7e-175
WP_138428053.1|2524102_2524549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055343623.1|2525146_2526679_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_044657954.1|2526840_2528031_+	acetate kinase	NA	NA	NA	NA	NA
WP_055343624.1|2528133_2528940_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013159993.1|2528939_2529737_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_044635847.1|2530855_2531365_+	DUF4395 domain-containing protein	NA	NA	NA	NA	NA
WP_081014640.1|2531399_2531786_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_044635846.1|2532009_2532972_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_013159988.1|2532968_2533826_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_055343626.1|2534001_2536398_+	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_055343627.1|2536440_2537211_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	2.1e-11
WP_041703943.1|2537210_2538095_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_081014641.1|2538099_2540112_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_048734350.1|2540108_2541296_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	44.4	7.9e-95
WP_055343629.1|2541608_2541848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172952992.1|2541867_2545080_+	glucosaminidase domain-containing protein	NA	A0A1I9SA50	Rhodococcus_phage	38.2	1.7e-35
WP_055343929.1|2545421_2546864_+	DUF2142 domain-containing protein	NA	NA	NA	NA	NA
WP_055343930.1|2546938_2547937_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.3	5.8e-67
WP_055343931.1|2547939_2549382_+	sugar nucleotide-binding protein	NA	NA	NA	NA	NA
WP_155489109.1|2549390_2551613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097776140.1|2551766_2552917_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.6	2.7e-39
WP_044635816.1|2553841_2554876_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_157761531.1|2555146_2556148_-|transposase	IS481-like element ISPfr17 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_LT618783	Propionibacterium freudenreichii isolate PFRJS25 chromosome I	2666517	2603615	2627042	2666517	integrase,transposase	Mycobacterium_phage(28.57%)	22	2608521:2608538	2611535:2611552
WP_157761795.1|2603615_2604617_+|transposase	IS481-like element ISPfr17 family transposase	transposase	NA	NA	NA	NA
WP_097776244.1|2604908_2607047_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_027587604.1|2607518_2607782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013162095.1|2607785_2608088_-	DUF4193 domain-containing protein	NA	NA	NA	NA	NA
2608521:2608538	attL	GGTTATGTTGACCGGCTC	NA	NA	NA	NA
WP_052809198.1|2608671_2609613_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	24.2	1.8e-17
WP_129931493.1|2609609_2609957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013162093.1|2610016_2610541_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_165363491.1|2611651_2611816_-	hypothetical protein	NA	NA	NA	NA	NA
2611535:2611552	attR	GGTTATGTTGACCGGCTC	NA	NA	NA	NA
WP_172664066.1|2611892_2612177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013162090.1|2612465_2612642_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_027587608.1|2612647_2612956_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	59.1	3.5e-23
WP_027587609.1|2612917_2614075_-|transposase	IS30-like element ISPfr16 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	1.5e-42
WP_027587610.1|2614470_2615019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013162114.1|2616684_2617992_+|transposase	ISL3-like element ISPfr6 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	73.0	1.8e-188
WP_080516165.1|2618224_2620192_+	KUP/HAK/KT family potassium transporter	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	31.2	6.3e-73
WP_051232795.1|2620348_2620813_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_157764728.1|2620922_2621924_-|transposase	IS481-like element ISPfr17 family transposase	transposase	NA	NA	NA	NA
WP_041704881.1|2622164_2622638_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_013162109.1|2623006_2623339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013162108.1|2623335_2624115_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_027587600.1|2624111_2624693_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	36.8	4.2e-17
WP_013162114.1|2625734_2627042_-|transposase	ISL3-like element ISPfr6 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	73.0	1.8e-188
