The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT903847	Escherichia coli O127:H6 isolate EPEC1 chromosome 1	4792490	1771613	1778753	4792490		Escherichia_phage(83.33%)	6	NA	NA
WP_001279001.1|1771613_1772252_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.8e-83
WP_000590412.1|1772248_1773511_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.8e-135
WP_000847970.1|1773507_1774416_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	4.3e-117
WP_001296319.1|1774611_1775379_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_001141306.1|1775429_1776086_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	8.6e-51
WP_000103866.1|1776191_1778753_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.7e-31
>prophage 2
NZ_LT903847	Escherichia coli O127:H6 isolate EPEC1 chromosome 1	4792490	1795302	1920530	4792490	tRNA,integrase,transposase,tail	Escherichia_phage(18.42%)	110	1846723:1846737	1878807:1878821
WP_000526113.1|1795302_1795761_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	8.5e-13
WP_000244358.1|1795898_1797272_-|transposase	IS4-like element ISEc13 family transposase	transposase	NA	NA	NA	NA
WP_001078777.1|1797805_1798333_+	electron transport protein HydN	NA	NA	NA	NA	NA
WP_001107656.1|1798485_1800738_+	carbamoyltransferase HypF	NA	NA	NA	NA	NA
WP_000907654.1|1802337_1803414_+|transposase	IS110-like element ISEc21 family transposase	transposase	NA	NA	NA	NA
WP_000064719.1|1804885_1806019_-	NADH:flavorubredoxin reductase NorW	NA	NA	NA	NA	NA
WP_000029589.1|1806015_1807455_-	anaerobic nitric oxide reductase flavorubredoxin	NA	NA	NA	NA	NA
WP_000010726.1|1807641_1809156_+	nitric oxide reductase transcriptional regulator NorR	NA	NA	NA	NA	NA
WP_001287401.1|1809152_1810118_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
WP_000476837.1|1810371_1811457_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_000132236.1|1811601_1812099_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	2.6e-31
WP_000963143.1|1812178_1813240_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140506.1|1813308_1813809_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047168.1|1813937_1816568_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|1816802_1816988_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000273309.1|1818043_1818610_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_001287462.1|1818606_1819035_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611792.1|1819107_1820664_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130211.1|1820813_1821329_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_000526113.1|1821521_1821980_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	8.5e-13
WP_000244358.1|1822087_1823461_-|transposase	IS4-like element ISEc13 family transposase	transposase	NA	NA	NA	NA
WP_000638139.1|1823648_1824761_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001097125.1|1824757_1825465_-	RNA ligase family protein	NA	NA	NA	NA	NA
WP_001296316.1|1825722_1827261_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001295175.1|1827277_1828450_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378442.1|1828576_1829107_-	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_000119749.1|1829197_1829533_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000445658.1|1829522_1830260_-	L-valine exporter subunit YgaZ	NA	NA	NA	NA	NA
WP_000165669.1|1830383_1831568_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216533.1|1832016_1833009_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000774965.1|1833066_1834131_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000985495.1|1834123_1835326_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777941.1|1835682_1836642_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	9.1e-134
WP_000246589.1|1836651_1838796_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.1e-195
WP_000080940.1|1838768_1839179_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	43.5	3.0e-17
WP_001223227.1|1839175_1839421_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000209795.1|1839629_1840061_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_001295174.1|1841537_1841867_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281320.1|1842018_1842363_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492656.1|1842399_1842849_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000115381.1|1843515_1843920_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_001229436.1|1843966_1844491_-	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000137287.1|1844500_1844800_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508177.1|1844982_1845141_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000522415.1|1845224_1845674_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156817.1|1845674_1846337_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001298180.1|1846357_1847758_-	GABA permease	NA	NA	NA	NA	NA
1846723:1846737	attL	ATGCCGCGCCGGTGG	NA	NA	NA	NA
WP_000097680.1|1847994_1849275_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.3	4.9e-34
WP_000772826.1|1849288_1850737_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271979.1|1850759_1852028_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_000993124.1|1852047_1853025_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_012578991.1|1853332_1853713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526065.1|1856925_1857027_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001339425.1|1859437_1859683_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	50.7	1.1e-16
WP_001816740.1|1859707_1860004_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	47.9	4.6e-20
WP_001339422.1|1860332_1860650_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0R6PGM3	Moraxella_phage	46.8	1.6e-10
WP_000162574.1|1863411_1863894_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600193.1|1864025_1864502_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117834.1|1864491_1864782_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1864843_1865185_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880896.1|1865333_1866995_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059176.1|1867080_1867959_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|1868081_1868675_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|1868729_1870016_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|1870036_1870828_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|1870994_1872356_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1872492_1872741_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1872759_1873308_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264790.1|1873338_1874106_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|1874147_1874495_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000948614.1|1874700_1875423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000972008.1|1875460_1875679_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	81.9	8.6e-32
WP_000884170.1|1875755_1876928_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	78.0	4.5e-167
WP_000978925.1|1876930_1877395_-|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	78.4	4.5e-62
WP_000069482.1|1877406_1879836_-|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	79.3	2.4e-279
1878807:1878821	attR	CCACCGGCGCGGCAT	NA	NA	NA	NA
WP_000763326.1|1879828_1879948_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	84.6	3.7e-13
WP_000361834.1|1879989_1880262_-|tail	phage tail assembly protein	tail	A0A0F7LBN9	Escherichia_phage	78.8	1.3e-29
WP_001207671.1|1880324_1880843_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	80.2	3.0e-75
WP_001286668.1|1880855_1882043_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	82.5	3.8e-190
WP_001195986.1|1882107_1882686_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	80.2	2.9e-79
WP_032160959.1|1882715_1883105_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	54.1	1.9e-13
WP_001106833.1|1883126_1883567_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.7	1.6e-53
WP_000548501.1|1883538_1884141_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	90.3	6.2e-96
WP_000503755.1|1884140_1884635_-|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	59.8	4.1e-45
WP_001408077.1|1884966_1885896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000589817.1|1886099_1886582_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969004.1|1886597_1887824_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212401.1|1887813_1888332_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001339413.1|1888479_1888845_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168045.1|1889055_1890126_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225221.1|1890136_1891258_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200108.1|1891300_1892461_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|1892559_1892607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|1892710_1893052_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|1894422_1895160_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079111.1|1895294_1896275_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040119.1|1896271_1897003_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|1897132_1899706_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000852123.1|1906987_1908286_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	2.2e-45
WP_001339409.1|1908282_1908606_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|1908651_1910007_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082956.1|1910120_1912781_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001339408.1|1912812_1913511_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|1913579_1913999_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997418.1|1914205_1915243_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262723.1|1915290_1915980_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000627804.1|1916284_1916668_+	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001386374.1|1917412_1918294_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|1918326_1919661_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000083664.1|1919792_1920530_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 3
NZ_LT903847	Escherichia coli O127:H6 isolate EPEC1 chromosome 1	4792490	2006575	2145973	4792490	capsid,holin,tail,integrase,tRNA,transposase,plate,protease,terminase,head	Salmonella_phage(32.63%)	156	2009674:2009689	2049971:2049986
WP_001296289.1|2006575_2008042_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_000138264.1|2008110_2009688_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
2009674:2009689	attL	ATTGAGTGGGAATGAT	NA	NA	NA	NA
WP_000954549.1|2009880_2011134_+|integrase	site-specific integrase	integrase	T1S9J3	Salmonella_phage	96.4	1.9e-232
WP_000177704.1|2011130_2011310_-	hypothetical protein	NA	T1SA82	Salmonella_phage	100.0	2.4e-24
WP_001013665.1|2011306_2011900_-	adenine methylase	NA	T1SA14	Salmonella_phage	98.5	1.2e-115
WP_000664383.1|2011896_2012610_-	hypothetical protein	NA	R9VWB9	Serratia_phage	70.0	4.0e-94
WP_000184078.1|2012606_2012765_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	86.5	3.5e-19
WP_000041115.1|2012757_2013057_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	99.0	3.1e-48
WP_000816432.1|2013166_2013415_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	81.7	1.5e-32
WP_000063813.1|2013461_2014343_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	94.5	4.3e-154
WP_001091673.1|2014339_2015161_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A193GYK2	Enterobacter_phage	97.4	9.1e-159
WP_000548052.1|2015157_2015460_-	hypothetical protein	NA	T1SA88	Salmonella_phage	97.0	6.5e-46
WP_172437433.1|2015467_2016391_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	79.7	1.6e-50
WP_001198622.1|2016423_2016573_-	hypothetical protein	NA	T1SA20	Salmonella_phage	70.2	1.1e-14
WP_000836620.1|2016797_2017394_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	98.0	1.1e-105
WP_001278768.1|2017549_2017783_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	100.0	1.2e-39
WP_000402891.1|2017930_2018131_+	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	75.8	2.5e-22
WP_000086426.1|2018146_2018953_+	helix-turn-helix domain-containing protein	NA	Q286X4	Escherichia_phage	78.5	1.2e-91
WP_001066738.1|2018949_2019735_+	hypothetical protein	NA	A0A193GYX1	Enterobacter_phage	89.7	2.2e-138
WP_000828691.1|2019852_2020194_+	hypothetical protein	NA	T1SA23	Salmonella_phage	76.3	2.6e-43
WP_029694141.1|2020590_2020806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856943.1|2020808_2021015_+	hypothetical protein	NA	A0A2D1GLS1	Escherichia_phage	88.1	2.9e-29
WP_012578976.1|2021025_2021322_+	hypothetical protein	NA	A0A2R2YB59	Pseudomonas_phage	65.1	8.2e-09
WP_001140120.1|2021855_2022194_+	hypothetical protein	NA	Q858C6	Salmonella_phage	86.6	2.3e-47
WP_172437434.1|2022216_2022891_+|terminase	terminase small subunit	terminase	M1F219	Salmonella_phage	98.2	8.7e-115
WP_000123109.1|2022887_2024369_+	hypothetical protein	NA	M1F3C4	Salmonella_phage	98.6	1.3e-293
WP_000031196.1|2024412_2024844_-	hypothetical protein	NA	A0A248SKX0	Klebsiella_phage	54.9	6.1e-37
WP_000334867.1|2025715_2025922_+	hypothetical protein	NA	T1SA67	Salmonella_phage	100.0	5.7e-09
WP_000852153.1|2025936_2027607_+|tail	tail protein	tail	T1S9Z7	Salmonella_phage	98.9	0.0e+00
WP_000968687.1|2027603_2027903_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	67.3	2.0e-31
WP_000619835.1|2027899_2028445_+	hypothetical protein	NA	S4TSV9	Salmonella_phage	58.8	9.7e-40
WP_001047889.1|2028459_2029170_+	peptidase	NA	T1SAP9	Salmonella_phage	81.9	1.6e-63
WP_000268705.1|2029184_2030171_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	86.6	1.7e-164
WP_000599566.1|2030222_2030663_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	89.7	7.0e-65
WP_000012264.1|2030673_2031054_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	52.8	2.1e-25
WP_000366671.1|2031105_2031429_+	hypothetical protein	NA	A0A193GYH8	Enterobacter_phage	71.8	1.5e-35
WP_000179046.1|2031428_2032034_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	98.5	2.6e-110
WP_000885914.1|2032033_2034511_+	hypothetical protein	NA	Q858G3	Salmonella_phage	98.5	0.0e+00
WP_000588339.1|2034510_2034975_+	hypothetical protein	NA	T1SA73	Salmonella_phage	98.7	2.0e-86
WP_000337194.1|2034974_2035517_+	hypothetical protein	NA	T1SA02	Salmonella_phage	98.9	2.8e-71
WP_001143616.1|2035529_2038040_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	82.8	0.0e+00
WP_000119842.1|2038036_2039839_+	hypothetical protein	NA	T1SAQ5	Salmonella_phage	96.2	1.6e-304
WP_001248449.1|2039843_2042318_+	hypothetical protein	NA	T1S9I6	Salmonella_phage	98.4	0.0e+00
WP_001189556.1|2042518_2042779_-	hypothetical protein	NA	T1SA06	Salmonella_phage	98.8	2.9e-42
WP_000218894.1|2042977_2045665_+	hypothetical protein	NA	T1S9Y2	Salmonella_phage	73.2	5.6e-96
WP_012578973.1|2045694_2046768_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	29.2	3.9e-24
WP_000751339.1|2046861_2047869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001275998.1|2048065_2048470_+	membrane protein	NA	T1SA79	Salmonella_phage	100.0	9.9e-66
WP_000207017.1|2048456_2048765_+|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	98.0	5.8e-50
WP_000354071.1|2048754_2049381_+	glycoside hydrolase family 19 protein	NA	T1SBJ3	Salmonella_phage	95.7	1.5e-113
WP_012578972.1|2049377_2049860_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	87.5	5.7e-68
WP_000755178.1|2050077_2050617_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
2049971:2049986	attR	ATTGAGTGGGAATGAT	NA	NA	NA	NA
WP_001311989.1|2050632_2051151_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_000076001.1|2051461_2051653_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017553.1|2051670_2051823_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	94.0	4.9e-18
WP_000772700.1|2052004_2054248_+	cyclic-guanylate-specific phosphodiesterase PdeF	NA	NA	NA	NA	NA
WP_001121361.1|2054286_2055828_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_001296288.1|2055832_2057899_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_001028627.1|2058070_2058709_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
WP_001339839.1|2058708_2059746_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001295473.1|2060070_2060697_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000198327.1|2060782_2062072_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.1	8.6e-63
WP_000247065.1|2062121_2062868_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_000166454.1|2063005_2063365_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_000489645.1|2063385_2064849_-|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_000892032.1|2065061_2066123_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_001068682.1|2066221_2066692_-	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_000176187.1|2066691_2067264_-	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_001295469.1|2067409_2068288_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_001296286.1|2068304_2069339_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_001295467.1|2069551_2070265_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
WP_001267498.1|2070432_2071296_+	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
WP_000829364.1|2071310_2073326_+|tRNA	tRNA cytosine(34) acetyltransferase TmcA	tRNA	NA	NA	NA	NA
WP_000679819.1|2073399_2074098_+	esterase	NA	NA	NA	NA	NA
WP_000383836.1|2074178_2074379_-	YpfN family protein	NA	NA	NA	NA	NA
WP_001277801.1|2074406_2075534_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_000258253.1|2075537_2075894_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_001386977.1|2076274_2076334_+	protein YpfM	NA	NA	NA	NA	NA
WP_001273135.1|2076432_2079546_-	multidrug efflux RND transporter permease AcrD	NA	NA	NA	NA	NA
WP_000069202.1|2080683_2081919_+	adhesin-glycosylating O-heptosyltransferase EhaJ	NA	NA	NA	NA	NA
WP_001082402.1|2081922_2085096_+	autotransporter adhesin glycoprotein EhaJ	NA	A0A2L1IV18	Escherichia_phage	24.6	7.6e-44
WP_000636131.1|2085182_2086901_-	nitrate/nitrite two-component system sensor histidine kinase NarQ	NA	NA	NA	NA	NA
WP_001078900.1|2087106_2089086_+	formate-dependent uric acid utilization protein AegA	NA	NA	NA	NA	NA
WP_001296284.1|2089153_2089729_+	GDP-mannose pyrophosphatase NudK	NA	NA	NA	NA	NA
WP_001270532.1|2089854_2090898_+	DUF1176 domain-containing protein	NA	NA	NA	NA	NA
WP_000087317.1|2090974_2092978_-	transketolase	NA	NA	NA	NA	NA
WP_001003720.1|2092997_2093948_-	transaldolase	NA	A0A127KNC6	Cyanophage	30.8	9.7e-11
WP_000342632.1|2094236_2096516_+	NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase	NA	NA	NA	NA	NA
WP_000356956.1|2096807_2097143_+	ethanolamine utilization microcompartment protein EutS	NA	NA	NA	NA	NA
WP_000820789.1|2097155_2097635_+	ethanolamine utilization acetate kinase EutP	NA	NA	NA	NA	NA
WP_000733877.1|2097609_2098311_+	ethanolamine utilization acetate kinase EutQ	NA	NA	NA	NA	NA
WP_000651284.1|2098307_2099111_+	ethanolamine utilization cob(I)yrinic acid a,c-diamide adenosyltransferase EutT	NA	NA	NA	NA	NA
WP_000582973.1|2099107_2100124_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_000387713.1|2100162_2100456_+	ethanolamine utilization microcompartment protein EutM	NA	NA	NA	NA	NA
WP_000762196.1|2100562_2100850_+	ethanolamine utilization microcompartment protein EutN	NA	NA	NA	NA	NA
WP_001075698.1|2100861_2102265_+	aldehyde dehydrogenase EutE	NA	NA	NA	NA	NA
WP_000929720.1|2102275_2103112_+	ethanolamine utilization protein EutJ	NA	NA	NA	NA	NA
WP_012578971.1|2103101_2104289_+	ethanolamine utilization ethanol dehydrogenase EutG	NA	NA	NA	NA	NA
WP_000512386.1|2104505_2105732_+	ethanolamine utilization protein EutH	NA	NA	NA	NA	NA
WP_024201071.1|2105728_2105965_+	ethanolamine ammonia-lyase reactivating factor EutA	NA	NA	NA	NA	NA
WP_000244358.1|2106071_2107445_+|transposase	IS4-like element ISEc13 family transposase	transposase	NA	NA	NA	NA
WP_000769961.1|2108703_2110065_+	ethanolamine ammonia-lyase subunit alpha	NA	NA	NA	NA	NA
WP_001115593.1|2110789_2111296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032314.1|2111298_2111715_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	47.6	4.1e-22
WP_000805554.1|2111686_2112280_-|tail	tail fiber assembly protein	tail	K7PMC4	Enterobacterial_phage	50.3	1.1e-52
WP_032211389.1|2112279_2112771_-	hypothetical protein	NA	K7PH60	Enterobacterial_phage	81.4	1.1e-69
WP_001098747.1|2113028_2113601_-	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	39.8	2.3e-31
WP_001116499.1|2113604_2114684_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	44.4	1.2e-73
WP_000372929.1|2114683_2115034_-	phage GP46 family protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	63.8	8.1e-32
WP_000263495.1|2115087_2115738_-|plate	phage baseplate assembly protein V	plate	F6MIL4	Haemophilus_phage	48.2	6.1e-41
WP_001143147.1|2115737_2116949_-	hypothetical protein	NA	A0A2H4J9E6	uncultured_Caudovirales_phage	37.5	1.3e-68
WP_000539587.1|2116932_2118282_-	DNA circularization N-terminal domain-containing protein	NA	F6MIL2	Haemophilus_phage	26.6	1.1e-36
WP_000918298.1|2118281_2120555_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	35.5	5.6e-81
WP_000178828.1|2120544_2120703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000152396.1|2120717_2121101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000053463.1|2121097_2121472_-	hypothetical protein	NA	F6MIK8	Haemophilus_phage	61.2	1.7e-32
WP_001290034.1|2121484_2122906_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0M3LQC3	Mannheimia_phage	45.7	3.2e-95
WP_000671672.1|2122898_2123099_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_071791946.1|2123112_2123751_-	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	39.4	9.9e-28
WP_000119401.1|2123747_2124179_-	DUF1320 family protein	NA	A0A1X9SGZ3	Bradyrhizobium_phage	27.4	9.1e-09
WP_000416600.1|2124182_2124515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960880.1|2124518_2125427_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A2H4J778	uncultured_Caudovirales_phage	60.3	7.4e-101
WP_000375809.1|2125437_2125833_-	hypothetical protein	NA	A0A2H4IZH5	uncultured_Caudovirales_phage	37.8	1.9e-16
WP_012578967.1|2125833_2126949_-|protease	phage protease	protease	A0A0M5N0Q6	Ralstonia_phage	37.1	7.3e-50
WP_000094313.1|2127158_2127710_-	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_001143306.1|2127706_2128873_-|capsid	minor capsid protein	capsid	A0A0M4UTA3	Ralstonia_phage	46.1	8.4e-57
WP_000068056.1|2128859_2130455_-	DUF935 domain-containing protein	NA	A0A0U5KSI0	unidentified_phage	45.7	3.5e-122
WP_001129149.1|2130458_2132099_-|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	63.1	6.6e-193
WP_001171800.1|2132100_2132841_-	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	52.4	2.4e-65
WP_000312577.1|2132887_2133388_-	DUF1804 family protein	NA	A0A0M3VI86	Ralstonia_phage	47.2	9.8e-39
WP_000241905.1|2133387_2133540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000198193.1|2133614_2133797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836742.1|2133793_2134339_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	85.6	6.4e-92
WP_000445983.1|2134322_2134619_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	50.5	8.1e-17
WP_001372993.1|2134608_2135001_-|holin	phage holin family protein	holin	Q9MBZ5	Enterobacteria_phage	55.7	1.6e-28
WP_000186337.1|2135183_2135462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001192999.1|2135488_2135956_-	hypothetical protein	NA	A0A2D1GNW5	Pseudomonas_phage	39.6	2.3e-18
WP_000976762.1|2136056_2136533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000914513.1|2136529_2136928_-	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	63.6	2.7e-39
WP_000687850.1|2136899_2137178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261588.1|2137430_2137601_-	hypothetical protein	NA	A0A0F6TJP6	Escherichia_coli_O157_typing_phage	91.2	1.4e-18
WP_001289972.1|2137600_2138098_-	ead/Ea22-like family protein	NA	A0A076GCN9	Escherichia_phage	72.2	3.7e-14
WP_001292367.1|2138084_2138354_-	hypothetical protein	NA	Q1MVG1	Enterobacteria_phage	46.0	4.1e-15
WP_000082800.1|2138350_2138515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000234091.1|2138486_2138801_-	DUF4752 family protein	NA	A0A088CD82	Shigella_phage	62.8	2.1e-23
WP_000687524.1|2138790_2139021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000653700.1|2139247_2139958_-	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_000564495.1|2140046_2140265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012578964.1|2140405_2140597_-	hypothetical protein	NA	A0A2D1GNV5	Pseudomonas_phage	54.4	5.2e-09
WP_000553850.1|2140577_2140811_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000206134.1|2140812_2141457_-	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	66.8	1.7e-75
WP_000361028.1|2141713_2141938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000053170.1|2141952_2142846_-	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	56.6	1.2e-90
WP_000500007.1|2142864_2144907_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	49.3	3.5e-175
WP_000989761.1|2144906_2145143_-	helix-turn-helix domain-containing protein	NA	M1PVU4	Vibrio_phage	57.4	1.8e-14
WP_000197710.1|2145325_2145973_+	helix-turn-helix domain-containing protein	NA	A0A2I7S9A5	Vibrio_phage	39.0	1.2e-07
>prophage 4
NZ_LT903847	Escherichia coli O127:H6 isolate EPEC1 chromosome 1	4792490	2228035	2276753	4792490	capsid,holin,tail,plate,integrase,protease,terminase	Enterobacteria_phage(34.29%)	79	2232665:2232680	2275685:2275700
WP_000194529.1|2228035_2229469_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.0	9.1e-29
WP_001274892.1|2229684_2230608_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001197004.1|2230669_2231917_+	MFS transporter	NA	NA	NA	NA	NA
WP_032160942.1|2231996_2232149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001163428.1|2232444_2232645_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2232665:2232680	attL	GGAATCGAACCTGCAA	NA	NA	NA	NA
WP_000545737.1|2232702_2232870_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_000208133.1|2232970_2233603_-	DUF551 domain-containing protein	NA	G9L6B4	Escherichia_phage	90.5	2.0e-81
WP_000360279.1|2233613_2233811_-	hypothetical protein	NA	A0A1I9SEY0	Klebsiella_phage	84.6	1.5e-30
WP_012578961.1|2233812_2234208_-	hypothetical protein	NA	A0A088CE95	Shigella_phage	96.1	9.7e-66
WP_001014291.1|2234210_2234402_-	hypothetical protein	NA	K7PKJ7	Enterobacteria_phage	100.0	3.3e-27
WP_000034177.1|2234403_2235042_-	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	98.3	1.0e-93
WP_000004315.1|2235028_2235298_-	hypothetical protein	NA	Q1MVG1	Enterobacteria_phage	55.2	1.1e-17
WP_001214458.1|2235294_2235462_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	96.4	1.2e-22
WP_001111303.1|2235472_2235766_-	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	100.0	5.0e-51
WP_000098523.1|2235779_2236286_-	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	98.8	6.8e-80
WP_000018648.1|2236282_2236750_-	HNH endonuclease	NA	A0A2I7QWC6	Vibrio_phage	61.3	1.0e-45
WP_000365292.1|2236750_2237458_-	recombinase	NA	Q716E7	Shigella_phage	99.6	3.8e-137
WP_001243355.1|2237712_2237865_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000638547.1|2237849_2237981_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_000005784.1|2238004_2238973_-	hypothetical protein	NA	G5DA88	Enterobacteria_phage	99.7	2.2e-55
WP_000865171.1|2239107_2239296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000505906.1|2239295_2239592_-	hypothetical protein	NA	A0A2D1GLR6	Escherichia_phage	95.9	8.1e-49
WP_000167602.1|2239638_2240109_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	98.7	4.1e-87
WP_000198444.1|2240167_2240551_-	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000050903.1|2241052_2241424_-	hypothetical protein	NA	C6ZR45	Salmonella_phage	58.3	3.6e-06
WP_000588958.1|2241410_2241848_-	hypothetical protein	NA	C6ZR46	Salmonella_phage	73.8	1.0e-55
WP_001274760.1|2241855_2242569_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	100.0	1.8e-131
WP_000437875.1|2242669_2242870_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_012578960.1|2243008_2243305_+	hypothetical protein	NA	A0A2D1GLZ9	Escherichia_phage	99.0	1.2e-47
WP_001244622.1|2243327_2243600_+	hypothetical protein	NA	G9L679	Escherichia_phage	98.9	1.4e-42
WP_000431319.1|2243662_2244550_+	replication protein	NA	A5VW95	Enterobacteria_phage	99.0	3.1e-144
WP_001248389.1|2244546_2245923_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.6	1.6e-253
WP_000736903.1|2245996_2246437_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_012578958.1|2246433_2246961_+	phage N-6-adenine-methyltransferase	NA	H6WZI7	Escherichia_phage	99.4	2.1e-100
WP_001254259.1|2246957_2247134_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	98.3	3.0e-27
WP_000386655.1|2247136_2247496_+	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	95.0	1.0e-61
WP_000950970.1|2247495_2247672_+	protein ninF	NA	A0A220NRM2	Escherichia_phage	98.3	7.4e-26
WP_001279421.1|2247664_2247934_+	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	100.0	7.1e-44
WP_000002231.1|2247933_2248224_+	DUF1364 domain-containing protein	NA	K7PK25	Enterobacteria_phage	96.9	9.3e-50
WP_001008199.1|2248220_2248583_+	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000994516.1|2248579_2248768_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000027553.1|2248764_2249283_+	DUF1133 family protein	NA	Q716B8	Shigella_phage	98.3	2.9e-94
WP_000658764.1|2249477_2249990_+	HNH endonuclease	NA	K7PL52	Enterobacteria_phage	99.4	1.4e-96
WP_000783734.1|2250442_2250766_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229385.1|2250749_2251226_+	glycoside hydrolase family protein	NA	K7P7Y6	Enterobacteria_phage	94.3	7.3e-84
WP_001311799.1|2251209_2251602_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	82.9	2.5e-50
WP_000113285.1|2251745_2251931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001472362.1|2252063_2252678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218996.1|2252631_2253183_+|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	70.3	1.9e-67
WP_001130793.1|2253185_2254808_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	0.0e+00
WP_000113480.1|2254807_2256253_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	94.6	3.7e-264
WP_000246484.1|2256161_2256899_+|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	96.0	6.0e-109
WP_000873163.1|2256913_2258134_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	89.8	1.4e-203
WP_001066736.1|2258137_2258644_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	78.7	3.2e-69
WP_000627485.1|2258655_2259597_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	87.2	1.7e-156
WP_162010769.1|2259593_2259827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001125668.1|2259825_2260233_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	7.4e-69
WP_000008742.1|2260229_2260784_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	85.9	4.7e-82
WP_001142483.1|2260770_2261160_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	95.3	1.1e-66
WP_032211368.1|2261134_2261698_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	2.6e-80
WP_000046921.1|2261701_2262847_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.2	7.5e-159
WP_000257260.1|2262858_2263299_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	2.0e-56
WP_000393944.1|2263302_2263755_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	76.0	2.2e-58
WP_000990882.1|2263932_2265921_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	74.2	1.6e-270
WP_001349561.1|2265920_2266508_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	89.1	3.1e-84
WP_000155121.1|2266507_2266810_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	90.0	9.1e-48
WP_000081741.1|2266812_2267874_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	83.4	4.1e-159
WP_077826329.1|2267909_2268218_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	98.7	2.5e-37
WP_000113597.1|2268338_2269109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001123212.1|2269095_2269491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000301071.1|2269555_2270308_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	65.9	4.5e-88
WP_001270636.1|2270307_2270661_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	88.9	2.0e-54
WP_001197072.1|2270660_2271860_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	83.6	2.9e-185
WP_000049950.1|2271856_2272537_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	2.6e-103
WP_001096966.1|2272536_2273565_+|tail	tail fiber protein	tail	A0A0M3ULD8	Salmonella_phage	46.3	3.5e-30
WP_024201066.1|2273573_2273930_+|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	68.6	2.2e-40
WP_096959196.1|2273905_2274121_+	Hin recombinase	NA	K7PJT4	Enterobacteria_phage	66.7	2.0e-17
WP_000958685.1|2274351_2275509_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.7	3.7e-222
WP_000368123.1|2275820_2276753_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
2275685:2275700	attR	GGAATCGAACCTGCAA	NA	NA	NA	NA
>prophage 5
NZ_LT903847	Escherichia coli O127:H6 isolate EPEC1 chromosome 1	4792490	2513962	2523407	4792490		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569341.1|2513962_2514889_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783128.1|2514893_2515625_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|2515605_2515713_-	protein YohO	NA	NA	NA	NA	NA
WP_001240407.1|2515772_2516504_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001340080.1|2516725_2518411_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	4.3e-304
WP_000598641.1|2518407_2519127_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001302807.1|2519173_2519644_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	3.3e-81
WP_001340078.1|2519684_2520146_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_012578945.1|2520270_2522274_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.2	0.0e+00
WP_001292780.1|2522270_2523407_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.7e-163
>prophage 6
NZ_LT903847	Escherichia coli O127:H6 isolate EPEC1 chromosome 1	4792490	2626023	2643788	4792490		Bacillus_phage(16.67%)	16	NA	NA
WP_001115987.1|2626023_2627418_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	1.7e-19
WP_000999466.1|2627575_2628571_+	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_000183075.1|2628813_2629707_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000234389.1|2630016_2631036_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	48.0	3.2e-84
WP_000799972.1|2631054_2632071_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001140914.1|2632097_2633219_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.5	5.3e-133
WP_000089908.1|2633221_2634187_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	2.2e-87
WP_012578940.1|2634189_2634690_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_001286272.1|2634682_2636131_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.1	3.2e-58
WP_000736844.1|2636134_2637508_+	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.4	1.1e-31
WP_001403120.1|2637520_2638792_+	O90/O127 family O-antigen flippase	NA	NA	NA	NA	NA
WP_012578939.1|2638788_2639442_+	CatB-related O-acetyltransferase	NA	A0A1V0SJ47	Klosneuvirus	39.0	4.2e-13
WP_000983273.1|2639449_2640616_+	O90/O127 family O-antigen polymerase	NA	NA	NA	NA	NA
WP_000626462.1|2640616_2641354_+	glycosyltransferase	NA	F2Y1U7	Organic_Lake_phycodnavirus	28.2	1.5e-11
WP_000271561.1|2641364_2642261_+	alpha-1,2-fucosyltransferase	NA	A0A2H4UUT1	Bodo_saltans_virus	32.3	1.5e-29
WP_000043439.1|2642381_2643788_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
>prophage 7
NZ_LT903847	Escherichia coli O127:H6 isolate EPEC1 chromosome 1	4792490	2951732	2997952	4792490	capsid,holin,portal,tail,tRNA,plate,integrase,terminase,head	Enterobacteria_phage(72.34%)	58	2959068:2959092	2995527:2995551
WP_001144202.1|2951732_2953661_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
WP_001700733.1|2953664_2954207_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_012578919.1|2954303_2954501_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|2954553_2954910_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|2955032_2955077_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018588.1|2955360_2956344_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_000672423.1|2956358_2958746_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|2958750_2959050_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2959068:2959092	attL	GGCCGCTCTGCGGCCTTTTTTCTTT	NA	NA	NA	NA
WP_000078916.1|2959353_2959494_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488101.1|2959684_2959945_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_024188892.1|2960094_2960598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132806.1|2960954_2962055_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	99.2	1.1e-204
WP_000005409.1|2962212_2963397_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	3.6e-225
WP_000290450.1|2963396_2963909_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000789085.1|2963964_2964339_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	7.6e-36
WP_000333505.1|2964347_2964503_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	94.1	2.8e-21
WP_000853385.1|2964489_2967297_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	97.9	0.0e+00
WP_000979945.1|2967309_2967798_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_001165545.1|2967824_2968424_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	81.7	2.6e-86
WP_012578917.1|2968495_2968954_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	52.5	3.4e-38
WP_001057723.1|2968953_2969565_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	80.0	2.5e-84
WP_012578916.1|2969571_2970048_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	57.6	1.2e-46
WP_000217022.1|2970058_2971624_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	56.7	1.4e-139
WP_000071724.1|2971620_2972229_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_001111951.1|2972221_2973118_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	9.7e-154
WP_001067548.1|2973121_2973451_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_012578915.1|2973468_2974035_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.3	1.2e-98
WP_000356305.1|2974046_2974682_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	2.6e-113
WP_000920596.1|2974674_2975142_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	7.6e-86
WP_001437610.1|2975279_2975687_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	4.5e-66
WP_000072327.1|2975683_2976076_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104350.1|2976072_2976396_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|2976398_2976599_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063103.1|2976598_2977093_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000632335.1|2977194_2977995_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.7	2.3e-130
WP_001055100.1|2978040_2979093_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	2.9e-194
WP_001262654.1|2979116_2979953_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	7.9e-150
WP_000613749.1|2980107_2981859_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
WP_000087812.1|2981858_2982905_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000970615.1|2983409_2985614_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_000248600.1|2985610_2986693_-	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	29.5	8.4e-19
WP_000211288.1|2987071_2987383_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	94.2	7.2e-48
WP_000686479.1|2987387_2988347_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	1.1e-179
WP_000123423.1|2988423_2991246_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.4	0.0e+00
WP_000599411.1|2991252_2991618_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	3.9e-61
WP_000153684.1|2991759_2992005_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	91.4	3.4e-37
WP_000985159.1|2992001_2992205_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
WP_000021668.1|2992291_2992405_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.2e-08
WP_000514277.1|2992401_2992644_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000158964.1|2992655_2992943_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	75.8	3.0e-32
WP_000917809.1|2992953_2993292_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	87.1	2.3e-52
WP_001151410.1|2993306_2993585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000904672.1|2993681_2993990_+	helix-turn-helix domain-containing protein	NA	A0A0M5M1I9	Salmonella_phage	53.1	1.3e-22
WP_001247208.1|2994078_2995014_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	50.8	5.6e-80
WP_000416304.1|2995024_2995420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000956501.1|2995609_2996590_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
2995527:2995551	attR	GGCCGCTCTGCGGCCTTTTTTCTTT	NA	NA	NA	NA
WP_001154183.1|2996651_2997203_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029464.1|2997202_2997952_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
>prophage 8
NZ_LT903847	Escherichia coli O127:H6 isolate EPEC1 chromosome 1	4792490	3334487	3428681	4792490	capsid,portal,holin,tail,integrase,transposase,protease,terminase,head	Stx2-converting_phage(27.27%)	100	3381610:3381635	3428820:3428845
WP_000244358.1|3334487_3335861_+|transposase	IS4-like element ISEc13 family transposase	transposase	NA	NA	NA	NA
WP_000135020.1|3335890_3337054_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.9	1.6e-28
WP_000946236.1|3337062_3338436_-	TolC family protein	NA	NA	NA	NA	NA
WP_000492800.1|3338439_3341547_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_000873803.1|3341546_3342668_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000202113.1|3342816_3343383_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000506492.1|3343860_3344649_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_012578897.1|3344793_3345948_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000485010.1|3345987_3347922_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	28.1	2.2e-33
WP_000526113.1|3348106_3348565_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	8.5e-13
WP_000221852.1|3348709_3348814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024201056.1|3348867_3350853_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_001288368.1|3351000_3351174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001088619.1|3351263_3352013_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000480199.1|3352281_3352500_+	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_001339667.1|3352625_3352952_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_001339668.1|3352951_3353689_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_000891353.1|3353880_3355050_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_000876274.1|3355056_3355365_-	lipopolysaccharide assembly protein LapA	NA	NA	NA	NA	NA
WP_001256548.1|3355513_3356278_-	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_001176295.1|3356447_3357038_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
WP_000099527.1|3357101_3359777_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_001310756.1|3359939_3360035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001308616.1|3360148_3360316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908596.1|3360318_3360483_-	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_000776253.1|3360777_3361752_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_001295576.1|3361961_3364559_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
WP_001031530.1|3364938_3365190_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422059.1|3365225_3366275_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559273.1|3366494_3367253_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_001278899.1|3367249_3367840_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291206.1|3367879_3368755_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001339671.1|3368967_3370857_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|3370884_3371505_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285667.1|3371501_3372383_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|3372520_3372565_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194637.1|3372656_3374213_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763545.1|3374212_3375808_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	1.1e-51
WP_001195274.1|3375811_3377170_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000209513.1|3377181_3378375_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443085.1|3378374_3379181_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000244358.1|3379256_3380630_-|transposase	IS4-like element ISEc13 family transposase	transposase	NA	NA	NA	NA
WP_000526113.1|3380921_3381380_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	8.5e-13
WP_000350514.1|3381501_3381624_-	membrane protein	NA	NA	NA	NA	NA
3381610:3381635	attL	GGTATCGATATCCATGTACCAGACCG	NA	NA	NA	NA
WP_106409363.1|3382917_3383112_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	87.2	1.1e-09
WP_000767050.1|3383056_3383599_-	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_001023459.1|3383819_3384089_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	96.6	4.6e-43
WP_000216481.1|3384090_3385368_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	88.9	2.4e-73
WP_001233154.1|3385519_3386119_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	4.5e-107
WP_000514675.1|3386186_3389660_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_122999376.1|3389900_3390533_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	97.1	3.9e-101
WP_000194793.1|3390478_3391222_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_001420466.1|3391227_3391926_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	9.9e-130
WP_000807924.1|3391925_3392267_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	96.5	2.4e-60
WP_000212986.1|3392259_3395502_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.1	0.0e+00
WP_001513217.1|3395549_3395759_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710949.1|3395854_3396229_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275441.1|3396243_3396960_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000133388.1|3397024_3397369_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573362.1|3397365_3397812_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	5.2e-76
WP_001007915.1|3397808_3398159_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	3.0e-58
WP_000125990.1|3398168_3398495_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_012578896.1|3398491_3401077_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.7	0.0e+00
WP_001063099.1|3401022_3401244_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173031.1|3401288_3403226_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001339613.1|3403289_3404951_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.1	0.0e+00
WP_000958372.1|3404947_3405511_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.5	3.3e-83
WP_000829185.1|3405801_3406167_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000095741.1|3406208_3406409_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000736383.1|3406607_3406832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|3406917_3407103_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_032140280.1|3407324_3407411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992071.1|3407965_3408499_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_000193280.1|3408562_3408913_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
WP_000372595.1|3408917_3409133_-|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000874861.1|3409283_3411137_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	94.2	0.0e+00
WP_000244363.1|3411671_3413045_+|transposase	IS4-like element ISEc13 family transposase	transposase	NA	NA	NA	NA
WP_001064912.1|3413621_3414311_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	2.1e-60
WP_000904174.1|3414307_3414667_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	3.9e-37
WP_001265094.1|3414679_3415729_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	5.9e-110
WP_001410105.1|3415730_3416009_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_000967405.1|3416175_3416388_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	1.8e-26
WP_000893384.1|3416677_3417769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000748514.1|3417765_3418194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001380433.1|3418234_3418828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001339608.1|3418824_3419217_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	58.3	3.7e-33
WP_001002673.1|3419478_3419790_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	96.1	3.1e-59
WP_001151205.1|3420033_3420456_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	3.9e-65
WP_000095665.1|3420496_3421459_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	50.9	1.0e-68
WP_000693943.1|3421481_3421907_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391950.1|3421890_3422172_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000362153.1|3422272_3422692_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000367380.1|3422957_3423110_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	4.3e-06
WP_001339605.1|3423121_3423523_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	81.6	1.0e-09
WP_000358771.1|3423482_3423761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3424319_3424508_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3424504_3424696_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048378.1|3424788_3427260_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|3427324_3427573_+	excisionase	NA	NA	NA	NA	NA
WP_000113687.1|3427550_3428681_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	5.7e-103
3428820:3428845	attR	GGTATCGATATCCATGTACCAGACCG	NA	NA	NA	NA
>prophage 9
NZ_LT903847	Escherichia coli O127:H6 isolate EPEC1 chromosome 1	4792490	3646638	3670477	4792490	transposase	Escherichia_phage(30.0%)	16	NA	NA
WP_000747069.1|3646638_3646989_+|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	1.8e-39
WP_170315999.1|3647108_3648321_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	97.3	3.3e-165
WP_000080159.1|3649501_3651115_-|transposase	IS66-like element ISEc47 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.2	1.0e-174
WP_085947603.1|3651307_3652469_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_000762451.1|3653484_3653760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000013660.1|3653940_3654309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343040.1|3655460_3655700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985463.1|3655739_3658178_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	37.8	7.6e-76
WP_001386438.1|3658189_3659539_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000312835.1|3659550_3660207_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_000634203.1|3660203_3661271_+	macro domain-containing protein	NA	B0FIJ9	Escherichia_phage	39.2	1.4e-18
WP_000108733.1|3661289_3664385_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	28.1	5.1e-53
WP_001122107.1|3664384_3665101_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_001297096.1|3665928_3666708_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255946.1|3666707_3667730_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_170315999.1|3669263_3670477_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	97.3	3.3e-165
>prophage 10
NZ_LT903847	Escherichia coli O127:H6 isolate EPEC1 chromosome 1	4792490	3679457	3758289	4792490	portal,holin,lysis,tail,integrase,transposase,protease,terminase	Enterobacteria_phage(51.52%)	93	3702689:3702703	3754259:3754273
WP_000279877.1|3679457_3680675_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.8	1.1e-43
WP_000009232.1|3680940_3681627_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000533536.1|3682189_3682978_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	2.7e-91
WP_001199145.1|3683604_3684876_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000154378.1|3684881_3686009_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_000497957.1|3686066_3686897_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_001018494.1|3687116_3688625_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000979523.1|3688783_3688993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578870.1|3689047_3693010_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000191701.1|3693049_3693688_-	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001340066.1|3693975_3695067_+	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_001340067.1|3695066_3695759_+	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001126780.1|3695770_3696157_+	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001340068.1|3696164_3696965_+	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001001173.1|3696974_3697565_+	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001028090.1|3697575_3698070_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	95.8	2.5e-50
WP_001298362.1|3698090_3699419_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	1.4e-233
WP_001273658.1|3699501_3699675_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001151437.1|3700047_3700644_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|3700664_3700892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000244367.1|3700926_3702300_-|transposase	IS4-like element ISEc13 family transposase	transposase	NA	NA	NA	NA
WP_001044299.1|3702488_3703730_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
3702689:3702703	attL	GCCAACGCTGGAAAA	NA	NA	NA	NA
WP_000420625.1|3704264_3705185_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_000024568.1|3705184_3705490_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209902.1|3705845_3706445_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001063129.1|3706441_3708988_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	1.3e-70
WP_001230247.1|3708987_3710160_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|3710289_3710982_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001265017.1|3710954_3711983_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001024006.1|3712706_3712976_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_012578868.1|3712977_3714291_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.8	6.3e-77
WP_001233161.1|3714355_3714955_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	99.5	6.7e-111
WP_109840064.1|3716771_3718739_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	99.7	0.0e+00
WP_012578867.1|3718799_3719447_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.1	1.6e-113
WP_012578866.1|3719344_3720088_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.9e-149
WP_001152385.1|3720092_3720791_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_000447253.1|3720800_3721130_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001161009.1|3724156_3724486_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001372042.1|3724494_3724881_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	100.0	4.3e-66
WP_000211121.1|3724941_3725685_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	100.0	1.6e-133
WP_001079423.1|3725695_3726097_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	100.0	8.3e-73
WP_000677106.1|3726093_3726672_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001283145.1|3726683_3726959_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	96.7	1.6e-43
WP_001097046.1|3726951_3727275_-	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	100.0	8.5e-52
WP_086214752.1|3727361_3729389_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.8	0.0e+00
WP_011478361.1|3729333_3730914_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	4.3e-290
WP_001072975.1|3730841_3731054_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934130.1|3731050_3733153_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.3	0.0e+00
WP_000373425.1|3733152_3733647_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_001059339.1|3734254_3734779_-	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	94.2	4.5e-87
WP_000092249.1|3734977_3735445_-|lysis	lysis protein	lysis	H6WZK2	Escherichia_phage	97.4	4.6e-75
WP_000075164.1|3735441_3735939_-	lysozyme	NA	H6WZK1	Escherichia_phage	98.8	3.8e-91
WP_000284524.1|3735938_3736154_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3736296_3736695_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499456.1|3736775_3736934_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3737019_3737763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235460.1|3738015_3738639_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.6	9.8e-113
WP_001008186.1|3738781_3739144_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	6.0e-62
WP_000002243.1|3739140_3739431_-	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_001003979.1|3739430_3740153_-	phage antirepressor KilAC domain-containing protein	NA	K7P7L0	Enterobacteria_phage	95.0	4.2e-123
WP_000566998.1|3740145_3740316_-	protein ninF	NA	A0A2I6PIG4	Escherichia_phage	100.0	7.2e-26
WP_001254226.1|3740312_3740495_-	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	98.3	4.3e-29
WP_000153283.1|3740491_3741019_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	98.9	2.3e-99
WP_000810177.1|3741015_3741462_-	recombination protein NinB	NA	A0A1I9LJP8	Stx_converting_phage	91.2	2.9e-74
WP_000796283.1|3741484_3741811_-	hypothetical protein	NA	I6RSP8	Salmonella_phage	99.1	9.5e-59
WP_000145926.1|3741883_3742174_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000788881.1|3742170_3742872_-	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	99.1	3.8e-129
WP_000185505.1|3742868_3743768_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000438530.1|3743800_3744097_-	hypothetical protein	NA	G9L678	Escherichia_phage	95.9	2.2e-46
WP_000067727.1|3744238_3744454_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_096246228.1|3744528_3745224_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	99.1	4.3e-133
WP_000032717.1|3745304_3746147_+	hypothetical protein	NA	F5A3D6	Riemerella_phage	42.5	1.2e-52
WP_000088206.1|3746585_3746858_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	1.7e-40
WP_000167595.1|3746916_3747387_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000065364.1|3747537_3747906_+	DUF2528 family protein	NA	K7PGR6	Enterobacteria_phage	99.2	2.6e-65
WP_000972063.1|3747981_3748116_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_001243355.1|3748100_3748253_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000365290.1|3748507_3749215_+	recombinase	NA	Q716E7	Shigella_phage	99.6	1.3e-137
WP_000168274.1|3749215_3749722_+	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	100.0	2.3e-80
WP_001111334.1|3749735_3750029_+	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	97.9	1.2e-49
WP_001214459.1|3750039_3750204_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	1.6e-22
WP_000827661.1|3750200_3750764_+	hypothetical protein	NA	A0A0F6TJR7	Escherichia_coli_O157_typing_phage	60.8	6.0e-45
WP_012578863.1|3750760_3751429_+	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	79.7	2.7e-68
WP_000026224.1|3751631_3751913_+	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	100.0	2.8e-51
WP_000545733.1|3752001_3752169_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_001303849.1|3752208_3752427_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533666.1|3752404_3753478_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	98.9	1.5e-198
WP_001054742.1|3753572_3756305_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	33.3	3.7e-39
3754259:3754273	attR	GCCAACGCTGGAAAA	NA	NA	NA	NA
WP_000818463.1|3756387_3757461_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|3757509_3757683_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001316982.1|3757672_3757903_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|3757877_3758066_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|3758076_3758289_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 11
NZ_LT903847	Escherichia coli O127:H6 isolate EPEC1 chromosome 1	4792490	3857761	3944007	4792490	capsid,portal,lysis,tail,tRNA,plate,integrase,protease,terminase,head	Salmonella_phage(60.71%)	89	3910481:3910506	3944082:3944107
WP_000886683.1|3857761_3859054_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067753.1|3859144_3860488_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	4.8e-80
WP_001295343.1|3860498_3861110_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077112.1|3861268_3865375_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3865509_3866004_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537423.1|3866548_3867514_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043562.1|3867636_3869403_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.0	5.4e-23
WP_001202172.1|3869403_3871125_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.6	3.8e-21
WP_001241681.1|3871166_3871871_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3872155_3872374_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3873176_3875453_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520792.1|3875483_3875804_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3876126_3876351_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188123.1|3876423_3878370_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	8.5e-38
WP_000746481.1|3878366_3879482_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001351020.1|3879632_3880589_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599803.1|3880585_3882244_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_000488716.1|3882669_3883365_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491136.1|3883848_3884748_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458817.1|3884891_3886544_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178693.1|3886555_3887524_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815374.1|3887656_3889375_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	6.8e-31
WP_000566381.1|3889411_3890413_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136526.1|3890423_3891854_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001305933.1|3891952_3892966_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255161.1|3892962_3893793_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	29.4	7.4e-07
WP_001160737.1|3893789_3894113_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001295906.1|3894238_3894754_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3894971_3895700_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756575.1|3895717_3896449_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|3896455_3897172_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3897171_3897840_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|3898065_3898797_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149710.1|3898825_3899953_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	4.6e-28
WP_000389260.1|3899993_3900482_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061665.1|3900541_3901387_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105422.1|3901383_3902337_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996007.1|3902346_3903480_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126095.1|3903574_3904687_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3905036_3905513_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3905600_3906503_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189166.1|3906563_3907286_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201578.1|3907269_3907557_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195231.1|3907716_3907974_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_000681104.1|3908003_3908381_-	membrane protein	NA	NA	NA	NA	NA
WP_001024876.1|3908650_3910336_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3910481:3910506	attL	ATGGGTTTTTTGTTGCCTGAAATTTA	NA	NA	NA	NA
WP_000972391.1|3910571_3910790_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001011806.1|3910877_3911978_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	86.1	1.0e-176
WP_000980387.1|3911974_3912460_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	3.7e-67
WP_001282790.1|3912456_3915534_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.5	0.0e+00
WP_000763311.1|3915526_3915646_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|3915660_3915963_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207667.1|3916017_3916533_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_000249532.1|3916542_3917715_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	89.5	6.6e-203
WP_000905023.1|3917857_3918424_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
WP_000575294.1|3918541_3919687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993763.1|3919778_3920357_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000177580.1|3920353_3920713_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_000268309.1|3920699_3921608_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	2.0e-143
WP_001086818.1|3921600_3922206_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	4.4e-110
WP_000104819.1|3922202_3923264_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	79.0	2.0e-150
WP_001039945.1|3923618_3924050_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
WP_001080937.1|3924145_3924574_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.6	1.1e-46
WP_000727846.1|3924570_3924948_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	5.1e-16
WP_001069909.1|3924949_3925462_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000171568.1|3925442_3925658_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|3925661_3925865_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673512.1|3925864_3926329_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	88.3	6.0e-75
WP_000059192.1|3926424_3927075_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	2.5e-111
WP_000742523.1|3927078_3928137_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	8.4e-181
WP_000216246.1|3928153_3928987_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	84.8	1.4e-122
WP_001098422.1|3929129_3930896_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000520398.1|3930895_3931921_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.5	2.0e-171
WP_001324531.1|3931945_3932920_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_001059831.1|3933471_3933807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3933999_3934233_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154431.1|3934243_3934432_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_000017609.1|3934586_3937001_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	95.1	0.0e+00
WP_000104133.1|3936997_3937855_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.1	2.1e-158
WP_000752613.1|3937851_3938079_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244228.1|3938078_3938312_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_000963473.1|3938379_3938721_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956184.1|3938684_3938885_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	2.1e-32
WP_000460902.1|3938892_3939402_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	94.7	5.1e-83
WP_000804007.1|3939434_3939656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000051080.1|3939781_3940351_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.9	2.7e-37
WP_000107166.1|3940401_3941325_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.8	2.1e-34
WP_000649630.1|3941350_3942868_+	NTPase	NA	R9TRQ8	Vibrio_phage	34.4	4.8e-44
WP_000290941.1|3942954_3944007_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.4	1.1e-105
3944082:3944107	attR	ATGGGTTTTTTGTTGCCTGAAATTTA	NA	NA	NA	NA
>prophage 12
NZ_LT903847	Escherichia coli O127:H6 isolate EPEC1 chromosome 1	4792490	3979708	4071600	4792490	capsid,portal,holin,lysis,tail,integrase,transposase,terminase,head	Enterobacteria_phage(38.89%)	112	3983609:3983624	4083530:4083545
WP_000526113.1|3979708_3980167_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	8.5e-13
WP_001295296.1|3980356_3980872_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|3980924_3980990_-	protein YliM	NA	NA	NA	NA	NA
WP_001340110.1|3981224_3982112_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|3982411_3982915_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|3983318_3984065_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
3983609:3983624	attL	TAAAAAAGCGATCGAT	NA	NA	NA	NA
WP_001159065.1|3984206_3984866_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|3984862_3985585_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001267238.1|3985701_3987927_+	mechanosensitive channel protein	NA	NA	NA	NA	NA
WP_012578859.1|3987923_3988850_-	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_000710618.1|3989125_3989386_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000429988.1|3989650_3991933_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990166.1|3991974_3992652_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	2.4e-19
WP_000146357.1|3992725_3992992_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000849308.1|3993256_3993517_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000253499.1|3993744_3994830_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386553.1|3994970_3995933_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001218658.1|3995960_3998111_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	6.3e-42
WP_000007144.1|3998647_4000009_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	8.6e-53
WP_001295890.1|4000237_4000909_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000743444.1|4000911_4001907_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001385246.1|4001899_4003636_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000070116.1|4003628_4004762_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000469031.1|4004772_4005879_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|4005840_4006251_-	YbhQ family protein	NA	NA	NA	NA	NA
WP_001113348.1|4006383_4007145_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650337.1|4007141_4008383_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_000045473.1|4008382_4009339_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_012578858.1|4009374_4010088_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000373624.1|4010292_4010997_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852274.1|4011133_4011586_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000611264.1|4011587_4011833_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|4011825_4012311_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084639.1|4012313_4012826_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_001339847.1|4012847_4013837_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001331964.1|4014233_4015142_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	3.7e-28
WP_000042533.1|4015179_4017201_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000030920.1|4017779_4018457_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246765.1|4018449_4019205_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118801.1|4019191_4020346_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951213.1|4020342_4021383_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_001339846.1|4021469_4022759_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.3e-18
WP_000817269.1|4022869_4024000_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	86.4	9.5e-191
WP_000767425.1|4024108_4024585_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_001024006.1|4024940_4025210_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_012578868.1|4025211_4026525_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.8	6.3e-77
WP_001233161.1|4026589_4027189_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	99.5	6.7e-111
WP_000515449.1|4027258_4030672_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.0	0.0e+00
WP_000090850.1|4030732_4031335_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_000140734.1|4031271_4032015_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	5.0e-148
WP_001152649.1|4032020_4032719_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_000847401.1|4032718_4033048_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_000082311.1|4033044_4035606_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	93.6	0.0e+00
WP_000533431.1|4035586_4036000_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000479086.1|4036026_4036458_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000106788.1|4036471_4037224_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	94.8	8.2e-130
WP_000683066.1|4037231_4037627_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	3.9e-59
WP_000975033.1|4037623_4038157_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	2.9e-57
WP_001204536.1|4038171_4038525_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	6.7e-42
WP_000201528.1|4038517_4038892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522630.1|4038943_4039972_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
WP_000256818.1|4040029_4040377_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_001254036.1|4040413_4041919_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_012578856.1|4041908_4043501_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	1.9e-184
WP_000259002.1|4043497_4043704_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_012578855.1|4043687_4045616_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.2e-262
WP_000235436.1|4045587_4046097_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001307652.1|4046491_4046686_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000881326.1|4046873_4047491_-	Rha family transcriptional regulator	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_000092318.1|4047640_4048078_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000075132.1|4048074_4048572_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_024164617.1|4048571_4048787_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000023276.1|4049225_4051076_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.6	0.0e+00
WP_000499454.1|4051374_4051533_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|4051618_4052362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097234.1|4052546_4053236_-	hypothetical protein	NA	I6PDF8	Cronobacter_phage	47.6	4.5e-58
WP_032160865.1|4053250_4053373_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|4053711_4054671_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_000994516.1|4054882_4055071_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000002251.1|4055426_4055717_-	DUF1364 domain-containing protein	NA	K7PK25	Enterobacteria_phage	97.9	7.1e-50
WP_000237093.1|4055709_4056102_-	hypothetical protein	NA	A0A1B0VBU7	Salmonella_phage	35.3	2.9e-14
WP_024201048.1|4056091_4056265_-	ninF	NA	NA	NA	NA	NA
WP_000567008.1|4056624_4056804_-	protein ninF	NA	M1FPE8	Enterobacteria_phage	86.0	1.7e-14
WP_001254251.1|4056800_4056983_-	NinE family protein	NA	Q716C5	Shigella_phage	100.0	1.3e-28
WP_000736893.1|4056979_4057420_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	99.3	1.6e-80
WP_012578852.1|4057497_4059378_-	toprim domain-containing protein	NA	K7PK08	Enterobacteria_phage	99.7	0.0e+00
WP_000062366.1|4059485_4060262_-	helix-turn-helix domain-containing protein	NA	A0A0P0ZC04	Stx2-converting_phage	98.4	2.1e-136
WP_000438488.1|4060424_4060724_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	97.0	1.4e-48
WP_001180318.1|4060830_4061058_-	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250470.1|4061136_4061844_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	98.7	2.2e-132
WP_000633167.1|4062048_4062873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000971597.1|4063104_4063317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000216182.1|4063315_4063624_+	hypothetical protein	NA	A0A075B8K6	Enterobacteria_phage	69.6	3.0e-30
WP_001077327.1|4063627_4063852_+	hypothetical protein	NA	K7PJZ1	Enterobacterial_phage	100.0	8.0e-33
WP_000387878.1|4063914_4064238_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	98.1	2.5e-59
WP_000065351.1|4064417_4064786_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	4.5e-65
WP_001183771.1|4064861_4065032_+	hypothetical protein	NA	A0A192Y6R1	Salmonella_phage	100.0	1.3e-24
WP_000365292.1|4065286_4065994_+	recombinase	NA	Q716E7	Shigella_phage	99.6	3.8e-137
WP_000018648.1|4065994_4066462_+	HNH endonuclease	NA	A0A2I7QWC6	Vibrio_phage	61.3	1.0e-45
WP_000098523.1|4066458_4066965_+	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	98.8	6.8e-80
WP_001111304.1|4066978_4067275_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	100.0	7.8e-52
WP_001214458.1|4067285_4067453_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	96.4	1.2e-22
WP_000004315.1|4067449_4067719_+	hypothetical protein	NA	Q1MVG1	Enterobacteria_phage	55.2	1.1e-17
WP_000034177.1|4067705_4068344_+	ead/Ea22-like family protein	NA	H6WZG2	Escherichia_phage	98.3	1.0e-93
WP_001014291.1|4068345_4068537_+	hypothetical protein	NA	K7PKJ7	Enterobacteria_phage	100.0	3.3e-27
WP_001339358.1|4068539_4068935_+	hypothetical protein	NA	A0A088CE95	Shigella_phage	96.9	3.3e-66
WP_000360279.1|4068936_4069134_+	hypothetical protein	NA	A0A1I9SEY0	Klebsiella_phage	84.6	1.5e-30
WP_000208133.1|4069144_4069777_+	DUF551 domain-containing protein	NA	G9L6B4	Escherichia_phage	90.5	2.0e-81
WP_000002111.1|4069769_4070054_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	96.8	1.0e-48
WP_000545741.1|4070126_4070294_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	4.9e-27
WP_001303849.1|4070333_4070552_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533654.1|4070529_4071600_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.4	5.6e-201
4083530:4083545	attR	ATCGATCGCTTTTTTA	NA	NA	NA	NA
