The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT883139	Escherichia coli isolate 6666666.257727.embl plasmid I	118720	4022	67237	118720	holin,transposase	Escherichia_phage(48.0%)	44	NA	NA
WP_000219087.1|4022_5261_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	23.1	2.5e-11
WP_032413363.1|5568_6561_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_040210237.1|6930_8013_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	97.5	7.2e-188
WP_042948535.1|8120_11180_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	95.8	0.0e+00
WP_046654864.1|11231_12485_+	lactose permease	NA	NA	NA	NA	NA
WP_021553367.1|14752_15757_+	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_021553366.1|16240_16930_+	D-galactonate utilization transcriptional regulator DgoR	NA	NA	NA	NA	NA
WP_021553365.1|16926_17805_+	2-dehydro-3-deoxygalactonokinase	NA	NA	NA	NA	NA
WP_021553364.1|17788_18406_+	2-dehydro-3-deoxy-6-phosphogalactonate aldolase	NA	NA	NA	NA	NA
WP_021553363.1|18402_19551_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.6	7.2e-53
WP_001067855.1|20961_21666_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001567968.1|23327_24308_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_000747846.1|24390_24639_-	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_000224043.1|24635_25076_-	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_000164724.1|27527_28130_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	99.5	1.6e-99
WP_000580776.1|28116_28560_-	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_064732969.1|28556_28844_-|holin	holin	holin	Q37876	Escherichia_phage	98.9	5.2e-45
WP_000725192.1|31068_32034_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	100.0	3.3e-168
WP_000817632.1|32030_33236_-	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	100.0	2.0e-226
WP_001076427.1|33635_34496_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
WP_001281116.1|34813_35206_-	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	99.2	2.0e-71
WP_001514466.1|35383_35806_-	hypothetical protein	NA	A0A1B0VCB0	Salmonella_phage	99.3	6.1e-58
WP_001567973.1|35845_36634_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	96.9	1.3e-117
WP_101430417.1|37231_37930_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	2.4e-131
WP_085950818.1|37963_39083_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_000780222.1|39605_39887_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|39867_40197_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_001084041.1|40872_42945_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_000085084.1|42941_44333_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_001196200.1|44409_44991_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	48.3	5.5e-41
WP_000718520.1|45149_48158_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.6	0.0e+00
WP_001300563.1|49224_50337_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_040209999.1|50533_51844_-	MFS transporter	NA	NA	NA	NA	NA
WP_141036419.1|51840_52059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021553356.1|52107_52962_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_021553357.1|53649_54456_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_050576801.1|54489_57258_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_021553359.1|57442_58900_-	DUF560 domain-containing protein	NA	NA	NA	NA	NA
WP_157831661.1|59372_59516_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|59552_60257_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_157831662.1|60262_60529_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	98.6	3.2e-36
WP_016236480.1|62524_63505_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.2e-184
WP_001567986.1|65277_65883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|66232_67237_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_LT883139	Escherichia coli isolate 6666666.257727.embl plasmid I	118720	73051	105297	118720	terminase,integrase,transposase	Escherichia_phage(55.56%)	32	95748:95765	100555:100572
WP_001567997.1|73051_73207_+	hypothetical protein	NA	Q1MVH0	Enterobacteria_phage	98.0	1.2e-19
WP_000484116.1|73708_74335_+	norphogenetic protein	NA	Q1MVG8	Enterobacteria_phage	100.0	2.1e-123
WP_016236873.1|74331_75009_+	metallophosphoesterase	NA	A0A077SLQ6	Escherichia_phage	99.1	8.4e-134
WP_021553345.1|75005_75707_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	97.9	1.1e-141
WP_021553347.1|76008_77271_+	hypothetical protein	NA	Q1MVG4	Enterobacteria_phage	99.8	3.5e-234
WP_000021755.1|77343_77850_+	hypothetical protein	NA	A0A077SK53	Escherichia_phage	98.8	5.4e-93
WP_000149668.1|78114_81231_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	8.3e-27
WP_023157127.1|81353_82565_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_021553349.1|82561_84118_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	1.1e-104
WP_001190712.1|84300_84522_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001694510.1|84521_84902_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	99.2	5.7e-63
WP_000113018.1|84906_85086_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
WP_000648832.1|85113_86157_+	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	98.3	3.1e-204
WP_021553350.1|87088_87298_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	50.0	1.0e-13
WP_024195570.1|88557_88995_-	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_001326849.1|89851_90304_+	late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
WP_000219610.1|90389_91583_+	hypothetical protein	NA	Q5QBP3	Enterobacteria_phage	93.5	4.4e-194
WP_000124150.1|91582_93067_+|terminase	terminase	terminase	Q71T61	Escherichia_phage	100.0	1.5e-292
WP_000611663.1|93091_93943_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
WP_000874156.1|94053_94263_-	hypothetical protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
WP_106417178.1|94434_95433_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	3.0e-180
WP_000019445.1|95657_96638_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
95748:95765	attL	ATTCTGCCATGGCAGAAT	NA	NA	NA	NA
WP_000542336.1|97274_97496_+	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
WP_001568009.1|97503_98535_+|integrase	tyrosine-type recombinase/integrase	integrase	Q71TG5	Escherichia_phage	99.1	3.2e-193
WP_001749391.1|98585_98897_+	hypothetical protein	NA	Q5QBN5	Enterobacteria_phage	100.0	2.1e-47
WP_001568010.1|99144_99705_+	Ref family protein	NA	Q5QBN4	Enterobacteria_phage	100.0	5.9e-101
WP_000019445.1|100464_101445_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
100555:100572	attR	ATTCTGCCATGGCAGAAT	NA	NA	NA	NA
WP_001336562.1|101609_102191_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001143120.1|102211_102439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101430420.1|102476_103718_-	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_001547737.1|103875_104226_+|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	5.2e-39
WP_001254932.1|104145_105297_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 1
NZ_LT883141	Escherichia coli isolate 6666666.257727.embl plasmid III	123705	3573	86114	123705	integrase,transposase	Escherichia_phage(14.29%)	58	2334:2393	57769:58728
2334:2393	attL	ACTGAACCGCCCCGGTAATCCTGGAGACTACACTCTTTGAGAGAGGTAACCAGGATGACA	NA	NA	NA	NA
WP_000227970.1|3573_4650_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_101430429.1|6923_7940_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	98.2	3.9e-183
WP_016156516.1|8122_9145_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000807690.1|10063_10819_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
WP_001201739.1|12335_12719_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	36.3	4.1e-13
WP_000609174.1|12715_13063_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001000406.1|13112_14648_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	88.1	4.8e-262
WP_000093087.1|15201_17397_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_004152291.1|17393_18710_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_029404135.1|18713_21023_-	TerB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_016156514.1|21485_22454_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	1.9e-179
WP_016151347.1|23627_24149_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_004118237.1|24145_25099_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_007898891.1|25185_27510_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_016156513.1|27554_28457_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_016156512.1|28453_29452_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004118246.1|29448_30405_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004152282.1|30405_31173_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_016156511.1|31271_31565_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.9	1.0e-48
WP_004118253.1|31895_32174_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000427623.1|32435_33440_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_007898882.1|33614_34040_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	1.9e-51
WP_007898880.1|34052_35342_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.1	4.4e-168
WP_004206577.1|35386_35707_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	2.9e-20
WP_024241646.1|36847_37930_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	98.3	2.2e-189
WP_016156506.1|38051_41126_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_003846917.1|41177_42431_+	lactose permease	NA	NA	NA	NA	NA
WP_016156502.1|43431_46053_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	23.6	1.1e-16
WP_000533745.1|46738_47101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000654269.1|47118_47928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|48277_49440_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_024144810.1|51655_51922_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001515717.1|52570_53311_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_000200071.1|55227_56238_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	8.8e-87
WP_164712619.1|56563_57774_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	76.4	4.7e-127
WP_000523813.1|58170_59337_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
57769:58728	attR	TGTCATCCTGGTTACCTCTCTCAAAGAGTGTAGTCTCCAGGATTACCGGGGCGGTTCAGTAAGTATCATGCCACAGTCAATATATTACATATCGCAGTCAATTTCATTATAACTGGCTGATCCCGAGCCATCTTAAGCAACCCGACGTACGTGCAATCTGTGAATTCTGTGATTTTCCGCTTCCTCGCCGCTTTCTCACTCCGTGAGATCGCTTACTGCGGCGAGCGGCAGTGATTAATATTGGCTGCGGTATGTACTCTTTTGTACTCCCCTGCGGTCTTTGCATCACCCAATGCGGTTCACTTTGCACTTTTTCGTGCACTTTGCGTCTTTATTGTTGCTTTGCAATAAATTCCAAGATTTAATAAAATAATGCAAAGTGATGATTAAAGGATGTTCAGTATGGGACTCATGGATACACTCAACCAGTGCATAAGTGCTGGTCATGAAATGACGAAAGCAATCGCCATTGCGCAGTTTAATGATGACAGTCCGGAAGCCCGGAAAATAACCCGGCGCTGGAGGATTGGTGAAGCAGCTGATTTAGTTGGCGTGTCATCTCAGGCTATCAGGGATGCCGAGAAAGCTGGCCGGCTGCCTCACCCTGATATGGAAACCCGTGGAAGAGTTGAGCAACGCGTTGGTTATACCATCGAGCAAATCAATCACATGCGGGATGTATTTGGTACACGACTGCGCCGTGCTGAAGATGCGTTTCCGCCGGTGATTGGTGTTGCTGCTCACAAAGGTGGTGTTTACAAAACCTCCGTTTCTGTTCACCTGGCTCAGGACCTGGCCCTGAAAGGATTACGCGTTCTGCTTGTCGAGGGTAATGATCCTCAGGGCACAGCCTCGATGTATCACGGATGGGTGCCCGATCTTCATATACACGCGGAAGATACTCTCCTGCCCTTTTATCTTGGTGAAAAGGATGATGCCAGTTATGCGATAAAACCAACC	NA	NA	NA	NA
WP_016156498.1|59336_60308_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	85.7	1.3e-148
WP_164712619.1|60991_62202_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	76.4	4.7e-127
WP_016156495.1|62726_63032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118488.1|63085_63337_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_029404075.1|63415_64675_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.5	8.5e-148
WP_061872725.1|64710_65415_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	2.6e-138
WP_020806042.1|66154_66364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000990392.1|66400_66820_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	31.4	1.8e-06
WP_000558568.1|66816_67128_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_000718520.1|67357_70366_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.6	0.0e+00
WP_001567981.1|71005_71986_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_016240364.1|72298_72988_-	VIT family protein	NA	NA	NA	NA	NA
WP_011977760.1|73123_73705_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_011977761.1|74142_74517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001198018.1|74628_75582_-	cation transporter	NA	NA	NA	NA	NA
WP_085950818.1|75809_76930_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_000648897.1|78043_78334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000494510.1|81522_82281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000528930.1|82292_82784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096321443.1|83039_83621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096321442.1|83775_84780_+	Abi family protein	NA	NA	NA	NA	NA
WP_077629802.1|85145_86114_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	5.0e-172
>prophage 1
NZ_LT883142	Escherichia coli isolate 6666666.257727.embl chromosome IV	4903991	958004	972807	4903991	integrase	Escherichia_phage(45.45%)	13	949138:949150	974532:974544
949138:949150	attL	GAAAGCTTTTGAG	NA	NA	NA	NA
WP_012602468.1|958004_958766_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|958759_959386_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|959525_960665_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|960727_961720_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|961813_963178_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|963266_964043_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|964047_964686_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|964682_965945_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|965941_966850_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001300386.1|967045_967813_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|967863_968520_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_096321409.1|968625_971193_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_096321408.1|971352_972807_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0R6PHE0	Moraxella_phage	27.8	1.7e-22
974532:974544	attR	GAAAGCTTTTGAG	NA	NA	NA	NA
>prophage 2
NZ_LT883142	Escherichia coli isolate 6666666.257727.embl chromosome IV	4903991	1607560	1617001	4903991		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569357.1|1607560_1608487_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1608491_1609223_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1609203_1609311_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1609370_1610102_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1610323_1612009_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1612005_1612725_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|1612771_1613242_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|1613281_1613743_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_096321194.1|1613867_1615868_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.1	0.0e+00
WP_016243711.1|1615864_1617001_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	98.0	3.8e-163
>prophage 3
NZ_LT883142	Escherichia coli isolate 6666666.257727.embl chromosome IV	4903991	1670981	1770546	4903991	transposase	Stx2-converting_phage(13.33%)	83	NA	NA
WP_085947770.1|1670981_1672351_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_096321245.1|1672431_1672491_+	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_000003154.1|1672711_1673371_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000119090.1|1673367_1674129_+	protein-serine/threonine phosphatase PphC	NA	NA	NA	NA	NA
WP_000856089.1|1674854_1676801_+	protein kinase YegI	NA	NA	NA	NA	NA
WP_096321244.1|1676812_1678165_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.1	7.1e-07
WP_000288420.1|1678298_1679147_+	DNA-3-methyladenine glycosylase 2	NA	NA	NA	NA	NA
WP_000043761.1|1679255_1682573_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_001295424.1|1682890_1683532_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234767.1|1683623_1684205_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_096321243.1|1684226_1686080_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_000454701.1|1686353_1687937_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_000978094.1|1688595_1689735_+	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_000482901.1|1689740_1690184_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000137196.1|1690186_1692349_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000654503.1|1692441_1693281_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_000888740.1|1693283_1693772_+	colanic acid biosynthesis acetyltransferase WcaB	NA	NA	NA	NA	NA
WP_096321242.1|1693768_1694986_+	colanic acid biosynthesis glycosyltransferase WcaC	NA	NA	NA	NA	NA
WP_000107816.1|1694960_1696178_+	putative colanic acid polymerase WcaD	NA	NA	NA	NA	NA
WP_000927049.1|1696188_1696935_+	colanic acid biosynthesis glycosyltransferase WcaE	NA	NA	NA	NA	NA
WP_001153553.1|1696950_1697499_+	colanic acid biosynthesis acetyltransferase WcaF	NA	NA	NA	NA	NA
WP_000048170.1|1697525_1698647_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.7	5.8e-132
WP_000089911.1|1698649_1699615_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	2.2e-87
WP_000479836.1|1699617_1700097_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000699711.1|1700093_1701317_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_016240101.1|1701319_1702756_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	9.7e-47
WP_021553711.1|1702948_1704319_+	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.4	3.4e-33
WP_000183143.1|1704454_1705849_+	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_000058466.1|1705850_1707329_+	colanic acid undecaprenyl disphosphate flippase WzxC	NA	NA	NA	NA	NA
WP_000770812.1|1707604_1708885_+	colanic acid biosynthesis pyruvyl transferase WcaK	NA	NA	NA	NA	NA
WP_000862683.1|1708881_1710102_+	colanic acid biosynthesis glycosyltransferase WcaL	NA	NA	NA	NA	NA
WP_001115991.1|1710112_1711507_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	6.3e-19
WP_000183060.1|1711681_1712575_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000843956.1|1714240_1715410_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000649626.1|1717461_1718214_+	glycosyltransferase family 25 protein	NA	A0A1V0S9H0	Catovirus	25.5	4.8e-05
WP_000017818.1|1718210_1719416_+	O40 family O-antigen polymerase	NA	NA	NA	NA	NA
WP_000691709.1|1719412_1720531_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000487314.1|1720612_1721893_+	O40 family O-antigen flippase	NA	NA	NA	NA	NA
WP_101430440.1|1721955_1723118_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	5.2e-51
WP_096321223.1|1723247_1723718_+	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_001360312.1|1723704_1724037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000043517.1|1724167_1725574_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	27.8	6.8e-37
WP_000526134.1|1725773_1726232_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_000704887.1|1726532_1727699_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	51.9	1.9e-109
WP_000227970.1|1730228_1731305_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001360318.1|1731605_1732397_-	O8 family O-antigen export ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000192839.1|1732398_1733775_-	O9 family phosphomannomutase RfbK2	NA	A0A127AWJ1	Bacillus_phage	26.4	1.1e-31
WP_000926406.1|1733798_1735214_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.9	1.2e-54
WP_000088886.1|1735491_1735776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000526134.1|1736416_1736875_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_001360317.1|1737069_1738047_-	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_101430441.1|1738293_1739310_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	1.4e-185
WP_000227970.1|1739646_1740723_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_050559255.1|1741541_1741703_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	98.1	6.3e-24
WP_001547431.1|1742315_1743854_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_164712619.1|1744105_1745315_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	76.4	4.7e-127
WP_074152845.1|1745374_1745617_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_000954898.1|1745655_1746264_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_000880182.1|1746257_1747034_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_000586449.1|1747015_1747753_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_001103550.1|1747752_1748343_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_000080133.1|1748342_1749410_-	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_001099215.1|1749409_1750480_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_001360321.1|1750476_1751781_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_000131782.1|1751786_1752686_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
WP_001364200.1|1752831_1752882_-	his operon leader peptide	NA	NA	NA	NA	NA
WP_001259255.1|1753165_1753417_+	YoeB-YefM toxin-antitoxin system antitoxin YefM	NA	NA	NA	NA	NA
WP_000767829.1|1753413_1753668_+	type II toxin-antitoxin system mRNA interferase toxin YoeB	NA	NA	NA	NA	NA
WP_000754762.1|1753750_1754575_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000803360.1|1754620_1755550_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010723108.1|1755764_1755827_+	membrane protein YoeI	NA	NA	NA	NA	NA
WP_000019197.1|1755816_1757175_+	putrescine/proton symporter PlaP	NA	NA	NA	NA	NA
WP_000492305.1|1757353_1758412_+	transport protein YeeE	NA	NA	NA	NA	NA
WP_000985273.1|1758425_1758653_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_000980601.1|1758695_1760123_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_000830155.1|1760331_1761498_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.0	6.5e-227
WP_001105412.1|1761616_1762090_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001200891.1|1762288_1763347_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|1763518_1763848_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001667686.1|1763948_1764131_-	ethanolamine utilization - propanediol utilization family protein	NA	NA	NA	NA	NA
WP_072170041.1|1764404_1765187_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.3e-138
WP_000255946.1|1765183_1766206_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_101430442.1|1769010_1770546_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.9	3.1e-261
>prophage 4
NZ_LT883142	Escherichia coli isolate 6666666.257727.embl chromosome IV	4903991	2195589	2288911	4903991	tail,head,terminase,transposase,protease,portal,capsid,integrase,lysis	Escherichia_phage(32.76%)	104	2189105:2189121	2295545:2295561
2189105:2189121	attL	TTTTCGCCGTCATAAAA	NA	NA	NA	NA
WP_000019441.1|2195589_2196570_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
WP_001397330.1|2196680_2197430_+	glucuronide uptake porin UidC	NA	NA	NA	NA	NA
WP_001043342.1|2197474_2198983_-	YdgA family protein	NA	NA	NA	NA	NA
WP_001170683.1|2199083_2200259_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000066628.1|2200457_2202104_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_001099102.1|2202246_2203650_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_000135186.1|2203646_2204576_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000732497.1|2204651_2205953_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	4.2e-17
WP_096321445.1|2205956_2206676_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000524868.1|2206804_2207140_+	GlpM family protein	NA	NA	NA	NA	NA
WP_000520804.1|2207136_2207859_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_000412379.1|2207895_2209278_-	amino acid permease	NA	NA	NA	NA	NA
WP_000769322.1|2209463_2210408_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001300486.1|2210931_2212464_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_096321446.1|2212474_2213863_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_001118241.1|2213887_2214922_-	AI-2 transporter TqsA	NA	NA	NA	NA	NA
WP_000276149.1|2215333_2215699_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000046661.1|2215685_2216015_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_001260865.1|2216053_2216875_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2216974_2217058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743957.1|2217150_2217486_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2217882_2219136_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019525.1|2219242_2220136_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225262.1|2220270_2221491_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2221615_2222311_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2222263_2223556_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2223713_2224328_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526503.1|2224370_2225225_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_096321447.1|2225226_2225844_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	2.8e-75
WP_001340362.1|2225854_2228278_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_085947770.1|2228796_2230165_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001300836.1|2232409_2232715_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2232822_2233533_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2233535_2234096_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2234130_2234472_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2234606_2234933_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2235138_2236353_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836066.1|2236364_2237384_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_021531328.1|2237441_2237552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876979.1|2237571_2238852_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	8.6e-156
WP_000005552.1|2238886_2239138_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_001515375.1|2239210_2241682_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083297.1|2241775_2241967_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2241963_2242152_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001299931.1|2242551_2242716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171952.1|2242719_2242938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096321526.1|2243097_2243253_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_000448564.1|2243419_2243827_-	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000920568.1|2243910_2244141_+	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_096321525.1|2244124_2244604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001151262.1|2245479_2245902_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_001310834.1|2245898_2246255_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_000955178.1|2247561_2247744_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_000589013.1|2247921_2249262_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_096321523.1|2249698_2250031_-	FlxA-like family protein	NA	NA	NA	NA	NA
WP_072134164.1|2250233_2250539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2250563_2250803_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2250802_2251090_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2251161_2251317_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001463433.1|2251533_2251785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001515373.1|2251851_2252130_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	9.7e-12
WP_001515372.1|2252131_2253181_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.7e-112
WP_001204787.1|2253198_2253576_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_000780584.1|2253731_2254256_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_000592549.1|2254448_2255408_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_001146314.1|2255814_2256528_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001515371.1|2256718_2256934_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	95.8	1.3e-32
WP_001515370.1|2256938_2257253_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	97.1	1.6e-50
WP_001515369.1|2257308_2257842_+	lysozyme	NA	Q08J98	Stx2-converting_phage	93.8	1.1e-99
WP_001071769.1|2257838_2258336_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|2258697_2258910_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2258920_2259109_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|2259111_2259177_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|2259255_2259411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000373090.1|2259906_2260317_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|2260374_2260608_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453611.1|2260996_2261542_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001027297.1|2261516_2263442_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
WP_000198149.1|2263438_2263645_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_096321522.1|2263641_2265243_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.6	2.1e-311
WP_000123271.1|2265223_2266543_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	1.0e-231
WP_001299443.1|2266552_2266885_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000063238.1|2266940_2267966_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	4.7e-189
WP_000158875.1|2268007_2268403_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000785282.1|2268414_2268768_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000975081.1|2268779_2269358_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683129.1|2269354_2269750_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_001361512.1|2269757_2270498_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	5.7e-128
WP_000479193.1|2270513_2270936_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_096321521.1|2270917_2271352_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.3e-63
WP_000840337.1|2271344_2273924_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	95.1	0.0e+00
WP_001543782.1|2273920_2274250_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	7.3e-59
WP_001152624.1|2274249_2274948_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	5.6e-133
WP_000194780.1|2274953_2275697_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090891.1|2275633_2276266_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_016242134.1|2276326_2279725_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	87.8	0.0e+00
WP_001230352.1|2279791_2280391_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.3e-109
WP_024195673.1|2280455_2283479_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	81.4	2.1e-67
WP_000885587.1|2283478_2284054_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	2.0e-104
WP_000086527.1|2284151_2284742_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2285058_2285292_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2285360_2285474_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_096321520.1|2286078_2287362_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527780.1|2287450_2288911_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
2295545:2295561	attR	TTTTCGCCGTCATAAAA	NA	NA	NA	NA
>prophage 5
NZ_LT883142	Escherichia coli isolate 6666666.257727.embl chromosome IV	4903991	2572681	2636541	4903991	tail,head,holin,terminase,protease,portal,capsid,integrase	Enterobacteria_phage(69.81%)	77	2592473:2592489	2636728:2636744
WP_000422045.1|2572681_2573731_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559286.1|2573950_2574709_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
WP_001278906.1|2574705_2575296_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291217.1|2575335_2576211_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001300853.1|2576418_2578314_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2578341_2578962_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285663.1|2578958_2579840_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2579977_2580022_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194582.1|2580113_2581676_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763511.1|2581675_2583271_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_000983912.1|2583271_2584633_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000209520.1|2584644_2585838_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443067.1|2585837_2586644_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2587024_2587204_+	general stress protein	NA	NA	NA	NA	NA
WP_096321493.1|2587289_2587790_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079505.1|2587835_2588342_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000737226.1|2588401_2589040_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000028545.1|2589396_2590140_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000808667.1|2590169_2590709_+	septation protein A	NA	NA	NA	NA	NA
WP_000108160.1|2590813_2591212_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_096321506.1|2591251_2591971_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000967595.1|2592194_2592491_+	YciI family protein	NA	NA	NA	NA	NA
2592473:2592489	attL	ATTTAAGAAAGTGTTCT	NA	NA	NA	NA
WP_000639140.1|2592609_2593158_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	100.0	2.7e-98
WP_096321492.1|2593213_2593567_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	41.0	4.5e-14
WP_101430449.1|2593964_2594399_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	53.8	6.5e-39
WP_001228569.1|2595315_2595549_-	hypothetical protein	NA	E4WL42	Enterobacteria_phage	100.0	2.3e-38
WP_096321133.1|2595660_2596335_-	hypothetical protein	NA	K7P7N1	Enterobacteria_phage	99.6	6.0e-124
WP_096321132.1|2596638_2600094_-	host specificity protein J	NA	K7PKR4	Enterobacteria_phage	97.1	0.0e+00
WP_061351296.1|2600145_2600736_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	94.9	5.3e-100
WP_061351295.1|2600720_2601455_-	C40 family peptidase	NA	K7P7M8	Enterobacteria_phage	96.3	3.6e-146
WP_061351294.1|2601456_2602212_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	97.2	1.5e-144
WP_025759358.1|2602208_2602556_-|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	99.1	7.0e-60
WP_096321131.1|2602561_2605078_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	90.1	0.0e+00
WP_000761928.1|2605055_2605376_-|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	100.0	2.1e-55
WP_000479021.1|2605384_2605807_-|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	100.0	6.7e-57
WP_000235019.1|2605843_2606581_-|tail	phage tail protein	tail	K7PGX1	Enterobacteria_phage	100.0	5.5e-131
WP_000682752.1|2606588_2606987_-|tail	tail protein	tail	K7PJT1	Enterobacteria_phage	100.0	1.0e-70
WP_000023111.1|2606983_2607538_-|tail	phage tail protein	tail	K7PKQ5	Enterobacteria_phage	100.0	1.8e-81
WP_000753023.1|2607547_2607901_-|head,tail	head-tail joining protein	head,tail	K7PHD8	Enterobacteria_phage	100.0	1.7e-61
WP_016240130.1|2607911_2608337_-	DNA-packaging protein FI	NA	K7PM13	Enterobacteria_phage	95.7	4.7e-42
WP_000118198.1|2608382_2609408_-|capsid	major capsid protein	capsid	K7PGW9	Enterobacteria_phage	100.0	9.2e-193
WP_001018610.1|2609475_2609808_-|head	head decoration protein	head	E4WL24	Enterobacteria_phage	100.0	9.0e-57
WP_000929808.1|2609817_2611161_-	S49 family peptidase	NA	K7PKQ1	Enterobacteria_phage	100.0	7.1e-217
WP_000701346.1|2611141_2612734_-|portal	phage portal protein	portal	K7PHD3	Enterobacteria_phage	100.0	1.0e-310
WP_000235410.1|2612730_2612937_-	gpW family protein	NA	K7PM10	Enterobacteria_phage	100.0	4.5e-30
WP_096321130.1|2612936_2614859_-|terminase	phage terminase large subunit family protein	terminase	K7PGW7	Enterobacteria_phage	99.7	0.0e+00
WP_000453626.1|2614833_2615379_-|terminase	terminase small subunit	terminase	K7PJS9	Enterobacteria_phage	100.0	1.1e-94
WP_000066210.1|2615624_2616353_-	hypothetical protein	NA	M9NZE9	Enterobacteria_phage	98.3	4.1e-118
WP_001446080.1|2616527_2616758_-	hypothetical protein	NA	Q38201	Enterobacteria_phage	98.7	1.0e-38
WP_001446081.1|2616756_2617353_+	hypothetical protein	NA	M9NZJ1	Enterobacteria_phage	100.0	9.7e-110
WP_171866413.1|2617475_2617619_-	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	91.5	1.5e-16
WP_077249777.1|2617832_2618399_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	32.5	4.5e-08
WP_032315006.1|2618332_2618875_-	lysozyme	NA	K7PM52	Enterobacteria_phage	97.2	1.3e-100
WP_016066213.1|2618852_2619131_-|holin	holin	holin	K7PGZ9	Enterobacteria_phage	100.0	6.0e-46
WP_073464673.1|2619635_2620451_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	97.0	1.0e-141
WP_001568781.1|2620447_2620588_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	95.7	1.2e-18
WP_096321129.1|2620584_2621193_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	63.5	1.4e-47
WP_096321128.1|2621195_2621402_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	70.6	1.2e-22
WP_096321127.1|2621401_2622004_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	92.0	2.8e-104
WP_039022275.1|2622355_2622613_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	72.4	3.5e-24
WP_039022276.1|2622612_2622795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039022277.1|2622950_2623292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039022278.1|2624242_2624554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039022279.1|2624572_2625322_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	86.7	9.6e-123
WP_061360102.1|2625324_2626272_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	33.3	1.4e-25
WP_096321126.1|2626439_2626979_-	regulator	NA	K7PJT7	Enterobacteria_phage	83.8	8.0e-79
WP_016156233.1|2627010_2627241_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	54.1	4.1e-16
WP_016247091.1|2627370_2628054_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	72.2	8.3e-89
WP_016247090.1|2628098_2628461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016247087.1|2629555_2629825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016247086.1|2629805_2630099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568763.1|2630278_2630485_+	hypothetical protein	NA	K7PM31	Enterobacteria_phage	100.0	1.5e-33
WP_096321125.1|2630496_2630658_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	98.1	8.3e-24
WP_095085418.1|2630797_2633707_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	K7PJT5	Enterobacteria_phage	99.7	0.0e+00
WP_000432226.1|2633718_2634831_+	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	100.0	3.9e-205
WP_001237029.1|2634869_2635112_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	100.0	4.0e-38
WP_000627155.1|2635347_2636541_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	100.0	1.3e-235
2636728:2636744	attR	ATTTAAGAAAGTGTTCT	NA	NA	NA	NA
>prophage 6
NZ_LT883142	Escherichia coli isolate 6666666.257727.embl chromosome IV	4903991	3006129	3092509	4903991	tRNA,tail,head,terminase,transposase,protease,portal,capsid,integrase,plate,lysis	Salmonella_phage(56.67%)	91	2999091:2999106	3095080:3095095
2999091:2999106	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000886683.1|3006129_3007422_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|3007512_3008856_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3008866_3009478_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_096321225.1|3009632_3013739_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3013873_3014368_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3014912_3015878_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043621.1|3016000_3017767_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_096321224.1|3017767_3019489_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	2.9e-21
WP_001241678.1|3019530_3020235_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3020519_3020738_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934040.1|3021537_3023814_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	2.5e-166
WP_000520781.1|3023844_3024165_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3024487_3024712_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188180.1|3024784_3026731_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746460.1|3026727_3027843_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001355621.1|3027993_3028950_+	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_000599806.1|3028946_3030605_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|3031030_3031726_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|3032220_3033120_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458809.1|3033263_3034916_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_096321141.1|3034927_3035896_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_096321140.1|3036028_3037747_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	1.8e-31
WP_000566372.1|3037783_3038785_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136559.1|3038795_3040226_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|3040324_3041338_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255167.1|3041334_3042165_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|3042161_3042485_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270734.1|3042610_3043126_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3043343_3044072_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|3044089_3044821_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|3044827_3045544_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3045543_3046212_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|3046502_3047234_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149740.1|3047432_3048560_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
WP_000389260.1|3048600_3049089_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061665.1|3049148_3049994_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105444.1|3049990_3050944_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996005.1|3050953_3052087_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126069.1|3052181_3053294_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3053644_3054121_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_096321139.1|3054208_3055111_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.9	6.7e-38
WP_000189162.1|3055171_3055894_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|3055877_3056165_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195225.1|3056324_3056582_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	3.0e-23
WP_000681108.1|3056611_3056989_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001024876.1|3057258_3058944_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|3059179_3059398_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_040090188.1|3059488_3060589_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	6.5e-176
WP_001471299.1|3060585_3061071_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	1.1e-66
WP_096321138.1|3061067_3064145_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.9	0.0e+00
WP_000763311.1|3064137_3064257_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|3064271_3064574_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_021548681.1|3064628_3065144_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	3.7e-89
WP_096321137.1|3065153_3066326_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.8	9.2e-205
WP_021548679.1|3066477_3067035_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	85.7	3.1e-86
WP_096321136.1|3067065_3067563_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	69.5	3.0e-56
WP_096321135.1|3067562_3068165_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	92.3	1.1e-97
WP_001548002.1|3068136_3068580_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	57.1	4.4e-43
WP_001086833.1|3070005_3070611_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	4.4e-110
WP_096321164.1|3070603_3071512_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.1e-141
WP_096321163.1|3071498_3071858_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.7	3.6e-51
WP_096321162.1|3071854_3072433_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	5.5e-94
WP_000829141.1|3072501_3072948_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.5e-62
WP_001039935.1|3072940_3073372_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	6.4e-71
WP_001337513.1|3073467_3073896_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	2.9e-47
WP_096321161.1|3073892_3074270_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	3.3e-15
WP_033817172.1|3074271_3074784_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.7	9.0e-88
WP_000171568.1|3074764_3074980_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868192.1|3074983_3075187_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	6.8e-31
WP_000673516.1|3075186_3075651_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	8.4e-77
WP_000059191.1|3075746_3076397_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_096321160.1|3076400_3077459_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	92.6	1.7e-181
WP_096321159.1|3077475_3078309_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	86.3	1.8e-122
WP_042049988.1|3078451_3080218_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	98.3	0.0e+00
WP_001573372.1|3080217_3081249_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	94.2	5.3e-188
WP_000019445.1|3081501_3082482_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_000756244.1|3083384_3084068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217570.1|3084163_3084397_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	93.5	1.3e-33
WP_001154434.1|3084407_3084596_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_096321455.1|3084747_3087162_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.5	0.0e+00
WP_096321456.1|3087158_3088016_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.5	5.4e-162
WP_096321457.1|3088012_3088315_-	DUF3850 domain-containing protein	NA	A0A0A8WI22	Clostridium_phage	42.1	9.8e-10
WP_000752620.1|3088311_3088539_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_001244214.1|3088538_3088772_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	2.4e-32
WP_000996713.1|3088839_3089181_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	91.2	2.6e-51
WP_096321458.1|3089298_3089595_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.4e-21
WP_096321459.1|3089602_3090112_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_096321460.1|3090144_3090366_-	regulator	NA	NA	NA	NA	NA
WP_021515785.1|3090491_3091061_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.9	2.2e-39
WP_001513672.1|3091076_3091268_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001703808.1|3091456_3092509_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.6	3.2e-108
3095080:3095095	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 7
NZ_LT883142	Escherichia coli isolate 6666666.257727.embl chromosome IV	4903991	3670076	3727800	4903991	transposase,plate,integrase	Enterobacteria_phage(52.94%)	51	3675832:3675847	3705424:3705439
WP_096321279.1|3670076_3672275_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	2.5e-38
WP_040091001.1|3672284_3673241_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_038989145.1|3673219_3673630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032221362.1|3674239_3676573_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
3675832:3675847	attL	GCCGGGCAAGGCTGGC	NA	NA	NA	NA
WP_000856729.1|3676587_3676908_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459297.1|3677043_3677499_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_001244665.1|3677491_3677779_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_032221358.1|3677771_3678326_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	79.3	4.4e-40
WP_001149160.1|3678322_3678589_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283018.1|3679141_3679876_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	99.2	3.6e-130
WP_000984201.1|3679872_3680118_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	100.0	1.8e-41
WP_096321278.1|3680904_3682527_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	24.7	2.8e-10
WP_032221356.1|3682523_3684224_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001580016.1|3684224_3685400_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.7	2.5e-141
WP_000893278.1|3685752_3687006_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_001285288.1|3687017_3688121_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|3688408_3689464_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174677.1|3689502_3689904_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189541.1|3689961_3691206_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|3691297_3691756_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293003.1|3692016_3693474_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_096321277.1|3693999_3694266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059847.1|3694499_3694952_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_096321276.1|3694961_3695360_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|3695362_3695656_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226164.1|3695707_3696763_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207587.1|3696833_3697619_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_016246871.1|3697563_3699303_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_096321275.1|3699566_3700016_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_015675129.1|3700191_3700965_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.3e-20
WP_000729704.1|3701150_3701411_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615976.1|3701413_3701692_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|3701847_3702588_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333379.1|3702558_3703326_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|3703531_3704110_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973083.1|3704349_3706794_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
3705424:3705439	attR	GCCGGGCAAGGCTGGC	NA	NA	NA	NA
WP_000532698.1|3706836_3707310_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118040.1|3707463_3708234_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_001419315.1|3710586_3711096_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032164960.1|3711164_3715394_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	4.4e-23
WP_000103355.1|3715469_3717611_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.8e-25
WP_001142958.1|3717820_3718339_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037395.1|3719034_3719535_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|3719569_3719794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056978.1|3719844_3721320_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611742.1|3721326_3721740_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|3721743_3723594_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_096321453.1|3723557_3724640_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113713.1|3724664_3725945_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3725941_3726466_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246443.1|3726468_3727800_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 8
NZ_LT883142	Escherichia coli isolate 6666666.257727.embl chromosome IV	4903991	4446529	4541614	4903991	tRNA,tail,head,holin,terminase,protease,portal,capsid,plate,integrase	Salmonella_phage(73.33%)	97	4456107:4456141	4550499:4550533
WP_000187022.1|4446529_4447630_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000806411.1|4447669_4448029_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_001309117.1|4448028_4448679_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_001120800.1|4449009_4450410_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_001025939.1|4450392_4451310_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_001230087.1|4451576_4452950_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_001302318.1|4453010_4453787_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_000935370.1|4453794_4454799_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_001298964.1|4454952_4456104_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
4456107:4456141	attL	CGTAGGCCGGATAAGGCGCTCGCGCCGCATCCGGC	NA	NA	NA	NA
WP_001005579.1|4456701_4459353_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_000556295.1|4459534_4461268_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000274624.1|4461482_4462334_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000323846.1|4462320_4462662_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000204135.1|4462663_4463542_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_000184830.1|4463507_4465805_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|4465855_4466176_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001004454.1|4466190_4467270_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001185138.1|4467578_4470080_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_000424841.1|4470091_4470754_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	4.2e-29
WP_000374004.1|4470764_4471868_+	bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_000647891.1|4472142_4472760_+	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_001271262.1|4472786_4473692_-	cystine transporter YijE	NA	NA	NA	NA	NA
WP_001300600.1|4473785_4475966_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_000007523.1|4476294_4477185_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_000110772.1|4477533_4479966_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_096321538.1|4479968_4481129_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000852812.1|4481405_4481723_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_000797341.1|4481906_4482515_+	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001323627.1|4483421_4483745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101430455.1|4483746_4485888_-	DUF4329 domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	32.7	1.9e-14
WP_000710769.1|4486047_4486260_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_096321143.1|4486462_4488661_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_000644904.1|4488816_4489842_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_000068828.1|4489933_4490893_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000208242.1|4490985_4491516_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293341.1|4491525_4492857_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|4492923_4493850_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|4493942_4494428_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|4494512_4494758_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|4495182_4496028_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_096321144.1|4496050_4497559_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250644.1|4497693_4498704_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796332.1|4498800_4499547_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323556.1|4499551_4499980_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655986.1|4500006_4500306_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155257.1|4500517_4500958_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802226.1|4501058_4501658_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216325.1|4501765_4502533_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000708998.1|4502587_4503343_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_032279227.1|4503449_4504439_-	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000591795.1|4504758_4505721_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001076748.1|4505901_4506804_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_001251454.1|4507052_4507295_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_044597460.1|4507343_4508462_-	phage late control D family protein	NA	A0A0M4REC6	Salmonella_phage	99.2	1.5e-191
WP_000224788.1|4508619_4509813_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0M4S6M1	Salmonella_phage	94.2	7.7e-215
WP_001207578.1|4509825_4510341_+|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	98.8	4.2e-93
WP_000047593.1|4510355_4510691_+	hypothetical protein	NA	A0A0M4RCV2	Salmonella_phage	99.1	3.0e-52
WP_000763325.1|4510699_4510816_+|tail	GpE family phage tail protein	tail	A0A0M3ULA8	Salmonella_phage	97.4	4.3e-14
WP_000775062.1|4510816_4513744_+|tail	phage tail tape measure protein	tail	A0A0M4R2V3	Salmonella_phage	91.5	0.0e+00
WP_000979934.1|4513754_4514204_+|tail	phage tail protein	tail	A0A1J0I2L5	Salmonella_phage	98.7	3.9e-79
WP_096321145.1|4514310_4514892_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	80.5	1.2e-80
WP_032265401.1|4515595_4516006_+|tail	tail fiber assembly protein	tail	U5P0S4	Shigella_phage	78.9	2.5e-24
WP_101430456.1|4515977_4516421_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	58.8	1.5e-43
WP_000063889.1|4517398_4518013_-|tail	phage tail protein I	tail	A0A1J0I2I4	Salmonella_phage	99.0	3.4e-110
WP_000017070.1|4518005_4518917_-|plate	baseplate assembly protein	plate	A0A0M4REB7	Salmonella_phage	98.0	2.4e-160
WP_000108898.1|4518913_4519276_-	GPW/gp25 family protein	NA	A0A0M4S6L5	Salmonella_phage	100.0	5.0e-61
WP_001052319.1|4519272_4519902_-|plate	phage baseplate assembly protein V	plate	A0A0M3ULA5	Salmonella_phage	97.6	5.4e-111
WP_001337857.1|4520059_4520704_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	98.1	1.2e-116
WP_000917105.1|4520664_4521159_-|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	98.0	8.7e-80
WP_001373667.1|4521158_4521692_-	DUF2514 family protein	NA	A0A0M4S5V1	Salmonella_phage	94.8	5.7e-45
WP_023309713.1|4521793_4522234_-	lysozyme	NA	A0A0M5M782	Salmonella_phage	96.6	8.8e-76
WP_000543937.1|4522217_4522553_-|holin	phage holin, lambda family	holin	A0A0M3ULH4	Salmonella_phage	98.2	2.1e-53
WP_001102549.1|4522563_4522764_-|tail	tail protein X	tail	A0A0M4RTN6	Salmonella_phage	100.0	1.8e-31
WP_016246752.1|4522763_4523252_-|head	head completion/stabilization protein	head	A0A0M4QWR7	Salmonella_phage	97.5	5.2e-85
WP_044597455.1|4523354_4524203_-|terminase	terminase	terminase	A0A0M4R523	Salmonella_phage	97.5	1.4e-133
WP_096321284.1|4524245_4525292_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	98.6	1.6e-195
WP_096321295.1|4525332_4526178_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	97.5	7.0e-154
WP_001090183.1|4526331_4528044_+|terminase	terminase	terminase	A0A0M4S6K7	Salmonella_phage	98.4	0.0e+00
WP_000014576.1|4528044_4529094_+|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	100.0	6.7e-207
WP_064106679.1|4529489_4530128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052929074.1|4530131_4531130_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_096321285.1|4531288_4533643_-	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	86.9	0.0e+00
WP_048275531.1|4533642_4533948_-	DUF4406 domain-containing protein	NA	A0A1I9KFD3	Aeromonas_phage	67.8	1.8e-27
WP_089617476.1|4533947_4534919_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	81.7	9.5e-139
WP_069899228.1|4534920_4535133_-	hypothetical protein	NA	A0A0M4R514	Salmonella_phage	94.3	1.9e-31
WP_000946669.1|4535175_4535358_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000482341.1|4535357_4535792_-	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	91.0	5.1e-68
WP_096321286.1|4535886_4536117_-	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	77.3	5.5e-29
WP_000290619.1|4536106_4536313_-	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	100.0	4.3e-33
WP_054628203.1|4536323_4536527_-	hypothetical protein	NA	A0A0M3ULI0	Salmonella_phage	95.5	4.8e-29
WP_000130011.1|4536537_4536819_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	98.9	5.3e-50
WP_000343126.1|4536909_4537149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000229411.1|4537348_4537669_+	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	98.1	1.3e-52
WP_096321287.1|4537738_4538719_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	97.9	1.5e-184
WP_001354478.1|4538895_4539396_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_001033722.1|4539545_4540244_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580424.1|4540240_4541614_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	26.2	3.8e-16
4550499:4550533	attR	GCCGGATGCGGCGCGAGCGCCTTATCCGGCCTACG	NA	NA	NA	NA
