The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT799839	Clostridium chauvoei JF4335 chromosome I	2887451	319348	387865	2887451	tRNA,integrase,transposase	Planktothrix_phage(20.0%)	52	327000:327016	389709:389725
WP_021874690.1|319348_321286_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.4	3.1e-112
WP_079481064.1|322012_322423_-	HNH endonuclease	NA	A0A0A7RVR5	Clostridium_phage	40.5	3.7e-20
WP_079481065.1|322627_323302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021874692.1|323904_325182_+	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_079480999.1|325301_326540_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	51.9	1.7e-52
WP_021874693.1|326740_328093_-	CZB domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.0	5.8e-09
327000:327016	attL	TCATTAATATTTTCTAA	NA	NA	NA	NA
WP_021874694.1|328263_329346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079481036.1|329918_331358_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_021874695.1|331536_332376_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021874696.1|332423_333107_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_079481066.1|333090_333813_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.1	1.2e-34
WP_021874698.1|333996_334833_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021874699.1|335028_337557_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_021874700.1|337999_339496_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_021874701.1|339692_341126_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021874702.1|341137_342379_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021874703.1|342435_342789_+	DUF1667 domain-containing protein	NA	NA	NA	NA	NA
WP_096145479.1|343197_343902_+	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	38.0	7.1e-35
WP_079481068.1|344000_344621_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_021874706.1|344617_345466_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.5	1.7e-14
WP_079481069.1|345469_345844_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021874708.1|345978_347157_-	cation transporter	NA	NA	NA	NA	NA
WP_021874709.1|347339_348635_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_021874710.1|348781_357274_+	cyclic beta 1-2 glucan synthetase	NA	NA	NA	NA	NA
WP_021874711.1|357494_358430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021874712.1|358445_359702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021874713.1|360203_360893_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079481070.1|361291_362812_+	L-lactate permease	NA	NA	NA	NA	NA
WP_021874715.1|362841_363630_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_021874716.1|363642_364833_+	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_021874717.1|364835_366236_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_172000982.1|366656_367943_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	24.5	2.4e-12
WP_021874720.1|368055_368196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021874721.1|368274_368433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021874722.1|368528_368738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021874723.1|368831_369605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079481071.1|369676_370168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021874725.1|370519_371809_-	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_021874726.1|371837_372512_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_079481072.1|372739_374515_+	histidine kinase	NA	NA	NA	NA	NA
WP_079481073.1|374507_376022_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_096145478.1|376362_376923_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_021874730.1|376927_378268_+	DUF4179 domain-containing protein	NA	NA	NA	NA	NA
WP_021874731.1|378414_378708_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	44.4	1.3e-06
WP_021874732.1|378740_379082_+	DUF4362 domain-containing protein	NA	NA	NA	NA	NA
WP_079481036.1|379412_380852_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_079481076.1|381328_382021_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.3	2.1e-23
WP_131431558.1|382017_383211_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_161493077.1|383213_384242_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_021874736.1|384332_384620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079481036.1|384887_386327_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_079481077.1|386650_387865_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
389709:389725	attR	TTAGAAAATATTAATGA	NA	NA	NA	NA
>prophage 2
NZ_LT799839	Clostridium chauvoei JF4335 chromosome I	2887451	510766	542751	2887451	holin,transposase	Synechococcus_phage(25.0%)	30	NA	NA
WP_079481109.1|510766_511504_+|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_021874844.1|511607_512078_+	VanZ family protein	NA	NA	NA	NA	NA
WP_021874845.1|512254_513862_+	phosphotransferase	NA	NA	NA	NA	NA
WP_021874846.1|513882_514830_+	DMT family transporter	NA	NA	NA	NA	NA
WP_021874847.1|514832_515516_+	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_021874848.1|515738_516542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021874849.1|516563_516983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096145424.1|517120_517837_+	transaldolase	NA	A0A0E3F5V4	Synechococcus_phage	34.5	6.8e-17
WP_021874851.1|517865_518312_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_079481110.1|518338_518626_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_021874853.1|518638_520018_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_021874854.1|520102_522235_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_021874855.1|522396_522669_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021874856.1|522686_523505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021874857.1|523519_524851_+	AAA family ATPase	NA	A0A139ZPD0	Marinitoga_camini_virus	26.7	9.0e-23
WP_021874858.1|525736_526387_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.1	1.4e-32
WP_079481112.1|527150_527942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021874861.1|527925_528717_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_021874862.1|528916_529081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021874863.1|529082_529649_+	zeta toxin family protein	NA	NA	NA	NA	NA
WP_021874864.1|530131_531055_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_021874868.1|532689_534531_+	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	25.2	1.7e-24
WP_021874869.1|534808_536836_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_021874871.1|537187_537793_+	Fic family protein	NA	NA	NA	NA	NA
WP_021874872.1|538055_538748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079481114.1|538876_539758_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_079481115.1|539787_540633_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_079481116.1|540662_540953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079481117.1|540982_541876_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_079481115.1|541905_542751_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_LT799839	Clostridium chauvoei JF4335 chromosome I	2887451	1073504	1086585	2887451		Cyanophage(25.0%)	12	NA	NA
WP_021875361.1|1073504_1074443_+	SPFH/Band 7/PHB domain protein	NA	A0A2K9KZA2	Tupanvirus	34.9	1.7e-23
WP_079481268.1|1074508_1074919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008677523.1|1075208_1075364_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_021875363.1|1075668_1075824_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_021875364.1|1076057_1076684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021875365.1|1077032_1080779_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	24.4	2.4e-28
WP_021875366.1|1080791_1081271_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	49.0	1.8e-29
WP_021875367.1|1081270_1081975_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	42.1	2.4e-43
WP_021875368.1|1082027_1083455_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	33.3	1.6e-57
WP_021875369.1|1083464_1084466_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SQF5	Cyanophage	45.9	5.3e-68
WP_079481269.1|1084453_1085065_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.4	4.6e-22
WP_021875371.1|1085082_1086585_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	45.2	9.1e-64
>prophage 4
NZ_LT799839	Clostridium chauvoei JF4335 chromosome I	2887451	1529984	1538701	2887451	integrase	uncultured_Mediterranean_phage(33.33%)	9	1536606:1536621	1541106:1541121
WP_079481387.1|1529984_1531145_-	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	29.4	3.5e-07
WP_021875775.1|1531283_1531862_+	DUF2953 domain-containing protein	NA	NA	NA	NA	NA
WP_021875776.1|1531871_1532372_+	sporulation protein YtfJ	NA	NA	NA	NA	NA
WP_079481388.1|1532431_1533043_-	segregation/condensation protein B	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	31.5	5.2e-18
WP_021875778.1|1533035_1533779_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	36.0	1.0e-07
WP_021875779.1|1533889_1535143_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	28.6	4.5e-32
WP_021875780.1|1535242_1536547_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	57.6	2.9e-130
1536606:1536621	attL	AAATTATAGTATTTCT	NA	NA	NA	NA
WP_021875781.1|1536608_1537775_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_021875782.1|1537822_1538701_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	26.7	2.0e-23
1541106:1541121	attR	AAATTATAGTATTTCT	NA	NA	NA	NA
>prophage 5
NZ_LT799839	Clostridium chauvoei JF4335 chromosome I	2887451	1750852	1821546	2887451	portal,transposase,integrase,tail,head,capsid,terminase,coat	Clostridium_phage(32.0%)	72	1799411:1799429	1827705:1827723
WP_079481077.1|1750852_1752067_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_079481449.1|1752254_1753454_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	51.4	8.8e-110
WP_021875995.1|1753505_1754156_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	37.8	1.4e-24
WP_021875996.1|1754191_1755286_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	37.3	4.5e-52
WP_079481450.1|1755658_1756627_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_021875998.1|1756653_1757529_-	radical SAM/SPASM domain-containing protein	NA	NA	NA	NA	NA
WP_079481451.1|1757954_1758485_+	J domain-containing protein	NA	NA	NA	NA	NA
WP_021876000.1|1758532_1759639_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_021876001.1|1759760_1761857_-	5'-nucleotidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_021876002.1|1762173_1764177_-	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	32.5	5.7e-29
WP_021876003.1|1764639_1765371_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_021876004.1|1765479_1766130_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	39.1	2.8e-30
WP_021876005.1|1766129_1767533_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_021876006.1|1767560_1768457_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_021876007.1|1768521_1769181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021876008.1|1769219_1771016_-	GTPase HflX	NA	NA	NA	NA	NA
WP_079481849.1|1771155_1771680_+	hypoxanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_079481453.1|1771880_1772537_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_021876011.1|1772646_1775238_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_079481454.1|1775529_1776927_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_079481455.1|1776968_1777811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021876014.1|1778070_1778970_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_021876015.1|1778989_1779727_-	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
WP_021876016.1|1779744_1780620_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_021876017.1|1780632_1781829_-	dihydroorotase	NA	NA	NA	NA	NA
WP_021876018.1|1781847_1782270_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_021876020.1|1783498_1783861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021876021.1|1783932_1784712_-	serine hydrolase	NA	NA	NA	NA	NA
WP_079481456.1|1784871_1785972_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_021876023.1|1786196_1787081_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_021876024.1|1787153_1788254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079481457.1|1788320_1790051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079481458.1|1790176_1790965_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_079481459.1|1790957_1791725_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	6.3e-29
WP_021876028.1|1791827_1792616_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_079481461.1|1793619_1794291_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_021876031.1|1794516_1794702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021876032.1|1794715_1794967_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_079481462.1|1795071_1796127_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1L6BY22	Clostridium_phage	38.6	1.9e-20
WP_021876034.1|1796197_1796605_-	hypothetical protein	NA	I2E8W8	Clostridium_phage	46.8	5.0e-25
WP_021876035.1|1796624_1796858_-	hemolysin XhlA family protein	NA	NA	NA	NA	NA
WP_021876036.1|1796868_1798722_-	SGNH/GDSL hydrolase family protein	NA	A0A0S2SXG8	Bacillus_phage	21.9	8.7e-16
WP_021876037.1|1798723_1799002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021876038.1|1799002_1800436_-|tail	phage tail protein	tail	A0A1B2APX2	Phage_Wrath	44.4	6.8e-85
1799411:1799429	attL	ATTTATATTTTTTTCTATA	NA	NA	NA	NA
WP_079481463.1|1800435_1801140_-	hypothetical protein	NA	A0A1B2APY0	Phage_Wrath	39.2	1.4e-38
WP_021876039.1|1801136_1803896_-|tail	phage tail tape measure protein	tail	A0A0U4IIN6	Exiguobacterium_phage	52.6	3.0e-81
WP_079481464.1|1804209_1804512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021876041.1|1804582_1805140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021876042.1|1805140_1805494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079481465.1|1805494_1805905_-	hypothetical protein	NA	A0A0A7AQU9	Bacillus_phage	40.2	6.6e-09
WP_079481466.1|1805897_1806212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021876045.1|1806208_1806529_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_021876046.1|1806572_1807460_-	hypothetical protein	NA	A0A0A7AQF5	Bacillus_phage	52.7	2.0e-74
WP_021876047.1|1807475_1808069_-	phage scaffolding protein	NA	A0A0A7S0J5	Clostridium_phage	47.4	1.5e-25
WP_021876048.1|1808256_1808532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079481467.1|1808745_1809057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079481468.1|1809049_1810408_-|capsid	minor capsid protein	capsid	H7BWE7	unidentified_phage	33.8	7.5e-25
WP_079481469.1|1810397_1811861_-|portal	phage portal protein	portal	A0A0A7S074	Clostridium_phage	41.0	8.8e-96
WP_079481470.1|1811953_1813264_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	60.0	1.9e-137
WP_079481471.1|1813256_1814030_-	hypothetical protein	NA	A0A1L2BWH4	Clostridium_phage	38.1	7.1e-36
WP_021876054.1|1814069_1814648_-	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	50.8	1.9e-46
WP_021876055.1|1815067_1815706_-|integrase	tyrosine-type recombinase/integrase	integrase	F6K8Q2	Clostridium_phage	40.6	2.6e-28
WP_165489634.1|1815698_1815857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021876056.1|1816094_1816484_-	hypothetical protein	NA	A0A0A7RTL7	Clostridium_phage	40.2	8.5e-22
WP_151901569.1|1816865_1817120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021876059.1|1817082_1817280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021876060.1|1817281_1818586_-	replicative DNA helicase	NA	O80281	Escherichia_phage	41.8	1.0e-79
WP_079481473.1|1819595_1820087_-	transcriptional regulator	NA	A0A2K9V3J3	Faecalibacterium_phage	40.2	3.9e-24
WP_021876063.1|1820266_1820458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021876064.1|1820522_1820696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161493099.1|1820807_1820999_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021876066.1|1821171_1821546_+	helix-turn-helix transcriptional regulator	NA	A0A0A8WJ60	Clostridium_phage	40.8	6.9e-13
1827705:1827723	attR	TATAGAAAAAAATATAAAT	NA	NA	NA	NA
>prophage 6
NZ_LT799839	Clostridium chauvoei JF4335 chromosome I	2887451	2430503	2478615	2887451	coat,integrase,transposase,protease	Clostridium_phage(25.0%)	47	2450152:2450211	2472165:2472324
WP_021876587.1|2430503_2431106_+|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	37.3	2.6e-17
WP_021876588.1|2431163_2432198_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_021876589.1|2432325_2432577_-	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	57.3	3.1e-17
WP_079481632.1|2432660_2433404_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_021876591.1|2433593_2434643_-	stage II sporulation protein D	NA	Q2XU88	Pseudomonas_phage	38.5	1.5e-36
WP_079481633.1|2434817_2436077_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_131431660.1|2436098_2436746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021876594.1|2436938_2437346_-	ATP synthase epsilon chain	NA	NA	NA	NA	NA
WP_021876595.1|2437360_2438749_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_021876596.1|2438764_2439616_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_021876597.1|2439652_2441167_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_021876598.1|2441177_2441717_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_021876599.1|2441719_2442199_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_021876600.1|2442239_2442473_-	ATP synthase F0 subunit C	NA	NA	NA	NA	NA
WP_021876601.1|2442492_2443173_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_079481635.1|2443173_2443536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021876603.1|2444261_2445443_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_021876604.1|2445561_2446713_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAI1	Catovirus	29.2	4.3e-29
WP_021876605.1|2446730_2447225_-	hypothetical protein	NA	A0A2H5BMD7	Streptomyces_phage	38.6	2.6e-15
WP_021876606.1|2447407_2448037_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_021876607.1|2448083_2448533_-	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_079481036.1|2448711_2450151_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
2450152:2450211	attL	TAAATCATAAAATCAAATATTGATTAAGTTTTTGCCTCCGTTACCGAAGGTCTTTTTAGC	NA	NA	NA	NA
WP_021876608.1|2450443_2451487_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	36.3	1.8e-47
WP_079481636.1|2451506_2452094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021876610.1|2452150_2453236_-	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_079481637.1|2453299_2455057_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_079481638.1|2455082_2455670_-	thymidine kinase	NA	A0A249XXF6	Clostridium_phage	51.6	1.0e-50
WP_021876613.1|2455953_2456160_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_021876614.1|2456297_2457407_+	diacylglycerol synthase	NA	NA	NA	NA	NA
WP_021876615.1|2457421_2458816_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_021876616.1|2459197_2460805_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.4	8.6e-153
WP_079481639.1|2460974_2461280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021876618.1|2461416_2461833_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_079481640.1|2461842_2462832_-	DUF814 domain-containing protein	NA	NA	NA	NA	NA
WP_079481641.1|2462912_2463566_-	stage II sporulation protein R	NA	NA	NA	NA	NA
WP_079481642.1|2463627_2464470_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_079481643.1|2464610_2467235_-	cyanophycin synthetase	NA	NA	NA	NA	NA
WP_021876623.1|2467215_2468052_-	cyanophycinase	NA	NA	NA	NA	NA
WP_021876624.1|2468231_2469812_-	DUF3794 domain-containing protein	NA	NA	NA	NA	NA
WP_079481644.1|2470309_2470546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079481036.1|2470724_2472164_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_021876625.1|2472528_2473413_-	sporulation peptidase YabG	NA	NA	NA	NA	NA
2472165:2472324	attR	TAAATCATAAAATCAAATATTGATTAAGTTTTTGCCTCCGTTACCGAAGGTCTTTTTAGCATATTCAATTTTAAAATTTTCTTAGATATTATAAAGATATTTTTAACTATTATTCCAAATTAGCCATAAGCTATTTTTTCATACGAAACTTTACACTATC	NA	NA	NA	NA
WP_021876626.1|2473502_2474504_-|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_021876627.1|2474609_2475731_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_079481875.1|2475781_2476828_-|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_131431664.1|2476820_2477555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021876630.1|2477622_2478615_-|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
