The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT906438	Bacillus pumilus strain NCTC10337 chromosome 1	3855667	22154	30872	3855667	tRNA	uncultured_Mediterranean_phage(16.67%)	8	NA	NA
WP_003218092.1|22154_23429_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.6	1.8e-97
WP_003218096.1|23531_24362_+	chemotaxis sensory transducer	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.1	3.5e-09
WP_003218104.1|24672_25332_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	33.2	1.1e-21
WP_003218080.1|25328_25952_-	deoxynucleoside kinase	NA	S5MMC6	Bacillus_phage	28.9	9.1e-18
WP_003218116.1|26031_27333_-	glycoside hydrolase family 18 protein	NA	A0A2P1CIG4	Microbacterium_phage	34.8	1.4e-07
WP_003218117.1|27378_27933_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_003218102.1|28012_28489_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003218100.1|29159_30872_+	DNA polymerase III subunit gamma/tau	NA	D9ZNI9	Clostridium_phage	34.9	2.3e-55
>prophage 2
NZ_LT906438	Bacillus pumilus strain NCTC10337 chromosome 1	3855667	649338	659233	3855667		Synechococcus_phage(50.0%)	9	NA	NA
WP_003213884.1|649338_650634_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	26.9	6.5e-18
WP_095117757.1|650706_651429_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	43.2	2.0e-45
WP_003214349.1|651421_651676_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FKD5	Synechococcus_phage	33.3	1.2e-05
WP_003214213.1|651672_652356_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_095117760.1|652339_654571_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.7	1.9e-158
WP_003213939.1|654546_655977_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	1.3e-51
WP_034620207.1|656072_657113_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	43.8	9.7e-65
WP_003214278.1|657109_657679_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.9	1.2e-29
WP_003214148.1|657694_659233_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.8	2.8e-76
>prophage 3
NZ_LT906438	Bacillus pumilus strain NCTC10337 chromosome 1	3855667	1706165	1712426	3855667		Bacillus_phage(83.33%)	6	NA	NA
WP_008360380.1|1706165_1706558_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	S5MA49	Bacillus_phage	54.2	6.1e-28
WP_003212060.1|1706517_1708620_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	82.8	0.0e+00
WP_003212452.1|1708637_1709618_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4JMU8	Bacillus_phage	80.5	1.4e-150
WP_003211636.1|1709702_1710320_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	44.8	5.1e-45
WP_003211781.1|1710387_1711146_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N6W8I1	Bacillus_phage	54.9	1.3e-47
WP_095117798.1|1711466_1712426_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	39.6	5.1e-52
>prophage 4
NZ_LT906438	Bacillus pumilus strain NCTC10337 chromosome 1	3855667	2095554	2101938	3855667		Staphylococcus_phage(50.0%)	10	NA	NA
WP_003215903.1|2095554_2096706_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	37.3	2.7e-23
WP_003215803.1|2096818_2097298_-	YpuI family protein	NA	NA	NA	NA	NA
WP_003215643.1|2097411_2098005_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.0	9.0e-15
WP_003216080.1|2097994_2098753_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	39.2	1.3e-10
WP_012010430.1|2098961_2099054_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003216132.1|2099141_2099666_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003215830.1|2099690_2100044_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003215561.1|2100157_2100622_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	65.3	7.9e-43
WP_003216067.1|2100649_2101276_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	56.3	1.0e-53
WP_095117834.1|2101287_2101938_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	40.1	1.4e-40
>prophage 5
NZ_LT906438	Bacillus pumilus strain NCTC10337 chromosome 1	3855667	2373099	2424618	3855667	protease,capsid,plate,head,integrase,terminase,portal,tail,holin,tRNA	Bacillus_phage(41.94%)	65	2371093:2371131	2412777:2412815
2371093:2371131	attL	TTGAAGAATCGTTTGAATTTTTGTCACCATTAAGTCAAT	NA	NA	NA	NA
WP_003216765.1|2373099_2373291_+	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	80.6	3.2e-22
WP_003216594.1|2373464_2373932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003216237.1|2374093_2374915_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	66.1	5.2e-61
WP_003216679.1|2374961_2375381_-|holin	holin family protein	holin	D6R405	Bacillus_phage	75.0	6.3e-47
WP_003216807.1|2375425_2375605_-	XkdX family protein	NA	NA	NA	NA	NA
WP_003216383.1|2375601_2375886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003216353.1|2375900_2377562_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	45.0	7.5e-51
WP_003216705.1|2377574_2380130_-	peptidase G2	NA	D6R401	Bacillus_phage	49.0	6.2e-230
WP_003216768.1|2380168_2381926_-|tail	phage tail protein	tail	D6R400	Bacillus_phage	69.3	1.1e-220
WP_003216562.1|2381937_2382774_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	64.6	1.3e-99
WP_003216387.1|2382774_2387208_-|tail	phage tail tape measure protein	tail	A0A2H4JA91	uncultured_Caudovirales_phage	51.9	1.3e-78
WP_003216783.1|2387414_2387759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003216480.1|2387815_2388430_-|tail	tail protein	tail	J7KKC8	Streptococcus_phage	38.2	3.3e-12
WP_003216298.1|2388432_2388831_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_003216823.1|2388827_2389232_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_003216322.1|2389231_2389552_-|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	34.3	2.7e-10
WP_003216495.1|2389541_2389844_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	45.1	1.4e-11
WP_003216566.1|2389856_2390264_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	54.5	6.1e-15
WP_003216735.1|2390287_2391583_-|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	46.7	7.5e-91
WP_003216716.1|2391622_2392246_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	72.2	1.6e-78
WP_003216200.1|2392208_2393489_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	60.7	3.4e-144
WP_003216556.1|2393493_2393673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034620640.1|2393672_2395364_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	61.1	3.9e-204
WP_003216465.1|2395378_2395894_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	42.2	1.1e-29
WP_034620643.1|2396121_2396487_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	50.8	3.3e-28
WP_034620567.1|2396476_2396833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003216536.1|2396891_2397515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003216707.1|2397679_2398069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003216755.1|2398068_2398407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155114468.1|2398438_2398606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003216373.1|2398615_2399428_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_003216827.1|2399739_2400831_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_003216618.1|2400972_2401515_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	60.0	2.8e-55
WP_003216791.1|2401511_2401961_-	DUF1492 domain-containing protein	NA	S6AVV9	Thermus_phage	50.7	2.6e-35
WP_003216268.1|2402188_2402794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003216655.1|2402847_2403255_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	44.0	1.4e-14
WP_003216673.1|2403275_2403734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003216524.1|2403753_2404737_-	DNA (cytosine-5-)-methyltransferase	NA	A0A2I7SDI7	Paenibacillus_phage	40.9	6.6e-63
WP_003216686.1|2404733_2404982_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	77.8	5.0e-28
WP_003216213.1|2404978_2405230_-	hypothetical protein	NA	A0A2H4JCD8	uncultured_Caudovirales_phage	77.1	4.6e-29
WP_003216388.1|2405263_2405473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003216505.1|2405539_2405710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155114469.1|2405723_2405858_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_003216670.1|2405966_2406494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003216234.1|2406490_2406646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034620571.1|2406754_2407576_-	ATP-binding protein	NA	A0A0U3U1U1	Bacillus_phage	40.4	5.3e-50
WP_003216567.1|2407559_2408420_-	phage replisome organizer N-terminal domain-containing protein	NA	V5UQV4	Oenococcus_phage	37.9	4.2e-45
WP_003216681.1|2408500_2408677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003216657.1|2408726_2409044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003216339.1|2409084_2409288_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003216602.1|2409463_2409862_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003216375.1|2410205_2411303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003216214.1|2411580_2412672_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	37.8	2.6e-60
WP_003216283.1|2412767_2413394_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.2	1.3e-32
2412777:2412815	attR	TTGAAGAATCGTTTGAATTTTTGTCACCATTAAGTCAAT	NA	NA	NA	NA
WP_003216809.1|2413401_2414670_-	U32 family peptidase	NA	Q6DW11	Phage_TP	31.3	1.5e-38
WP_003216182.1|2414690_2415620_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_003216230.1|2415616_2416282_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_003216614.1|2416492_2417575_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_003216841.1|2417648_2418737_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_003216368.1|2418724_2420188_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	24.2	7.6e-23
WP_003216511.1|2420184_2420751_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_003216483.1|2420905_2421190_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_003216519.1|2421205_2421622_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_034620648.1|2421625_2421892_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_003216457.1|2421981_2424618_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	35.0	3.0e-70
>prophage 6
NZ_LT906438	Bacillus pumilus strain NCTC10337 chromosome 1	3855667	2456974	2508495	3855667	coat,tRNA,protease	Moraxella_phage(28.57%)	52	NA	NA
WP_003216540.1|2456974_2458120_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	43.5	2.1e-84
WP_003216830.1|2458151_2459180_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003216361.1|2459214_2459415_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_050943663.1|2459407_2460412_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	31.0	1.1e-07
WP_003216534.1|2460423_2461029_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003216805.1|2461177_2461690_-	intercompartmental signaling factor BofC	NA	NA	NA	NA	NA
WP_003216487.1|2461916_2462561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034620653.1|2462794_2462974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003216600.1|2463167_2463314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003216710.1|2463349_2465110_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_003216651.1|2465583_2466216_+	LysE family transporter	NA	NA	NA	NA	NA
WP_003216228.1|2466264_2466882_-	spore cortex protein	NA	NA	NA	NA	NA
WP_003216558.1|2467205_2468483_-|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_003216441.1|2468614_2469724_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_003216390.1|2469710_2470574_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_003216776.1|2470555_2472130_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_034620583.1|2472215_2473367_+	IscS subfamily cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	27.0	8.6e-30
WP_003216377.1|2473370_2473913_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_003216746.1|2473937_2474816_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003216269.1|2474834_2475278_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_003216191.1|2475333_2476620_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_003216825.1|2476650_2477235_-	sporulation protein	NA	NA	NA	NA	NA
WP_003216586.1|2477489_2477774_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003216478.1|2477786_2478125_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003216781.1|2478139_2478448_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_034620586.1|2478599_2479469_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003216570.1|2479461_2480253_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_003216504.1|2480365_2481169_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_003216790.1|2481171_2481855_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003216271.1|2481909_2482428_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003216396.1|2482424_2483324_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003216532.1|2483351_2484371_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_034620589.1|2484461_2485136_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_003216355.1|2485184_2485754_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_034620656.1|2485931_2486945_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_003216484.1|2487119_2487839_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_003216210.1|2487986_2489291_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_003216328.1|2489356_2491999_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	41.3	7.7e-159
WP_003216497.1|2492455_2492644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003216429.1|2492678_2493710_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_003216314.1|2493747_2494998_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003216796.1|2495321_2496614_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_003216644.1|2496641_2497613_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_003216187.1|2497609_2498401_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003216588.1|2498397_2499333_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003216469.1|2499374_2500205_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_003216303.1|2500212_2501580_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003216801.1|2501822_2502308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003216344.1|2502351_2502939_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003216539.1|2502935_2505260_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.6	2.0e-179
WP_003216675.1|2505431_2507093_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	36.8	1.0e-15
WP_003216176.1|2507229_2508495_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	64.4	3.5e-149
>prophage 7
NZ_LT906438	Bacillus pumilus strain NCTC10337 chromosome 1	3855667	2748491	2864552	3855667	protease,capsid,plate,integrase,terminase,portal,tail,holin	Bacillus_phage(24.62%)	141	2840347:2840362	2866758:2866773
WP_003217754.1|2748491_2748896_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_003217712.1|2749052_2749244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003217576.1|2749369_2749807_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	66.2	2.8e-50
WP_003217544.1|2749938_2750085_+	YtzI protein	NA	NA	NA	NA	NA
WP_003217735.1|2750093_2750528_-	FixH family protein	NA	NA	NA	NA	NA
WP_003217624.1|2750642_2751116_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_003217666.1|2751242_2751467_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	70.3	1.6e-25
WP_003217750.1|2751468_2752035_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_003217657.1|2752249_2753239_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003217579.1|2753315_2753558_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_003217550.1|2753734_2755066_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003217630.1|2755081_2756134_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_008360682.1|2756202_2756361_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_003217708.1|2756386_2756578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003217663.1|2756684_2757809_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_003217578.1|2757795_2759256_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	35.7	1.5e-82
WP_003217719.1|2759327_2760146_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_034620863.1|2760160_2760985_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_003217756.1|2760969_2762712_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_003217738.1|2762704_2764123_-	isochorismate synthase MenF	NA	NA	NA	NA	NA
WP_003217744.1|2764505_2765444_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_003217716.1|2765561_2766296_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_034620862.1|2766382_2766859_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_003213462.1|2774860_2775436_+	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_003213495.1|2775528_2775717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003212763.1|2775676_2776231_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003212948.1|2776400_2777036_+	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_003212840.1|2777050_2778205_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_080550306.1|2778210_2779344_+	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
WP_003213366.1|2779496_2781044_-	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	28.4	9.5e-08
WP_034620073.1|2781055_2781586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003213650.1|2781790_2782270_+	DinB family protein	NA	NA	NA	NA	NA
WP_003213555.1|2782310_2783519_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_003212701.1|2783546_2785016_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003213048.1|2785223_2785781_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_155114458.1|2786169_2787303_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	49.1	4.9e-94
WP_034620074.1|2787570_2787759_+	hypothetical protein	NA	A0A2H4J4T3	uncultured_Caudovirales_phage	85.5	2.2e-23
WP_003213287.1|2787840_2788602_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_003213762.1|2788683_2789532_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_003213606.1|2789745_2790447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003213595.1|2790443_2790881_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_003213024.1|2791710_2792529_-	M15 family metallopeptidase	NA	A0A2H4J4U2	uncultured_Caudovirales_phage	92.3	4.7e-115
WP_003213008.1|2792587_2792851_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	80.5	2.3e-31
WP_034620157.1|2792863_2793076_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	56.5	1.0e-13
WP_080550307.1|2793137_2793278_-	XkdX family protein	NA	NA	NA	NA	NA
WP_003213700.1|2793277_2793652_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	40.9	5.5e-10
WP_003213507.1|2793656_2794784_-	hypothetical protein	NA	A0A2H4J4R1	uncultured_Caudovirales_phage	52.9	5.5e-29
WP_003213653.1|2794801_2795185_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_003213457.1|2795197_2796121_-	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	28.4	1.6e-10
WP_003212987.1|2796107_2797154_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	42.9	1.1e-68
WP_003213190.1|2797146_2797575_-	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	32.5	1.1e-11
WP_003212795.1|2797574_2797856_-	DUF2577 family protein	NA	S6C459	Thermus_phage	40.4	5.9e-09
WP_003212996.1|2797852_2798947_-	hypothetical protein	NA	H7BV96	unidentified_phage	27.8	5.9e-36
WP_003212722.1|2798958_2799621_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2SUI2	Clostridium_phage	31.1	2.5e-26
WP_034620075.1|2799613_2804590_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	42.8	1.6e-43
WP_095117862.1|2804593_2804740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003212620.1|2804769_2805219_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	32.6	9.2e-12
WP_106918392.1|2805371_2805461_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_003212705.1|2805773_2806217_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	47.2	7.6e-27
WP_003213180.1|2806218_2807565_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7S087	Clostridium_phage	41.4	2.1e-83
WP_003213528.1|2807567_2807792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003213063.1|2807772_2808234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003212650.1|2808238_2808745_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	48.8	9.6e-42
WP_003213352.1|2808741_2809098_-	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_003212914.1|2809094_2809487_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_003213658.1|2809492_2809879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003213479.1|2809884_2810814_-|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	65.5	5.4e-107
WP_003213717.1|2810837_2811788_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	53.2	1.5e-56
WP_003213629.1|2811789_2812665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003212626.1|2812686_2813619_-	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	37.6	2.6e-45
WP_095117864.1|2813615_2815145_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	52.1	3.4e-143
WP_162013622.1|2815141_2816446_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	63.2	1.1e-153
WP_003213256.1|2816457_2817342_-	hypothetical protein	NA	D2IZ90	Enterococcus_phage	37.6	6.6e-30
WP_003213237.1|2817788_2818034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003213427.1|2818173_2819451_-	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	41.7	3.7e-82
WP_003213013.1|2819503_2819968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003213026.1|2820035_2820380_-	hypothetical protein	NA	Q38579	Bacillus_phage	53.5	1.1e-25
WP_003213735.1|2820470_2820647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155114461.1|2821111_2822134_-	amidinotransferase	NA	NA	NA	NA	NA
WP_003213675.1|2822273_2822657_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	54.8	4.3e-26
WP_003213504.1|2822731_2822953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003213285.1|2822949_2823360_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	40.4	2.7e-10
WP_034620078.1|2823482_2823755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080550308.1|2823794_2823995_-	hypothetical protein	NA	A0A2H4JDM6	uncultured_Caudovirales_phage	86.4	1.3e-23
WP_003213088.1|2824063_2824423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003212740.1|2824650_2824851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003212733.1|2825058_2825283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003212680.1|2825315_2825522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003213324.1|2825595_2825877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003213506.1|2826164_2826863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003212902.1|2826881_2827373_-	hypothetical protein	NA	A0A0C5AFC9	Paenibacillus_phage	53.5	1.1e-37
WP_034620081.1|2827369_2827609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003213171.1|2827605_2827806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003213119.1|2827820_2829113_-	replicative DNA helicase	NA	D2XR44	Bacillus_phage	44.9	8.6e-95
WP_003213660.1|2829084_2829372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003212616.1|2829377_2830190_-	hypothetical protein	NA	A0A2P1JTY8	Anoxybacillus_phage	52.0	4.3e-36
WP_003213248.1|2830391_2831096_-	MBL fold metallo-hydrolase	NA	A0A1L2JY21	Aeribacillus_phage	67.9	2.2e-89
WP_003212883.1|2831092_2832013_-	recombinase RecT	NA	D7RWF9	Brochothrix_phage	63.7	5.9e-90
WP_003213418.1|2832005_2832251_-	hypothetical protein	NA	A0A142F1S1	Bacillus_phage	35.1	2.4e-06
WP_003213022.1|2832247_2834230_-	AAA family ATPase	NA	A0A1L2K2K3	Aeribacillus_phage	42.7	8.7e-131
WP_003213591.1|2834331_2834550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003213455.1|2834546_2834741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003212625.1|2834923_2835100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034620083.1|2835100_2835376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003213344.1|2835378_2835630_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003213103.1|2835732_2835930_-	helix-turn-helix domain-containing protein	NA	U5P0W4	Brevibacillus_phage	50.8	1.9e-09
WP_003213298.1|2835984_2836224_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003213755.1|2836345_2836765_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003213355.1|2836783_2837434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003213204.1|2837511_2838006_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_003213100.1|2837998_2839282_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	47.0	1.4e-105
WP_003213006.1|2839597_2840659_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5S7K9	Streptococcus_phage	23.8	1.2e-06
2840347:2840362	attL	CTTAAGTAACTACGGA	NA	NA	NA	NA
WP_003212822.1|2840695_2841484_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_034620084.1|2841611_2841815_+	helix-turn-helix transcriptional regulator	NA	A0A0A0RMC4	Bacillus_phage	38.7	5.2e-07
WP_003212702.1|2841839_2842088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034620085.1|2842133_2842478_+	YolD-like family protein	NA	O64030	Bacillus_phage	32.3	2.5e-09
WP_034620086.1|2842493_2843045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034620087.1|2843137_2843377_-|holin	phage holin	holin	A0A1D6Z272	Staphylococcus_phage	51.5	1.8e-11
WP_003212823.1|2843373_2844213_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	65.2	7.3e-63
WP_003213691.1|2844234_2844501_-	hemolysin XhlA family protein	NA	D2J075	Enterococcus_phage	41.0	4.0e-07
WP_003213019.1|2844531_2844693_-	XkdX family protein	NA	E2ELK1	Clostridium_phage	53.7	3.9e-05
WP_003212998.1|2844692_2844980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003212778.1|2844991_2846431_-|plate	phage baseplate upper protein	plate	M4ZRP1	Bacillus_phage	53.2	7.2e-50
WP_003212731.1|2846445_2848326_-	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K1Y5U2	Streptomyces_phage	32.3	7.7e-36
WP_003213720.1|2848338_2849730_-|tail	phage tail protein	tail	A6M966	Geobacillus_virus	32.0	1.2e-38
WP_003213566.1|2849741_2851169_-|tail	phage tail family protein	tail	A0A0B5CTY7	Listeria_phage	36.4	3.3e-39
WP_003213388.1|2851184_2853971_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	41.9	1.7e-92
WP_003213152.1|2854307_2854691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003212975.1|2854747_2855290_-	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	62.1	9.6e-56
WP_034620088.1|2855332_2855707_-	hypothetical protein	NA	A0A0N7GFE5	Paenibacillus_phage	37.1	3.2e-18
WP_003213235.1|2855706_2856117_-	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	50.0	2.0e-29
WP_003212696.1|2856113_2856452_-	hypothetical protein	NA	A0A2H4J6J5	uncultured_Caudovirales_phage	35.4	1.9e-09
WP_003212887.1|2856452_2856839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003213702.1|2857063_2857348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003212730.1|2857397_2858501_-	DUF5309 family protein	NA	A0A2I7S650	Vibrio_phage	26.7	2.4e-29
WP_113755074.1|2858512_2859178_-|protease	Clp protease ClpB	protease	A0A2H4IZP8	uncultured_Caudovirales_phage	45.5	2.4e-16
WP_003213404.1|2859259_2860090_-	type IV secretion protein Rhs	NA	A0A0N9SJR1	Paenibacillus_phage	51.6	3.5e-73
WP_003213158.1|2860089_2861691_-|portal	phage portal protein	portal	A0A2H4J180	uncultured_Caudovirales_phage	58.0	3.8e-169
WP_003213159.1|2861694_2862120_-	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	47.9	2.5e-27
WP_003212832.1|2862137_2863904_-|terminase	phage terminase large subunit	terminase	A0A142F1L6	Bacillus_phage	44.0	4.1e-132
WP_003213737.1|2864006_2864552_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	43.6	4.2e-27
2866758:2866773	attR	TCCGTAGTTACTTAAG	NA	NA	NA	NA
>prophage 8
NZ_LT906438	Bacillus pumilus strain NCTC10337 chromosome 1	3855667	2868688	2890996	3855667		Bacillus_phage(59.09%)	31	NA	NA
WP_003213262.1|2868688_2869498_-	hypothetical protein	NA	A0A0N9S810	Paenibacillus_phage	55.7	3.0e-69
WP_003213448.1|2869539_2870028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003212850.1|2870168_2870552_-	DUF134 domain-containing protein	NA	A0A0N9RZI0	Paenibacillus_phage	42.1	1.6e-12
WP_050782673.1|2870551_2871226_-	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	49.7	1.3e-46
WP_034620092.1|2871378_2871753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034620093.1|2871731_2872292_-	hypothetical protein	NA	A0A076G817	Bacillus_phage	33.7	3.6e-21
WP_034620094.1|2872288_2873146_-	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	48.0	2.2e-22
WP_003212888.1|2873311_2873824_-	3D domain-containing protein	NA	A0A127AW72	Bacillus_phage	45.9	4.0e-11
WP_034620166.1|2873823_2874597_-	FAD-dependent thymidylate synthase	NA	A0A142F1S2	Bacillus_phage	68.2	3.6e-88
WP_003212610.1|2875086_2875623_-	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	54.2	2.5e-40
WP_003213251.1|2876074_2876245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034620095.1|2876341_2877094_-	hypothetical protein	NA	A0A2I6UHL5	Bacillus_phage	49.2	1.5e-62
WP_003213156.1|2877068_2878058_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4JMU8	Bacillus_phage	77.7	2.0e-144
WP_003212938.1|2878337_2879135_-	site-specific DNA-methyltransferase	NA	W8EBG5	Geobacillus_phage	55.1	9.7e-73
WP_003213364.1|2880697_2881429_-	GIY-YIG nuclease family protein	NA	A0A024FSJ1	Bacillus_phage	58.1	3.2e-70
WP_003212619.1|2881579_2882368_-	ribonucleotide-diphosphate reductase subunit alpha	NA	R4JDX9	Bacillus_phage	80.2	1.3e-117
WP_003212769.1|2882357_2883119_-	site-specific DNA-methyltransferase	NA	W8EBG5	Geobacillus_phage	57.4	3.5e-80
WP_034620096.1|2883123_2883483_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	50.4	2.5e-28
WP_003213052.1|2883479_2883644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003213391.1|2883640_2883814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003212947.1|2883810_2883978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003213649.1|2883974_2884178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034620097.1|2884180_2884534_-	hypothetical protein	NA	A0A218KDD8	Bacillus_phage	37.1	3.3e-09
WP_003213277.1|2884526_2884790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003212848.1|2884795_2885314_-	hypothetical protein	NA	A0A109ZVT6	Bacillus_phage	31.7	9.0e-11
WP_003212712.1|2885314_2885875_-	hypothetical protein	NA	A0A0N9ST03	Paenibacillus_phage	50.0	5.0e-07
WP_034620098.1|2885871_2886069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003213253.1|2886068_2887118_-	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	51.3	5.2e-74
WP_155114462.1|2887118_2887838_-	3'-5' exonuclease	NA	U5PXE0	Bacillus_virus	41.1	2.4e-30
WP_155114463.1|2887840_2890069_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	47.7	1.1e-166
WP_003213488.1|2890252_2890996_-	hypothetical protein	NA	A0A142F1R1	Bacillus_phage	31.3	1.5e-11
>prophage 9
NZ_LT906438	Bacillus pumilus strain NCTC10337 chromosome 1	3855667	2894390	2930912	3855667	capsid,plate,terminase,portal,tail,holin	Bacillus_phage(33.33%)	55	NA	NA
WP_003213560.1|2894390_2895557_-	hypothetical protein	NA	A0A0U3TNF6	Bacillus_phage	29.9	4.0e-43
WP_080550300.1|2895931_2896174_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003213747.1|2896170_2897172_-	toprim domain-containing protein	NA	A0A2H4J6E6	uncultured_Caudovirales_phage	43.3	6.9e-60
WP_003213339.1|2897294_2898686_-	DNA helicase	NA	A0A2H4IZL9	uncultured_Caudovirales_phage	48.4	1.2e-113
WP_003212876.1|2898682_2899315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003213054.1|2899315_2900077_-	ATP-binding protein	NA	A0A0N7GFF0	Paenibacillus_phage	56.3	7.6e-75
WP_003212744.1|2900066_2900264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003212830.1|2900361_2900574_-	hypothetical protein	NA	U5Q038	Bacillus_phage	64.7	2.4e-18
WP_003213621.1|2900570_2901395_-	hypothetical protein	NA	R4JEY6	Bacillus_phage	52.5	2.7e-33
WP_003212754.1|2901396_2901759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050782668.1|2901771_2901969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003213512.1|2901968_2902310_-	hypothetical protein	NA	R4JGJ3	Bacillus_phage	44.7	1.8e-15
WP_003213069.1|2902306_2902534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034620101.1|2902557_2902893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003213150.1|2902882_2903107_-	hypothetical protein	NA	A0A0A0RMF3	Bacillus_phage	32.8	4.1e-05
WP_034620103.1|2903495_2903912_-	transcriptional regulator	NA	A0A142F1P0	Bacillus_phage	56.9	1.8e-33
WP_003212805.1|2904290_2904479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003213521.1|2904593_2905397_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	67.3	6.6e-61
WP_003212734.1|2905416_2905680_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	70.1	5.9e-27
WP_003213245.1|2905691_2905904_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	53.6	6.6e-13
WP_034620175.1|2905940_2906081_-	XkdX family protein	NA	NA	NA	NA	NA
WP_095117866.1|2906575_2907706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003212881.1|2907713_2907887_-	hypothetical protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	46.9	3.4e-07
WP_003213655.1|2907883_2908213_-|portal	phage portal protein	portal	A0A2H4JCI0	uncultured_Caudovirales_phage	33.7	1.5e-08
WP_003213185.1|2908222_2909101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003212666.1|2909115_2909499_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_003212799.1|2909510_2910434_-	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	29.2	9.4e-11
WP_003212924.1|2910417_2911467_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.2	1.1e-68
WP_003213065.1|2911459_2911882_-	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_003212971.1|2911896_2912163_-	DUF2577 family protein	NA	S6C459	Thermus_phage	37.5	2.1e-08
WP_003213128.1|2912159_2913170_-	hypothetical protein	NA	H7BV96	unidentified_phage	29.0	7.8e-35
WP_003213616.1|2913181_2913850_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2SUI2	Clostridium_phage	30.1	5.9e-23
WP_050782674.1|2913842_2917904_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	41.9	1.6e-41
WP_088002055.1|2917958_2918096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003213341.1|2918137_2918578_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	36.8	1.7e-10
WP_106918392.1|2918730_2918820_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_003213309.1|2919108_2919552_-|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	46.5	7.6e-27
WP_003212878.1|2919553_2920900_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7S087	Clostridium_phage	41.0	2.1e-80
WP_003212736.1|2920903_2921116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003212659.1|2921102_2921558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003212615.1|2921562_2922060_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	46.2	1.6e-36
WP_003212773.1|2922056_2922413_-	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_003213486.1|2922409_2922793_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_095117868.1|2922806_2923730_-|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	63.9	1.3e-108
WP_003212716.1|2923752_2924841_-	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	40.9	2.3e-61
WP_003212960.1|2924879_2926337_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	51.6	9.3e-138
WP_162013623.1|2926333_2927635_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	61.1	7.2e-150
WP_003213198.1|2927643_2928288_-	helix-turn-helix domain-containing protein	NA	A0A2P1JTW4	Anoxybacillus_phage	44.3	1.4e-42
WP_003213659.1|2928441_2928960_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J6J3	uncultured_Caudovirales_phage	47.5	3.6e-36
WP_003212874.1|2929088_2929295_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	66.7	2.2e-13
WP_003212720.1|2929291_2929693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003213683.1|2929743_2929974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003213636.1|2929963_2930116_-	hypothetical protein	NA	A0A2H4J4L6	uncultured_Caudovirales_phage	52.8	8.1e-05
WP_003213361.1|2930112_2930376_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003213241.1|2930534_2930912_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	44.5	6.1e-17
>prophage 10
NZ_LT906438	Bacillus pumilus strain NCTC10337 chromosome 1	3855667	3227473	3245991	3855667		Streptococcus_phage(25.0%)	19	NA	NA
WP_034620139.1|3227473_3229063_-	ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	36.3	3.8e-68
WP_003213609.1|3229524_3230694_-	UDP-glucosyltransferase	NA	A0A2H4ZK81	Cryptophlebia_leucotreta_granulosis_virus	23.6	1.5e-08
WP_003212622.1|3230955_3231420_-	DinB family protein	NA	NA	NA	NA	NA
WP_034620141.1|3231915_3232221_-	TM2 domain-containing protein	NA	A0A127AZ85	Bacillus_phage	41.1	4.8e-12
WP_003212962.1|3232449_3233046_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.9	2.0e-54
WP_034620142.1|3233105_3233684_-	TIGR00730 family Rossman fold protein	NA	A0A1V0S9E9	Catovirus	29.2	1.4e-12
WP_003213115.1|3233820_3234150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003213243.1|3234178_3235801_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.6	2.8e-42
WP_003213318.1|3235838_3236420_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_003213741.1|3236973_3237951_+	D-glycerate dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	25.6	1.1e-22
WP_003212642.1|3238135_3238624_+	ribonuclease	NA	NA	NA	NA	NA
WP_003213548.1|3238674_3239418_-	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_003212821.1|3239457_3239715_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_003213321.1|3239741_3240692_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	37.5	1.6e-50
WP_003213226.1|3240709_3241669_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	40.1	9.3e-62
WP_034620188.1|3241669_3242557_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	26.3	4.3e-05
WP_003213484.1|3242596_3243061_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_034620189.1|3243418_3244369_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.1	4.1e-86
WP_003213684.1|3244602_3245991_-	C40 family peptidase	NA	A0A0A0RVE6	Bacillus_phage	53.4	4.1e-26
>prophage 11
NZ_LT906438	Bacillus pumilus strain NCTC10337 chromosome 1	3855667	3502898	3551793	3855667	coat,protease,transposase	Escherichia_phage(28.57%)	56	NA	NA
WP_003214576.1|3502898_3503561_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003214939.1|3503668_3503854_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_155114466.1|3504032_3504194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003215273.1|3504564_3505377_-	peptidase M84	NA	NA	NA	NA	NA
WP_034620269.1|3505750_3507079_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003214906.1|3507117_3508002_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003214640.1|3508152_3508704_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_003215315.1|3508687_3509713_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003215313.1|3509712_3509967_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_003215102.1|3509993_3510557_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003215084.1|3510570_3511332_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003215163.1|3511349_3512192_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003214542.1|3512208_3512919_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003215167.1|3512915_3513659_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.8	1.3e-31
WP_003215119.1|3513751_3514252_-	YwgA family protein	NA	NA	NA	NA	NA
WP_003214648.1|3514282_3515584_-	HD domain-containing protein	NA	A0A1V0SGM3	Hokovirus	30.3	1.6e-24
WP_003215259.1|3515754_3515976_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_003214842.1|3516214_3517015_+	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_003214547.1|3517049_3517283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003214890.1|3517279_3519547_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_003215006.1|3519665_3520151_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_034620271.1|3520179_3521025_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_003215187.1|3521192_3521585_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_003215094.1|3521747_3522191_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_003214934.1|3522190_3523978_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003215416.1|3523989_3524268_-	YwqI/YxiC family protein	NA	NA	NA	NA	NA
WP_003215158.1|3524260_3524671_-	DUF5082 family protein	NA	NA	NA	NA	NA
WP_003215032.1|3524846_3525113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003214816.1|3525126_3526461_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_003215347.1|3526506_3527382_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_080550323.1|3527393_3528065_-	RraA family protein	NA	NA	NA	NA	NA
WP_003214860.1|3528218_3529070_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003215086.1|3529203_3530175_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003215092.1|3530415_3531186_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_003214871.1|3531253_3532414_+	MFS transporter	NA	NA	NA	NA	NA
WP_003214594.1|3532427_3532907_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003215228.1|3533052_3534285_+	MFS transporter	NA	NA	NA	NA	NA
WP_003215386.1|3534434_3535037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003214795.1|3535038_3535746_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003215234.1|3535742_3536504_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.2	6.7e-23
WP_003214966.1|3536519_3537941_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_050782682.1|3537956_3539153_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003215189.1|3539167_3539965_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003215275.1|3540061_3540517_-	dTDP-4-dehydrorhamnose 3,5-epimerase family protein	NA	NA	NA	NA	NA
WP_003214612.1|3540509_3541364_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	9.5e-34
WP_003214650.1|3541367_3542333_-	dTDP-glucose 4,6-dehydratase	NA	K7QJG5	Escherichia_phage	46.2	6.0e-77
WP_003214929.1|3542329_3543070_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	40.7	1.0e-44
WP_003215183.1|3543072_3544101_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_003215406.1|3544097_3544838_-	glycosyltransferase family protein	NA	NA	NA	NA	NA
WP_003215000.1|3544827_3545952_-|coat	spore coat protein	coat	A0A1B1IVE2	uncultured_Mediterranean_phage	28.6	1.4e-21
WP_003215248.1|3545953_3546829_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_095117909.1|3546825_3548004_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_003214910.1|3548025_3549438_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_169901773.1|3549444_3550215_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003214621.1|3550390_3551065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003215192.1|3551250_3551793_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
