The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT906454	Streptococcus acidominimus strain NCTC11291 chromosome 1	2330811	12981	94864	2330811	transposase,tRNA,integrase	Streptococcus_phage(19.05%)	55	26221:26241	91022:91042
WP_095121201.1|12981_14253_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	R4TVK3	Phaeocystis_globosa_virus	28.2	7.8e-16
WP_017769763.1|14265_14808_+	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	27.9	1.5e-05
WP_095121202.1|14832_16794_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	H8ZJI5	Ostreococcus_tauri_virus	48.8	6.7e-107
WP_095121204.1|17282_18146_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
26221:26241	attL	CTTAGCTCAGTTGGTAGAGCA	NA	NA	NA	NA
WP_095121206.1|27522_28770_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	56.1	1.8e-126
WP_157737793.1|29444_29630_-	hypothetical protein	NA	A0A1S5SBP9	Streptococcus_phage	53.4	1.5e-08
WP_095121208.1|30032_31460_+	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_017770453.1|31585_32548_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	36.2	4.8e-42
WP_095121210.1|33641_34817_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_017770760.1|34806_35562_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_095121212.1|35673_36678_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_095121214.1|36670_36913_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_095121217.1|37309_38017_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D8KNF0	Synechococcus_phage	41.3	1.0e-41
WP_095121219.1|38034_41754_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	26.1	5.1e-39
WP_095121224.1|41767_43219_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	3.4e-55
WP_172843134.1|43282_44302_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	41.9	6.4e-61
WP_095121230.1|44461_45010_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.8	6.3e-23
WP_095121233.1|45257_46805_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.3	4.8e-76
WP_095121236.1|47078_48698_-	SH3 domain-containing protein	NA	M1PKZ3	Streptococcus_phage	30.3	2.6e-08
WP_095121239.1|48916_50095_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_095121242.1|50534_51797_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_095121246.1|51928_52417_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.7	1.1e-18
WP_095121249.1|52403_53477_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_017770745.1|53485_53725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017770743.1|54572_55865_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.1	7.2e-17
WP_095121251.1|55965_56874_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_095121255.1|58326_59173_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	23.3	9.9e-07
WP_095121258.1|59547_59970_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017770740.1|59987_60389_+	membrane protein	NA	NA	NA	NA	NA
WP_095121260.1|60385_62167_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	27.2	9.0e-18
WP_017770737.1|63074_63431_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017770736.1|63423_64251_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	2.9e-11
WP_017770735.1|64253_64919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095121264.1|65371_67984_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_095121266.1|68573_69506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095121270.1|69702_71199_+	threonine synthase	NA	NA	NA	NA	NA
WP_095121273.1|71200_71737_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_095121275.1|71848_73318_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	73.6	1.1e-199
WP_095121277.1|77735_79085_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_095121280.1|79352_80624_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_095121283.1|80782_81289_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095121287.1|81333_82164_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_095121291.1|82187_83639_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_095121295.1|84033_84897_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095121297.1|84901_86128_-	MFS transporter	NA	NA	NA	NA	NA
WP_095121299.1|86295_87084_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_095121302.1|88323_88530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095121304.1|88591_89113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017769240.1|89297_89615_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_095121306.1|89601_89985_+	antitoxin	NA	NA	NA	NA	NA
WP_095121312.1|90377_90869_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	38.0	4.5e-20
WP_095121316.1|91329_92598_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	46.1	3.0e-92
91022:91042	attR	TGCTCTACCAACTGAGCTAAG	NA	NA	NA	NA
WP_017769609.1|92590_93085_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017769608.1|93182_93653_+	DUF3013 family protein	NA	NA	NA	NA	NA
WP_157737894.1|93898_94864_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_LT906454	Streptococcus acidominimus strain NCTC11291 chromosome 1	2330811	159086	166633	2330811		Erysipelothrix_phage(16.67%)	6	NA	NA
WP_017770601.1|159086_160850_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.6	7.7e-30
WP_017770602.1|161447_162437_+	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	27.1	4.1e-12
WP_095121435.1|162506_163121_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	2.5e-12
WP_095121438.1|163333_164401_+	purine/pyrimidine permease	NA	H9YQ34	environmental_Halophage	32.8	2.2e-11
WP_095121440.1|164476_165037_+	cysteine hydrolase	NA	A0A1V0SL12	Klosneuvirus	28.2	1.0e-07
WP_095121444.1|165313_166633_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	35.5	1.7e-61
>prophage 3
NZ_LT906454	Streptococcus acidominimus strain NCTC11291 chromosome 1	2330811	201718	267918	2330811	transposase,tRNA	Leptospira_phage(28.57%)	52	NA	NA
WP_095121492.1|201718_202468_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_095121494.1|202457_203225_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_095121496.1|203211_203682_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_095121498.1|203725_204289_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_017770646.1|204445_205654_-	MFS transporter	NA	NA	NA	NA	NA
WP_095121500.1|205964_206801_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_017770648.1|206974_208258_+	trigger factor	NA	NA	NA	NA	NA
WP_095121502.1|208666_209671_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_095121504.1|209876_211067_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_095121506.1|211076_212462_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_095121508.1|212550_212910_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_017769876.1|212893_213697_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_095121510.1|213711_214824_+	Jag N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_017769874.1|215402_215849_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_037564142.1|215864_216260_+	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_000831903.1|216360_216495_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_095121512.1|216560_217910_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_095121514.1|218221_219226_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	33.1	2.4e-07
WP_095121516.1|219375_220110_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_095121518.1|220145_221432_+	amino acid permease	NA	NA	NA	NA	NA
WP_095121521.1|221651_227843_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_095121524.1|228235_229012_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_172843135.1|229192_229759_+	ribonuclease M5	NA	NA	NA	NA	NA
WP_095121530.1|229761_230208_+	HIT family protein	NA	NA	NA	NA	NA
WP_095121532.1|230226_231117_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_095121535.1|231745_232240_-	VIT1/CCC1 transporter family protein	NA	NA	NA	NA	NA
WP_017769862.1|233194_234043_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_095121537.1|234857_235730_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_095121539.1|235736_236399_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_095121541.1|236391_237024_+	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_095121543.1|237039_238332_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_095121545.1|238303_239242_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_017769856.1|239408_240221_+	pur operon repressor	NA	NA	NA	NA	NA
WP_095121547.1|240357_243099_+	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_001142328.1|246710_247124_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_017768901.1|247144_247615_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_017768900.1|247843_249922_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.6	6.1e-58
WP_095121550.1|249990_250944_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.5	3.9e-36
WP_017768899.1|251380_252394_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_037563601.1|252870_253419_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_037563596.1|253545_254223_+	VIT family protein	NA	NA	NA	NA	NA
WP_095121552.1|256244_256700_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095121554.1|256966_258163_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_095121556.1|259057_260062_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_095121558.1|260424_261271_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	23.7	1.9e-05
WP_095121560.1|261401_262598_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_017769411.1|262738_263260_+	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_095121562.1|263412_263799_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	34.1	1.9e-05
WP_095121564.1|263828_265175_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_095121566.1|265214_265613_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_095121568.1|265528_266376_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	23.5	3.2e-05
WP_095121570.1|266813_267918_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	50.2	4.8e-70
>prophage 4
NZ_LT906454	Streptococcus acidominimus strain NCTC11291 chromosome 1	2330811	272462	340552	2330811	holin,transposase,tRNA,integrase	Lactobacillus_phage(15.79%)	60	276056:276071	341434:341449
WP_095121581.1|272462_273152_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_100244367.1|273111_273570_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_095121583.1|273675_274683_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.5	1.4e-60
WP_095121586.1|274763_275462_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_017770327.1|275451_275775_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_095121588.1|275818_276844_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
276056:276071	attL	ATCTCTGCTGAGACAG	NA	NA	NA	NA
WP_017770329.1|276978_277248_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_095121591.1|277339_278512_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	53.5	4.7e-15
WP_017770331.1|278646_279189_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017770332.1|279236_279824_+	3'-5' exonuclease	NA	A0A0A8WJ41	Clostridium_phage	27.3	2.3e-10
WP_017770333.1|280813_281113_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_095121594.1|281479_283141_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_095121596.1|283344_285627_-	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_095121599.1|285744_286596_+	aquaporin family protein	NA	NA	NA	NA	NA
WP_095121601.1|287652_288402_+	peptidase	NA	NA	NA	NA	NA
WP_095121603.1|288407_289343_+	serine hydrolase	NA	NA	NA	NA	NA
WP_172843168.1|289530_291849_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	32.4	4.0e-111
WP_095121605.1|292082_293177_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_095121607.1|293821_296320_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	28.3	1.4e-53
WP_095121609.1|296402_296996_-	signal peptidase I	NA	NA	NA	NA	NA
WP_095121612.1|297009_297921_-	ribonuclease HIII	NA	NA	NA	NA	NA
WP_095121614.1|298179_298968_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_017770347.1|299366_300620_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	50.2	5.1e-60
WP_095121616.1|300636_301242_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	55.4	8.2e-56
WP_017770349.1|301423_301783_+	YbaN family protein	NA	NA	NA	NA	NA
WP_095121618.1|301948_302398_+	dUTP diphosphatase	NA	A5GYP0	Lactococcus_phage	51.7	4.7e-32
WP_095121620.1|302413_303775_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_095123686.1|303838_304588_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	A0A2D1A6G0	Rhodococcus_phage	24.1	1.1e-06
WP_095121622.1|304607_305126_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_095121623.1|305201_306062_+	DegV family protein	NA	NA	NA	NA	NA
WP_017769586.1|306233_306680_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_017769585.1|306706_307099_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_095121625.1|307226_308381_-|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	30.9	1.8e-43
WP_095121627.1|308450_309017_-	helix-turn-helix domain-containing protein	NA	A0A1S5PRT4	Streptococcus_phage	50.8	4.5e-08
WP_095121629.1|309333_309612_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_029690773.1|309617_309947_+	replication initiator protein A	NA	Q9MCM7	Streptococcus_virus	28.9	2.1e-05
WP_095121631.1|309949_310603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095121633.1|310926_311774_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	23.6	5.8e-07
WP_095121635.1|312724_313159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095121637.1|314903_315377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095121639.1|315675_316011_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_017769573.1|316000_316288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095123687.1|317033_317282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095121641.1|317591_319136_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	44.2	4.0e-107
WP_172843136.1|319137_320346_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.8	5.5e-11
WP_172843137.1|320350_320887_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_095121643.1|320905_322000_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_095121645.1|321996_325092_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_095121651.1|327148_327995_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	23.9	1.5e-07
WP_017770005.1|328352_329615_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_095121654.1|329813_330905_+	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_029690786.1|331005_331584_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_017770002.1|331799_333410_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	45.6	5.1e-137
WP_095121656.1|333567_335328_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	29.8	1.8e-63
WP_017770000.1|335324_336053_+	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017769999.1|336190_336640_+|holin	antiholin-like murein hydrolase modulator LrgA	holin	NA	NA	NA	NA
WP_095121658.1|336658_337366_+|holin	antiholin-like protein LrgB	holin	NA	NA	NA	NA
WP_095121660.1|337422_338340_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_095121662.1|338698_339580_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_095121664.1|340039_340552_-|integrase	site-specific integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	39.1	1.4e-27
341434:341449	attR	ATCTCTGCTGAGACAG	NA	NA	NA	NA
>prophage 5
NZ_LT906454	Streptococcus acidominimus strain NCTC11291 chromosome 1	2330811	362990	414095	2330811	transposase	Planktothrix_phage(27.27%)	41	NA	NA
WP_095121687.1|362990_363854_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_095121688.1|364114_366088_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_095121690.1|366153_367653_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_095121692.1|367652_368579_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_095121694.1|368587_369637_+	ABC transporter ATP-binding protein	NA	A0A2R8FFL6	Cedratvirus	24.7	5.5e-07
WP_095121696.1|369651_370581_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.9	3.1e-22
WP_095121698.1|370888_372550_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017769008.1|372664_373579_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_095121700.1|373589_374621_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017769010.1|374635_375682_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	2.8e-19
WP_017769011.1|375681_376614_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.9	2.2e-23
WP_095121550.1|378220_379174_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	38.1	2.8e-42
WP_017770045.1|379584_379875_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_095121702.1|379886_380372_+	single-stranded DNA-binding protein	NA	A0A286QNX2	Streptococcus_phage	74.7	1.5e-60
WP_000068665.1|380407_380647_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_095121704.1|382158_383163_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_095121706.1|383854_384526_-	DUF1129 family protein	NA	NA	NA	NA	NA
WP_017768819.1|384617_385562_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_095121708.1|385883_388706_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.8	0.0e+00
WP_017768817.1|388973_390053_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_095121710.1|390158_391223_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_095121712.1|391232_391682_+	competence protein ComE	NA	F8WPT6	Bacillus_phage	55.1	6.5e-34
WP_017768814.1|391920_392481_+	elongation factor P	NA	NA	NA	NA	NA
WP_017768813.1|392552_392948_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_029691148.1|392934_393372_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_095121714.1|394150_395440_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_095121716.1|395621_396587_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_095121718.1|396588_398028_-	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.8	8.6e-19
WP_095121720.1|398230_400144_+	PTS sugar transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_095121722.1|400284_401175_+	ROK family protein	NA	NA	NA	NA	NA
WP_172843138.1|401372_402395_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.5	7.4e-41
WP_157737808.1|402493_403690_-	amidohydrolase	NA	NA	NA	NA	NA
WP_172843139.1|403679_403934_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_095121730.1|404031_404334_-	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_157737810.1|404330_404549_-	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_095121422.1|404615_405620_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_095121736.1|406423_407170_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_095121738.1|407243_408107_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_095121740.1|408093_410409_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_095121742.1|410424_411801_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_172843140.1|413141_414095_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.8	7.9e-37
>prophage 6
NZ_LT906454	Streptococcus acidominimus strain NCTC11291 chromosome 1	2330811	482119	532459	2330811	protease,transposase	Bacillus_phage(22.22%)	39	NA	NA
WP_017770834.1|482119_483034_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_095121830.1|483054_483594_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_017770836.1|483823_484513_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.7	5.2e-30
WP_017770837.1|484493_486005_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	28.4	4.2e-24
WP_017770838.1|486257_486737_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_095121831.1|486733_487909_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_017770840.1|487911_488814_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	33.0	1.9e-24
WP_095121833.1|488874_490185_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_095121835.1|490226_490754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095121836.1|491484_494580_+	SNF2 helicase associated domain-containing protein	NA	V9XTV7	Choristoneura_murinana_nucleopolyhedrovirus	27.6	1.7e-40
WP_017770844.1|494642_495332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095121838.1|495342_496674_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_095121839.1|496860_497358_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_095121841.1|497443_499285_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_017770848.1|499361_499853_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_095121843.1|500081_500928_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	23.7	1.3e-06
WP_095121845.1|501257_502178_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_017770578.1|502259_502538_-	acylphosphatase	NA	NA	NA	NA	NA
WP_095121847.1|502582_503323_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_017770576.1|503363_503867_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_095121849.1|503884_504574_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_095121851.1|504727_505042_-	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_037564552.1|505144_505678_-	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_095121853.1|505758_506535_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_095121855.1|506537_507353_-	phosphotransferase	NA	NA	NA	NA	NA
WP_095121857.1|507377_508346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095121860.1|508342_509698_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	33.3	1.2e-75
WP_095121550.1|510043_510997_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.5	3.9e-36
WP_172843170.1|518114_519233_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_157737814.1|519644_519878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157737816.1|519980_520127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095121864.1|520348_522004_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017770565.1|522014_522338_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_017770564.1|522447_522708_+	metal-sensitive transcriptional regulator	NA	NA	NA	NA	NA
WP_095121570.1|525856_526962_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	50.2	4.8e-70
WP_095121552.1|527432_527888_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095121554.1|528154_529351_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_095121556.1|530245_531250_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_095121558.1|531612_532459_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	23.7	1.9e-05
>prophage 7
NZ_LT906454	Streptococcus acidominimus strain NCTC11291 chromosome 1	2330811	595311	688506	2330811	tail,capsid,terminase,transposase,holin,protease,head,portal	Streptococcus_phage(78.57%)	90	NA	NA
WP_017769109.1|595311_595902_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	54.1	3.7e-53
WP_017769816.1|596223_596484_+	DUF2129 domain-containing protein	NA	NA	NA	NA	NA
WP_095121951.1|596678_597683_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_095121953.1|598255_599431_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017769814.1|599779_600649_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_095121955.1|600653_601607_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_017769812.1|601606_602371_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	8.0e-16
WP_095121957.1|602370_603081_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	26.6	7.4e-16
WP_017769810.1|603289_603949_+	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	63.9	7.3e-74
WP_095121959.1|604016_604664_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	61.1	9.0e-69
WP_095121961.1|604656_605556_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	45.3	5.6e-61
WP_017769807.1|605666_605993_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.6	2.5e-27
WP_095121963.1|605995_606862_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	71.1	4.7e-113
WP_095121965.1|608294_608636_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_095121967.1|608924_609560_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_017769553.1|609748_610840_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	73.5	3.3e-156
WP_095121969.1|610840_611389_+	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	57.2	1.9e-56
WP_017769555.1|611419_612604_+	3-phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	76.1	3.0e-171
WP_095121971.1|612662_612845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017769557.1|613117_614026_-	diacylglycerol kinase family lipid kinase	NA	NA	NA	NA	NA
WP_017769558.1|614114_614654_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_095121973.1|614643_615147_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	32.3	4.5e-15
WP_172843141.1|615124_616207_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_095121975.1|617776_618936_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	26.8	4.5e-18
WP_029751348.1|620386_621637_-	YSIRK-targeted surface antigen transcriptional regulator	NA	NA	NA	NA	NA
WP_000391860.1|627718_627904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000154548.1|627957_628308_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000165733.1|628297_628480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001212841.1|628567_628777_-	helix-turn-helix domain-containing protein	NA	A0A2K5B263	Erysipelothrix_phage	63.1	2.6e-17
WP_000904400.1|628766_630425_-	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_001176804.1|630415_630640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000347293.1|630639_631758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000182249.1|632190_632787_+	hypothetical protein	NA	M1Q222	Streptococcus_phage	29.4	2.2e-13
WP_000242734.1|633062_633491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001121831.1|633549_635505_-	DNA polymerase	NA	E4ZFK1	Streptococcus_phage	86.0	0.0e+00
WP_000158580.1|635553_635721_-	hypothetical protein	NA	E4ZFK2	Streptococcus_phage	49.0	1.8e-05
WP_000105207.1|635740_636304_-	DUF2815 family protein	NA	A0A1B0RXA9	Streptococcus_phage	92.3	1.6e-90
WP_095121979.1|636308_637430_-	DUF2800 domain-containing protein	NA	M1Q218	Streptococcus_phage	89.5	9.4e-199
WP_095121981.1|637701_638806_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	50.2	4.8e-70
WP_001160925.1|639326_641615_+	hypothetical protein	NA	A0A1B0RXC5	Streptococcus_phage	87.1	0.0e+00
WP_095121983.1|641895_642177_+	VRR-NUC domain-containing protein	NA	M1PFY8	Streptococcus_phage	79.6	1.4e-37
WP_095121985.1|642157_643534_+	DEAD/DEAH box helicase	NA	M1Q214	Streptococcus_phage	95.0	8.5e-250
WP_000356273.1|643526_644003_+	hypothetical protein	NA	A0A1B0RXB9	Streptococcus_phage	96.8	1.2e-81
WP_000166944.1|644186_644369_+	hypothetical protein	NA	A0A1B0RXC3	Streptococcus_phage	96.7	3.8e-25
WP_000578147.1|644417_645455_+	methionine adenosyltransferase	NA	E4ZFL0	Streptococcus_phage	83.8	3.6e-168
WP_001138024.1|645456_645822_+	HNH endonuclease	NA	A0A1B0RXJ3	Streptococcus_phage	89.3	2.4e-63
WP_095121987.1|646119_646581_+	hypothetical protein	NA	M1Q209	Streptococcus_phage	96.7	9.9e-86
WP_095121989.1|646552_647812_+	DNA modification methylase	NA	E4ZFL4	Streptococcus_phage	96.9	2.9e-236
WP_024409992.1|647908_648157_+	hypothetical protein	NA	D0R0C7	Streptococcus_phage	98.8	7.5e-40
WP_095121991.1|648158_648371_+	DUF4314 domain-containing protein	NA	A0A1X9I6A3	Streptococcus_phage	97.1	4.4e-33
WP_095121995.1|648654_649128_+|terminase	phage terminase small subunit P27 family	terminase	A0A1X9I6K0	Streptococcus_phage	98.7	1.0e-85
WP_095121997.1|649124_650717_+|terminase	terminase large subunit	terminase	E4ZFM0	Streptococcus_phage	98.5	0.0e+00
WP_157737820.1|650770_651511_+	serine/threonine protein kinase	NA	A0A2I2L395	Orpheovirus	27.6	5.8e-11
WP_095122001.1|651476_652019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122006.1|652067_652914_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	23.7	9.9e-07
WP_095122008.1|652976_654260_+|portal	phage portal protein	portal	A0A1B0RXD8	Streptococcus_phage	97.9	1.0e-244
WP_095122011.1|654252_654948_+|protease	Clp protease ClpP	protease	A0A1B0RXJ9	Streptococcus_phage	98.7	1.9e-125
WP_095122012.1|654966_656172_+|capsid	phage major capsid protein	capsid	E4ZFM5	Streptococcus_phage	99.5	3.2e-229
WP_095122013.1|656174_656432_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1X9I695	Streptococcus_phage	96.5	2.5e-38
WP_095122015.1|656431_656770_+|head,tail	head-tail adaptor protein	head,tail	A0A1X9I694	Streptococcus_phage	96.4	1.2e-56
WP_095122017.1|656762_657131_+	hypothetical protein	NA	A0A1B0RXJ7	Streptococcus_phage	94.3	1.4e-45
WP_095122019.1|657137_657464_+	hypothetical protein	NA	A0A1X9I6J7	Streptococcus_phage	97.2	1.3e-55
WP_024416034.1|657465_658035_+|tail	phage tail protein	tail	E4ZFM9	Streptococcus_phage	98.9	1.7e-103
WP_095122021.1|658046_658466_+	hypothetical protein	NA	D0R0E2	Streptococcus_phage	97.1	1.5e-69
WP_095122023.1|658648_661507_+|tail	phage tail tape measure protein	tail	A0A1X9I6B4	Streptococcus_phage	92.8	2.2e-252
WP_095122025.1|661503_662226_+|tail	phage tail protein	tail	E4ZFN2	Streptococcus_phage	97.9	4.6e-130
WP_095122027.1|662225_666707_+|tail	phage tail protein	tail	E4ZFN3	Streptococcus_phage	90.1	0.0e+00
WP_002943561.1|666719_666926_+	hypothetical protein	NA	A0A1X9I679	Streptococcus_phage	100.0	8.7e-26
WP_095122029.1|666931_667300_+	hypothetical protein	NA	A0A1B0RXK8	Streptococcus_phage	97.5	1.0e-64
WP_024388660.1|667277_667673_+|holin	phage holin family protein	holin	A0A1B0RXK5	Streptococcus_phage	99.2	5.0e-46
WP_095122031.1|667679_669149_+	N-acetylmuramoyl-L-alanine amidase	NA	E4ZFN7	Streptococcus_phage	97.5	3.1e-274
WP_095122033.1|669314_669716_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
WP_032510820.1|669712_669874_+	hypothetical protein	NA	Q6DMS7	Streptococcus_phage	58.8	2.9e-08
WP_095121570.1|670771_671877_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	50.2	4.8e-70
WP_095122035.1|672364_673930_+	recombinase family protein	NA	Q6DMS5	Streptococcus_phage	60.9	7.5e-178
WP_100244354.1|674089_674872_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_095122037.1|674853_675675_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_095122039.1|675676_677314_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_017769745.1|677393_678209_-	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_095122041.1|678205_679111_-	permease	NA	NA	NA	NA	NA
WP_095122043.1|679119_679308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095122046.1|679282_679414_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_017769742.1|679528_680497_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_017769741.1|680860_681079_+	AEC family transporter	NA	NA	NA	NA	NA
WP_095122048.1|681102_681696_+	AEC family transporter	NA	NA	NA	NA	NA
WP_095122050.1|681914_682910_-	bile acid:sodium symporter family protein	NA	NA	NA	NA	NA
WP_095122052.1|683339_684386_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_095123691.1|684643_685948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122054.1|686385_686784_+	response regulator	NA	W8CYM9	Bacillus_phage	45.7	4.6e-23
WP_095121550.1|687552_688506_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.5	3.9e-36
>prophage 8
NZ_LT906454	Streptococcus acidominimus strain NCTC11291 chromosome 1	2330811	717487	785724	2330811	transposase,tRNA	Leptospira_phage(30.0%)	49	NA	NA
WP_095122090.1|717487_718335_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	25.5	1.1e-05
WP_095122092.1|718369_719239_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_095121843.1|720250_721098_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	23.7	1.3e-06
WP_095122094.1|721759_723133_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_095122095.1|723470_724517_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_017769542.1|727329_727584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157737898.1|728463_728619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172843171.1|728628_729135_+	maturase	NA	NA	NA	NA	NA
WP_157737826.1|729131_729509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095121704.1|729820_730825_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_095122099.1|731669_732854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122101.1|732887_734054_+	amidohydrolase	NA	NA	NA	NA	NA
WP_095122103.1|734147_735011_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_095122105.1|735120_735968_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	24.2	3.7e-06
WP_017770007.1|737528_737921_-	VOC family protein	NA	NA	NA	NA	NA
WP_017770008.1|738089_739625_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_095122107.1|742301_744236_+	AlwI family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_095122109.1|744468_745554_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_095122111.1|745746_746748_+	catabolite control protein A	NA	NA	NA	NA	NA
WP_095122113.1|746843_748295_+	alpha-amylase	NA	NA	NA	NA	NA
WP_095122115.1|748367_749366_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_017770015.1|749367_750720_+	glycosyltransferase family 4 protein	NA	A0A1V0SL50	Klosneuvirus	25.1	6.8e-10
WP_157737828.1|751527_751689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122116.1|751770_752094_+	MazG-like protein	NA	NA	NA	NA	NA
WP_017770018.1|752111_754067_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	38.9	3.3e-122
WP_029691270.1|754659_755649_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_095122118.1|755661_756246_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_095122120.1|756238_756613_+	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
WP_100244342.1|756703_757675_+	DUF3114 domain-containing protein	NA	NA	NA	NA	NA
WP_095122122.1|757697_758384_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.6	1.6e-31
WP_095122124.1|758373_759822_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.9	1.1e-18
WP_017769336.1|759912_760509_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_095122126.1|761040_762114_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_029691261.1|762194_762800_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	56.2	2.5e-60
WP_095122127.1|763302_764397_+	serine hydrolase	NA	NA	NA	NA	NA
WP_017769332.1|764503_765550_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_095122129.1|765715_766417_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_095122131.1|766535_767540_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_017769330.1|768063_769020_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_095122134.1|769938_770892_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_095122137.1|770913_772713_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_095122139.1|772724_773147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122141.1|773283_773898_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_095123694.1|773974_774682_+	O-methyltransferase	NA	NA	NA	NA	NA
WP_095122143.1|774790_775735_+	peptidylprolyl isomerase PrsA	NA	NA	NA	NA	NA
WP_095123695.1|776369_778988_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.4	3.5e-63
WP_095122146.1|779118_780540_+	amino acid permease	NA	NA	NA	NA	NA
WP_095121570.1|782457_783563_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	50.2	4.8e-70
WP_095122148.1|784920_785724_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_LT906454	Streptococcus acidominimus strain NCTC11291 chromosome 1	2330811	810057	873343	2330811	transposase,tRNA	Streptococcus_phage(35.29%)	57	NA	NA
WP_095122179.1|810057_811062_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_095122181.1|811441_812233_-	glutathione-dependent disulfide-bond oxidoreductase	NA	NA	NA	NA	NA
WP_095122183.1|812487_813633_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_095122185.1|813906_814350_+	flavodoxin	NA	NA	NA	NA	NA
WP_095122188.1|814446_815664_+	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	49.6	1.5e-88
WP_017770116.1|815785_816133_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_095122190.1|818827_819675_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	24.5	1.4e-05
WP_017770180.1|820322_821522_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_095122192.1|821702_823655_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.1	3.0e-144
WP_095122193.1|823751_825476_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_095122195.1|825502_826021_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_095122197.1|826076_827180_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	54.1	1.1e-79
WP_017770183.1|827204_827651_-	DUF1694 domain-containing protein	NA	NA	NA	NA	NA
WP_017770184.1|827796_829098_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	94.9	6.2e-234
WP_095122199.1|829287_830514_+	peptidase T	NA	NA	NA	NA	NA
WP_017770186.1|830568_831066_+	EbsA family protein	NA	NA	NA	NA	NA
WP_017770187.1|831054_831249_-	ferredoxin	NA	NA	NA	NA	NA
WP_095122201.1|831294_831852_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_095122204.1|831872_832553_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_017770190.1|832715_833246_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.3	5.4e-11
WP_017770191.1|833281_833482_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_017770192.1|833537_833897_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017770193.1|834649_836482_+	elongation factor 4	NA	A0A1B0RXH7	Streptococcus_phage	24.8	7.5e-20
WP_095122207.1|837261_837633_-	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_095122209.1|837756_839553_+	DNA primase	NA	A0A1S5RFR1	Helicobacter_phage	29.4	2.1e-46
WP_017770196.1|839561_840674_+	RNA polymerase sigma factor RpoD	NA	F4YCU2	Synechococcus_phage	38.2	9.2e-37
WP_095122211.1|841190_841529_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_095122213.1|841542_842469_+	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	49.5	6.2e-79
WP_095122217.1|842534_843386_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.5	3.0e-27
WP_095122222.1|843599_844892_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	86.5	1.2e-194
WP_095122229.1|845116_846268_+	DUF1972 domain-containing protein	NA	NA	NA	NA	NA
WP_095122236.1|846257_847187_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017769890.1|847198_848005_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017769891.1|848004_849216_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.2	1.1e-11
WP_095122242.1|849233_851102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095123697.1|851110_852343_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_095122248.1|852335_853322_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_095122252.1|853401_855864_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_017769896.1|855871_857641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122259.1|857730_858159_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_017769897.1|858416_858695_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_095122263.1|858737_859691_+	amidohydrolase	NA	NA	NA	NA	NA
WP_017769899.1|859913_861068_+	ABC transporter ATP-binding protein	NA	F2Y165	Organic_Lake_phycodnavirus	28.4	4.3e-13
WP_095123698.1|861069_861705_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_095122265.1|861705_862626_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017769902.1|862626_863286_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_095122267.1|863539_863977_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_029691100.1|863978_864437_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017769905.1|864578_864851_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_029691099.1|864861_865101_+	KH domain-containing protein	NA	NA	NA	NA	NA
WP_095121550.1|865534_866488_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.5	3.9e-36
WP_095122268.1|866878_868474_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_095122270.1|868636_869155_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_095123700.1|869144_869900_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_095122271.1|869896_870895_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	50.0	7.2e-25
WP_095122273.1|871383_872445_+	PTS transporter subunit IIC	NA	NA	NA	NA	NA
WP_095122274.1|872496_873343_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	22.9	8.3e-06
>prophage 10
NZ_LT906454	Streptococcus acidominimus strain NCTC11291 chromosome 1	2330811	881740	938221	2330811	protease,transposase,tRNA	Leptospira_phage(22.22%)	44	NA	NA
WP_095122103.1|881740_882604_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_095122282.1|882699_883546_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	23.6	1.1e-05
WP_095122284.1|883681_884143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157737832.1|884267_884972_+	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
WP_157737834.1|885001_885427_+	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
WP_095122293.1|885468_886014_-	dihydrofolate reductase family protein	NA	NA	NA	NA	NA
WP_095122296.1|886129_886651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017770716.1|886716_887097_+	DUF1149 family protein	NA	NA	NA	NA	NA
WP_017770715.1|887096_887945_+	DegV family protein	NA	NA	NA	NA	NA
WP_017770714.1|888062_888830_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_095122298.1|888829_890053_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	G3MAR3	Bacillus_virus	37.6	8.3e-31
WP_095122300.1|890437_892309_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.6	6.9e-61
WP_095122302.1|892318_893656_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_095122304.1|893689_894250_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_095122305.1|894246_895989_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.6	1.6e-35
WP_095122307.1|895988_897785_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.2	1.1e-60
WP_095122309.1|898251_899097_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_095121843.1|899193_900041_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	23.7	1.3e-06
WP_095122314.1|901000_902911_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_095122317.1|903016_903946_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_095122319.1|905116_905365_+	NINE protein	NA	NA	NA	NA	NA
WP_095122321.1|905605_907042_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_095122323.1|907228_907924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122326.1|908998_909280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122328.1|911293_912211_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	26.7	8.7e-25
WP_095122330.1|912534_913908_+	MFS transporter	NA	NA	NA	NA	NA
WP_095122333.1|914119_915349_+	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_017769519.1|915397_916615_+	amidohydrolase	NA	NA	NA	NA	NA
WP_095122336.1|916664_917921_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_095123701.1|918181_918700_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_095122339.1|918950_919979_+	FUSC family protein	NA	NA	NA	NA	NA
WP_095122341.1|920348_926249_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_095122343.1|927144_927459_+	PTS cellobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_095122345.1|927502_929491_+	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_095122347.1|929492_929813_+	PTS cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_017769054.1|929831_930338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122349.1|930371_931724_+	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_095122351.1|931795_932890_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_172843144.1|932960_933983_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.2	1.4e-39
WP_095122356.1|934125_934602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122358.1|934558_935161_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	36.7	2.6e-25
WP_095122360.1|935170_935779_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_017769882.1|935899_936625_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_095121704.1|937216_938221_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_LT906454	Streptococcus acidominimus strain NCTC11291 chromosome 1	2330811	979321	1078705	2330811	tail,capsid,tRNA,terminase,integrase,transposase,holin,protease,head,portal	Streptococcus_phage(64.0%)	117	988827:988845	1031577:1031595
WP_157737836.1|979321_979609_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_095122421.1|979995_980310_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_095122423.1|980440_981288_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	27.1	8.3e-06
WP_095122425.1|981488_983168_+	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_095122426.1|983178_983898_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_095122427.1|984075_985737_-	fibronectin/fibrinogen-binding protein	NA	A0A1J0F9J4	Only_Syngen_Nebraska_virus	41.0	3.0e-07
WP_017769298.1|986123_987125_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_095122428.1|987152_988022_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_095122429.1|988018_988777_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.0	9.1e-12
988827:988845	attL	TATACTTAATAACGAGTAT	NA	NA	NA	NA
WP_095122430.1|988872_989967_-|integrase	site-specific integrase	integrase	M1Q1T0	Streptococcus_phage	47.5	9.5e-95
WP_095122431.1|990084_991032_-	Abi family protein	NA	A0A1S5S8T0	Streptococcus_phage	53.1	2.6e-88
WP_095122435.1|991220_991937_-	helix-turn-helix transcriptional regulator	NA	E8ZDN4	Streptococcus_phage	56.7	9.0e-70
WP_172843145.1|992639_992786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122437.1|993059_993275_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_095122438.1|993294_993903_+	phage repressor protein	NA	A0A2H4JB17	uncultured_Caudovirales_phage	46.3	1.2e-43
WP_172843146.1|993913_994051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122440.1|994047_994575_-	hypothetical protein	NA	A0A141E0Q2	Streptococcus_phage	61.5	2.9e-57
WP_095122441.1|994623_994812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122443.1|994928_995204_+	DNA-binding protein	NA	O48392	Streptococcus_phage	62.0	4.6e-22
WP_157737838.1|995205_995367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170237059.1|995366_995540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095123702.1|995986_996151_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_095122445.1|996426_996594_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_095122447.1|996772_997048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122449.1|997025_997412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095122451.1|997467_997908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122453.1|997904_998099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122455.1|998101_998323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122457.1|998322_999096_+	DnaD domain protein	NA	A0A0K0MX39	Streptococcus_phage	58.2	8.9e-39
WP_172843172.1|999138_999951_+	ATP-binding protein	NA	M1PFI4	Streptococcus_phage	40.3	9.3e-47
WP_095122461.1|999950_1000475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122464.1|1000465_1000690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122467.1|1000667_1000946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122469.1|1000942_1001587_+	ERF family protein	NA	A0A1S5SAM9	Streptococcus_phage	39.3	2.8e-38
WP_095122472.1|1001588_1002014_+	single-stranded DNA-binding protein	NA	Q938M7	Temperate_phage	73.0	1.6e-50
WP_095123703.1|1002030_1002213_+	hypothetical protein	NA	A0A2I6QR06	Streptococcus_phage	50.0	1.0e-06
WP_095122474.1|1002209_1002644_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A141E1Z1	Streptococcus_phage	64.2	7.4e-43
WP_157737840.1|1002628_1002796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122476.1|1002779_1003097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122478.1|1003096_1003318_+	hypothetical protein	NA	A0A1P8VVZ1	Streptococcus_phage	44.4	3.3e-07
WP_095122480.1|1003359_1003665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122482.1|1003769_1004114_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1S5SEX8	Streptococcus_phage	73.5	1.0e-42
WP_095122484.1|1004103_1004319_-	AbrB family transcriptional regulator	NA	Q708N8	Streptococcus_phage	75.7	1.7e-24
WP_095122486.1|1004388_1004904_+	DUF1642 domain-containing protein	NA	A0A1X9I5P8	Streptococcus_phage	44.9	5.6e-21
WP_157737842.1|1004906_1005422_+	DUF1642 domain-containing protein	NA	A0A1X9I5P8	Streptococcus_phage	34.7	2.7e-15
WP_157737844.1|1005458_1005608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122490.1|1005609_1005816_+	hypothetical protein	NA	A0A1X9I653	Streptococcus_phage	56.7	1.3e-13
WP_095122492.1|1005940_1006129_+	sporulation protein Cse60	NA	NA	NA	NA	NA
WP_095122494.1|1006125_1006374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122496.1|1006389_1006776_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_095122498.1|1006985_1007402_+	DUF1492 domain-containing protein	NA	A0A0B5A564	Streptococcus_phage	47.1	5.1e-25
WP_095122500.1|1008614_1008992_-	type II toxin-antitoxin system HicB family antitoxin	NA	I3NLB2	Bifidobacterium_phage	40.8	1.2e-17
WP_095122502.1|1009038_1009224_-	type II toxin-antitoxin system HicA family toxin	NA	F0PIL1	Enterococcus_phage	58.1	2.3e-09
WP_095122504.1|1009375_1009711_+	HNH endonuclease	NA	J7KH36	Streptococcus_phage	75.5	4.7e-45
WP_095122506.1|1010365_1012108_+|terminase	terminase large subunit	terminase	J7KKD1	Streptococcus_phage	80.2	4.6e-285
WP_095122508.1|1012295_1012841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122510.1|1012905_1014126_+|portal	phage portal protein	portal	A0A2H4JGQ4	uncultured_Caudovirales_phage	77.8	1.4e-179
WP_037564299.1|1014115_1014718_+|protease	Clp protease ClpP	protease	A0A2H4JG44	uncultured_Caudovirales_phage	54.7	1.1e-57
WP_095122512.1|1014744_1015929_+|capsid	phage major capsid protein	capsid	J7KJ82	Streptococcus_phage	61.3	5.2e-131
WP_095122514.1|1016067_1016370_+|head,tail	phage head-tail connector protein	head,tail	M1NRM0	Streptococcus_phage	67.7	8.5e-30
WP_095122516.1|1016356_1016707_+|head,tail	head-tail adaptor protein	head,tail	M1PFA2	Streptococcus_phage	56.6	4.8e-32
WP_095122518.1|1016703_1017081_+	HK97 gp10 family phage protein	NA	M1PKN1	Streptococcus_phage	62.4	7.2e-34
WP_095122520.1|1017077_1017521_+	hypothetical protein	NA	J7KBZ9	Streptococcus_phage	69.3	2.1e-53
WP_095122522.1|1017522_1018077_+|tail	phage tail protein	tail	M1PRQ7	Streptococcus_phage	78.5	8.8e-81
WP_095122524.1|1018136_1018463_+	hypothetical protein	NA	M1NRL6	Streptococcus_phage	71.3	3.0e-36
WP_157737846.1|1018486_1018660_+	hypothetical protein	NA	J7KBS0	Streptococcus_phage	77.8	3.4e-15
WP_095122526.1|1018672_1022965_+|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	46.2	1.1e-205
WP_095122528.1|1022961_1023681_+|tail	phage tail family protein	tail	Q938K2	Temperate_phage	48.5	1.6e-66
WP_095122530.1|1023677_1027709_+	hypothetical protein	NA	Q938K1	Temperate_phage	49.6	7.7e-142
WP_157737848.1|1027730_1027880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122532.1|1027879_1028272_+	DUF1366 domain-containing protein	NA	NA	NA	NA	NA
WP_157737850.1|1028246_1028420_+	hypothetical protein	NA	A0A097PAU6	Streptococcus_pyogenes_phage	77.5	2.3e-11
WP_095122535.1|1028430_1028724_+	hypothetical protein	NA	J7KH30	Streptococcus_phage	37.8	7.1e-13
WP_095122538.1|1028725_1029001_+|holin	phage holin	holin	A0A0B5A2E7	Streptococcus_phage	75.8	9.8e-33
WP_095122540.1|1029010_1029730_+	CHAP domain-containing protein	NA	A0A1S5S9Z7	Streptococcus_phage	66.9	1.0e-52
WP_157737852.1|1029934_1030105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122542.1|1030101_1030680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172843147.1|1031052_1031235_+	hypothetical protein	NA	A0A286QNA2	Streptococcus_phage	67.9	6.3e-12
WP_095122546.1|1031279_1031486_+	Paratox	NA	NA	NA	NA	NA
WP_095122548.1|1031747_1033409_+	ribonuclease J	NA	NA	NA	NA	NA
1031577:1031595	attR	TATACTTAATAACGAGTAT	NA	NA	NA	NA
WP_095122550.1|1033526_1034309_+	esterase family protein	NA	NA	NA	NA	NA
WP_095122553.1|1034431_1035160_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_095122555.1|1035338_1035539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095123704.1|1035593_1037522_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.4	1.9e-53
WP_095122558.1|1037724_1038147_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095122561.1|1038143_1039526_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017769288.1|1039982_1040771_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_095123705.1|1040770_1042114_-	Mur ligase family protein	NA	NA	NA	NA	NA
WP_017769286.1|1042212_1043070_+	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_017769285.1|1043062_1044022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017769284.1|1044063_1045413_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_017769283.1|1045486_1045858_+	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_029690992.1|1045847_1046576_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_095122563.1|1046652_1047894_-	aminopeptidase	NA	NA	NA	NA	NA
WP_079268446.1|1048048_1048180_+	DUF4044 domain-containing protein	NA	NA	NA	NA	NA
WP_029690990.1|1048336_1049650_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_095122566.1|1050060_1050408_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_095122568.1|1050407_1050614_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_029690989.1|1050628_1050802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122006.1|1051068_1051916_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	23.7	9.9e-07
WP_095122570.1|1053468_1055226_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_017770416.1|1055289_1056795_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SGN0	Hokovirus	30.3	5.3e-11
WP_095123706.1|1056981_1057536_+	adenylate kinase	NA	A0A097BYE2	Leuconostoc_phage	36.7	7.1e-22
WP_017770418.1|1057560_1058301_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.9	2.2e-34
WP_095122572.1|1058300_1060481_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_172843173.1|1060944_1061631_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_095122574.1|1061820_1063812_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_095122576.1|1064568_1065405_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_095122578.1|1065404_1066766_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_095122581.1|1066941_1068174_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_017770426.1|1068615_1069644_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_095122583.1|1070028_1071570_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_095122585.1|1071562_1073830_+	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	43.4	6.7e-10
WP_095122587.1|1073990_1074791_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_095122589.1|1074802_1075921_+	aminotransferase	NA	NA	NA	NA	NA
WP_017770431.1|1075999_1076818_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017770432.1|1077337_1078705_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
>prophage 12
NZ_LT906454	Streptococcus acidominimus strain NCTC11291 chromosome 1	2330811	1190753	1242982	2330811	transposase,tRNA	Planktothrix_phage(16.67%)	44	NA	NA
WP_095121738.1|1190753_1191617_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017769401.1|1193607_1194675_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_095122732.1|1194687_1195353_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	3.4e-31
WP_017769399.1|1195472_1196027_+	FMN-binding protein	NA	NA	NA	NA	NA
WP_095122734.1|1196139_1197201_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_172843150.1|1197169_1198150_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_095122738.1|1198200_1198656_-	NusG domain II-containing protein	NA	NA	NA	NA	NA
WP_095122740.1|1198862_1199651_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_095123709.1|1199647_1200082_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_095121570.1|1200225_1201330_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	50.2	4.8e-70
WP_157737854.1|1201621_1202719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122744.1|1202964_1203969_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_095122746.1|1204192_1205263_+	tyrosine recombinase XerS	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	29.1	1.8e-05
WP_095122748.1|1206527_1207127_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_095122750.1|1207166_1207346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095122752.1|1207552_1208497_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_095122754.1|1208493_1209162_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_095123710.1|1209204_1211169_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_017769386.1|1211155_1211926_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.5	1.2e-27
WP_017769385.1|1212145_1212637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172843176.1|1212839_1214126_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	93.0	7.2e-211
WP_095122758.1|1214727_1215732_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_017769462.1|1216158_1216422_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_017769463.1|1216418_1216634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095122760.1|1217258_1218428_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_095122763.1|1218449_1219196_-	esterase family protein	NA	NA	NA	NA	NA
WP_095122765.1|1219217_1220042_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_095122767.1|1222234_1223578_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_017768856.1|1223909_1226021_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	36.0	1.3e-100
WP_095122769.1|1226148_1226991_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	42.0	1.8e-29
WP_017768854.1|1227059_1227611_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_017768853.1|1227610_1228393_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	39.5	1.6e-24
WP_017768852.1|1228379_1229231_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_172843151.1|1230263_1233584_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_095122773.1|1233780_1234170_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_095122775.1|1234509_1234914_-	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_095122777.1|1234943_1236485_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.2	5.5e-48
WP_095122779.1|1236583_1237165_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_017769630.1|1237391_1238375_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	74.0	2.3e-140
WP_051105464.1|1239021_1239414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122781.1|1239477_1240314_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017769633.1|1240329_1240959_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.2	2.3e-32
WP_029690590.1|1241128_1241770_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_172843152.1|1241959_1242982_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.5	9.6e-41
>prophage 13
NZ_LT906454	Streptococcus acidominimus strain NCTC11291 chromosome 1	2330811	1413461	1452836	2330811	protease,transposase,tRNA	Streptococcus_phage(36.36%)	34	NA	NA
WP_024409351.1|1413461_1414043_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_024409352.1|1414045_1414279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024409353.1|1414288_1414672_-	arsenate reductase	NA	NA	NA	NA	NA
WP_044769798.1|1414681_1415110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029743109.1|1415093_1416449_-	DNA (cytosine-5-)-methyltransferase	NA	A0A141E1L1	Streptococcus_phage	55.6	2.9e-125
WP_009909851.1|1416606_1417431_-	replication initiator protein A	NA	A0A286QNA4	Streptococcus_phage	37.6	5.8e-12
WP_044769819.1|1417427_1417601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095122950.1|1417860_1418229_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_017769382.1|1418303_1418807_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_095121550.1|1419071_1420025_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	35.5	3.9e-36
WP_157737902.1|1420531_1421824_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	86.5	7.8e-197
WP_095122954.1|1422239_1422887_-	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	47.0	8.8e-48
WP_095122956.1|1422894_1423494_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_017768796.1|1423508_1424738_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.7	2.5e-136
WP_095122960.1|1424928_1425432_-	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	38.7	6.9e-24
WP_095122962.1|1425497_1426337_-	thymidylate synthase	NA	U5J9N5	Bacillus_phage	52.7	4.3e-79
WP_017768793.1|1426541_1427717_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_095122964.1|1427709_1428990_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_095122967.1|1429000_1430017_-	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_095122970.1|1430000_1430549_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_095122973.1|1430548_1431547_-	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_095122975.1|1431548_1432481_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_017768787.1|1432462_1433338_-	mevalonate kinase	NA	NA	NA	NA	NA
WP_157737866.1|1433858_1435151_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	85.2	7.6e-192
WP_095122982.1|1436936_1438661_-	ABC transporter permease/substrate binding protein	NA	NA	NA	NA	NA
WP_095122984.1|1438676_1439888_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	6.3e-31
WP_095123719.1|1440198_1440756_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	30.9	2.7e-13
WP_095122986.1|1442197_1443130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095122988.1|1444424_1445774_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_095122990.1|1445927_1447250_-	accessory Sec system glycosylation chaperone GtfB	NA	NA	NA	NA	NA
WP_095122992.1|1447242_1448751_-	accessory Sec system glycosyltransferase GtfA	NA	NA	NA	NA	NA
WP_017770491.1|1448813_1450031_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_095122994.1|1450055_1451198_-	cysteine desulfurase	NA	NA	NA	NA	NA
WP_095122996.1|1451678_1452836_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_LT906454	Streptococcus acidominimus strain NCTC11291 chromosome 1	2330811	1456049	1523651	2330811	tail,capsid,terminase,transposase,protease,head,portal	Streptococcus_phage(75.0%)	70	NA	NA
WP_095123002.1|1456049_1456896_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_095123004.1|1456980_1460160_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_095123006.1|1460639_1461722_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.7	4.9e-59
WP_095123009.1|1461764_1462691_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	30.3	4.5e-21
WP_095123011.1|1462750_1463272_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_017770480.1|1463454_1464351_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_017770479.1|1464334_1464796_-	signal peptidase II	NA	NA	NA	NA	NA
WP_029690477.1|1464805_1465711_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000916503.1|1466077_1466371_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_095123014.1|1466391_1466727_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_017770476.1|1466732_1467047_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_095123017.1|1467252_1468428_-	CapA family protein	NA	A0A2H4JG01	uncultured_Caudovirales_phage	33.2	7.0e-35
WP_095123020.1|1468583_1469430_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	23.5	3.2e-05
WP_002884573.1|1469568_1469745_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_095123023.1|1469825_1470398_-	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_095123025.1|1470408_1471755_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_095123027.1|1471860_1472583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095123029.1|1472792_1473245_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017770469.1|1475971_1476376_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_017770468.1|1476390_1476951_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	39.7	5.5e-30
WP_095123031.1|1477094_1478033_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_157737868.1|1478127_1478676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095123720.1|1479645_1480311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017770463.1|1480341_1481196_-	VanW family protein	NA	NA	NA	NA	NA
WP_095123036.1|1481195_1481735_-	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
WP_095123002.1|1482127_1482974_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_095123038.1|1483118_1483946_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_095123042.1|1483936_1484428_-	shikimate kinase	NA	NA	NA	NA	NA
WP_095123047.1|1484449_1485730_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_095123051.1|1485955_1486975_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	35.0	3.5e-43
WP_095123053.1|1486993_1488019_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	35.1	1.4e-44
WP_095123055.1|1488046_1488916_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_095123058.1|1488928_1489996_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_095123061.1|1490313_1491417_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_095123063.1|1491423_1492590_-	chorismate synthase	NA	NA	NA	NA	NA
WP_095123066.1|1492586_1493267_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	54.9	2.7e-63
WP_017768863.1|1493582_1493849_+	chorismate mutase	NA	NA	NA	NA	NA
WP_017768862.1|1495020_1495914_-	cation transporter	NA	NA	NA	NA	NA
WP_095123068.1|1495903_1496224_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_095121570.1|1496637_1497743_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	50.2	4.8e-70
WP_095123070.1|1497844_1498162_-	hypothetical protein	NA	Q6DMT6	Streptococcus_phage	62.1	3.3e-32
WP_017770801.1|1498158_1498527_-	HK97 gp10 family phage protein	NA	Q6DMT7	Streptococcus_phage	55.2	7.5e-28
WP_017770800.1|1498507_1498858_-|head,tail	head-tail adaptor protein	head,tail	A0A1B0RXE4	Streptococcus_phage	48.2	1.2e-22
WP_017770799.1|1498857_1499133_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1X9I695	Streptococcus_phage	59.3	1.7e-21
WP_017770798.1|1499135_1500335_-|capsid	phage major capsid protein	capsid	M1Q1R5	Streptococcus_phage	86.5	4.4e-202
WP_017770797.1|1500346_1501039_-|protease	Clp protease ClpP	protease	E4ZFM4	Streptococcus_phage	81.4	5.1e-102
WP_017770796.1|1501031_1502294_-|portal	phage portal protein	portal	A0A1B0RXD8	Streptococcus_phage	92.3	2.9e-228
WP_044753264.1|1502307_1503900_-|terminase	terminase large subunit	terminase	Q6DMU3	Streptococcus_phage	90.0	7.9e-292
WP_037564715.1|1503901_1504369_-|terminase	phage terminase small subunit P27 family	terminase	Q6DMU4	Streptococcus_phage	95.5	1.8e-79
WP_017770793.1|1504442_1504679_-	hypothetical protein	NA	E4ZFL8	Streptococcus_phage	50.0	6.7e-14
WP_017770792.1|1504671_1504884_-	DUF4314 domain-containing protein	NA	Q6DMU8	Streptococcus_phage	92.4	6.0e-30
WP_017770791.1|1504944_1506213_-	DNA (cytosine-5-)-methyltransferase	NA	M1NSK8	Streptococcus_phage	83.7	3.9e-209
WP_017770790.1|1506209_1507457_-	DNA modification methylase	NA	A0A1B0RXJ0	Streptococcus_phage	93.7	1.1e-227
WP_017770789.1|1507428_1507884_-	hypothetical protein	NA	M1Q209	Streptococcus_phage	51.0	6.6e-42
WP_017770788.1|1508144_1508510_-	HNH endonuclease	NA	M1PLL8	Streptococcus_phage	76.9	6.0e-54
WP_095123072.1|1508511_1509552_-	methionine adenosyltransferase	NA	E4ZFL0	Streptococcus_phage	77.2	8.3e-149
WP_017770786.1|1509599_1509761_-	hypothetical protein	NA	A0A1B0RXC3	Streptococcus_phage	72.3	3.3e-12
WP_017770785.1|1509963_1510446_-	hypothetical protein	NA	D0R0B9	Streptococcus_phage	70.7	2.6e-60
WP_095123074.1|1510438_1511815_-	DEAD/DEAH box helicase	NA	A0A1X9I6B0	Streptococcus_phage	82.5	1.6e-219
WP_017770783.1|1511795_1512077_-	VRR-NUC domain-containing protein	NA	A0A1B0RXC4	Streptococcus_phage	72.0	7.7e-33
WP_017770782.1|1512423_1514703_-	hypothetical protein	NA	M1NSF0	Streptococcus_phage	75.8	0.0e+00
WP_172843155.1|1515055_1515193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095123076.1|1515167_1515497_+	hypothetical protein	NA	M1PSP3	Streptococcus_phage	44.1	7.9e-13
WP_017770779.1|1515489_1516611_+	DUF2800 domain-containing protein	NA	M1Q218	Streptococcus_phage	76.3	4.1e-170
WP_017770778.1|1516614_1517178_+	DUF2815 family protein	NA	E4ZFK3	Streptococcus_phage	91.2	5.6e-91
WP_017770777.1|1517234_1517405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095123079.1|1517610_1519560_+	DNA polymerase	NA	A0A1B0RXB4	Streptococcus_phage	76.1	1.3e-301
WP_017770774.1|1519604_1520186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095123082.1|1520607_1522452_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1X9I6C7	Streptococcus_phage	53.8	6.8e-194
WP_017770772.1|1522523_1523651_-	DNA cytosine methyltransferase	NA	A7XXH6	Thermus_virus	41.6	5.2e-64
>prophage 15
NZ_LT906454	Streptococcus acidominimus strain NCTC11291 chromosome 1	2330811	1605621	1683895	2330811	transposase,tRNA	Streptococcus_phage(20.0%)	55	NA	NA
WP_017769185.1|1605621_1606968_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.6	4.8e-56
WP_095123169.1|1607001_1608180_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_095123172.1|1608258_1610721_-	bifunctional DnaQ family exonuclease/ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	46.6	3.5e-198
WP_095123173.1|1610903_1611860_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_095123175.1|1612011_1612647_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	61.6	4.7e-78
WP_095123177.1|1612696_1613629_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_095123178.1|1613621_1614314_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	35.6	1.3e-28
WP_172843156.1|1614686_1615709_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.2	1.4e-39
WP_157737872.1|1616013_1617109_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_095123183.1|1617158_1618277_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_095123185.1|1620070_1621987_-	fructose-1,6-bisphosphatase	NA	NA	NA	NA	NA
WP_095122744.1|1622400_1623405_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_095123187.1|1624102_1625458_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_095123189.1|1625546_1626404_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_029690863.1|1626464_1626833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095122744.1|1627220_1628225_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_095123191.1|1630133_1632818_-	cation-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.0	2.7e-74
WP_029690859.1|1633031_1634834_-	beta-hexosaminidase	NA	NA	NA	NA	NA
WP_029690858.1|1634844_1635645_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_095123193.1|1636379_1637912_-	beta-glucuronidase	NA	NA	NA	NA	NA
WP_017768722.1|1637977_1638817_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_017768721.1|1638868_1639963_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_017768720.1|1640025_1641426_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_017768719.1|1641427_1642048_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_029690855.1|1642231_1642906_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017768716.1|1644657_1646451_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	46.0	1.0e-141
WP_017768715.1|1646463_1647501_-	sugar kinase	NA	NA	NA	NA	NA
WP_095123195.1|1647560_1649108_-	MFS transporter	NA	NA	NA	NA	NA
WP_095123197.1|1649285_1649681_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_095123199.1|1649782_1651084_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	30.5	1.6e-27
WP_095123201.1|1651162_1651972_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_095123204.1|1651971_1653192_+	aminoacyltransferase	NA	NA	NA	NA	NA
WP_095123206.1|1653193_1654426_+	aminoacyltransferase	NA	NA	NA	NA	NA
WP_095123208.1|1655072_1655825_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_017768708.1|1656161_1657358_-	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	28.9	7.8e-34
WP_095123210.1|1657487_1658468_-	anti sigma factor C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_095123212.1|1658451_1658961_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_095123214.1|1659210_1660455_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_095123216.1|1660851_1661856_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_095123218.1|1662264_1665054_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_095123220.1|1665197_1667006_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	36.5	1.2e-105
WP_017768701.1|1666989_1667469_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	31.2	4.5e-09
WP_017768826.1|1667971_1668352_-	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_017768825.1|1668317_1668845_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_095123223.1|1668932_1670066_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	41.2	4.3e-74
WP_095123225.1|1670257_1671130_+	N-acetylmuramoyl-L-alanine amidase	NA	X2JN49	Bacillus_phage	34.0	3.6e-20
WP_095123227.1|1671367_1671931_+	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_095123724.1|1673793_1674267_+|tRNA	aminoacyl-tRNA deacylase	tRNA	NA	NA	NA	NA
WP_095123229.1|1674269_1674635_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_095123231.1|1674637_1675261_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_017770439.1|1675298_1676201_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_095123233.1|1676340_1677831_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	40.7	5.6e-90
WP_095123235.1|1679755_1679962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006738512.1|1680057_1680255_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_172843152.1|1682872_1683895_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.5	9.6e-41
>prophage 16
NZ_LT906454	Streptococcus acidominimus strain NCTC11291 chromosome 1	2330811	1716087	1766044	2330811	protease,transposase,tRNA	Streptococcus_phage(23.08%)	46	NA	NA
WP_095123272.1|1716087_1716951_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_095123273.1|1717348_1718353_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_095123275.1|1719088_1719472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095123277.1|1719598_1720348_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017768957.1|1720505_1720694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095123278.1|1720834_1721590_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_095123280.1|1721591_1721855_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_095123281.1|1721912_1723505_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	38.0	6.1e-58
WP_172843157.1|1723771_1724002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095123285.1|1724141_1725941_-	SH3 domain-containing protein	NA	M1PRP8	Streptococcus_phage	53.2	8.8e-05
WP_017768963.1|1726112_1726493_-	PH domain-containing protein	NA	A6N235	Microbacterium_phage	42.0	1.4e-08
WP_095123725.1|1727828_1729373_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	28.5	2.8e-36
WP_017769348.1|1729492_1730179_-	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
WP_095123287.1|1730185_1731556_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_095123289.1|1731888_1732455_+	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_095123291.1|1732495_1733542_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_017769352.1|1733669_1734266_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_095123726.1|1734290_1736276_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_017769354.1|1736744_1737440_-	phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_157737876.1|1737516_1737660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095123293.1|1737732_1738668_+	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	42.6	2.4e-62
WP_095123295.1|1738791_1738974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017769715.1|1739021_1739201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095123297.1|1739204_1739672_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_095123298.1|1739772_1740558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095121570.1|1740667_1741772_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	50.2	4.8e-70
WP_157737878.1|1741769_1742867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095123302.1|1743105_1743952_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	22.6	7.5e-07
WP_017769711.1|1744155_1744431_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	71.9	1.5e-25
WP_017769710.1|1744552_1745146_-	YpmS family protein	NA	NA	NA	NA	NA
WP_095123304.1|1745135_1745966_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_017769708.1|1745958_1746798_-	DegV family protein	NA	NA	NA	NA	NA
WP_095123306.1|1746904_1748563_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_017769706.1|1748572_1749040_-	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017769705.1|1749017_1749854_-	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_017769704.1|1749819_1750716_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_017769703.1|1750715_1750934_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_095123308.1|1750923_1752252_-	exodeoxyribonuclease VII large subunit	NA	M1NLU2	Moumouvirus	32.8	5.8e-38
WP_017769702.1|1755514_1756165_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_172843181.1|1756148_1756604_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_095123312.1|1756699_1757554_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	42.2	5.0e-43
WP_095123314.1|1757766_1758501_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	8.4e-39
WP_017769698.1|1758500_1759187_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000443582.1|1759340_1759571_-	DUF1797 family protein	NA	NA	NA	NA	NA
WP_095123317.1|1759860_1762119_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	39.1	4.3e-126
WP_095123319.1|1764751_1766044_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	92.0	1.5e-208
>prophage 17
NZ_LT906454	Streptococcus acidominimus strain NCTC11291 chromosome 1	2330811	1802938	1841109	2330811	transposase,tRNA	Streptococcus_phage(55.56%)	30	NA	NA
WP_095123355.1|1802938_1803786_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	23.5	2.2e-06
WP_095123357.1|1803945_1804914_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_095123360.1|1804915_1805365_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_095123362.1|1805997_1806699_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_017768759.1|1806691_1806928_-	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_095123365.1|1808226_1809074_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	24.5	7.5e-07
WP_095123367.1|1809138_1809495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095123369.1|1809542_1810370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017769485.1|1810356_1810692_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017769484.1|1810704_1810857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017769483.1|1810872_1811019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017769482.1|1811294_1812530_-	aminoacyltransferase	NA	NA	NA	NA	NA
WP_095121704.1|1812713_1813718_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_095121704.1|1814273_1815278_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_095123371.1|1817105_1819163_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	34.4	1.5e-85
WP_095123373.1|1820904_1821123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095123375.1|1821129_1822794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051105453.1|1822939_1823647_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_172843158.1|1823892_1825029_-	L-lactate oxidase	NA	NA	NA	NA	NA
WP_095123379.1|1825363_1826191_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	82.4	1.6e-123
WP_095123381.1|1826370_1826991_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_095123383.1|1827193_1827844_-	HD domain-containing protein	NA	S4W232	Pandoravirus	30.4	1.9e-13
WP_017768730.1|1827859_1828114_-	DUF1912 family protein	NA	NA	NA	NA	NA
WP_095123728.1|1828926_1829112_+|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	81.4	3.5e-18
WP_017769993.1|1835690_1836239_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_095123385.1|1836320_1836983_-	ComF family protein	NA	NA	NA	NA	NA
WP_095123387.1|1836982_1838281_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	54.2	1.4e-132
WP_095123389.1|1838328_1838955_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	60.7	5.0e-64
WP_095123391.1|1839050_1839971_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	82.2	1.4e-139
WP_095122103.1|1840245_1841109_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_LT906454	Streptococcus acidominimus strain NCTC11291 chromosome 1	2330811	1850945	1909415	2330811	transposase,tRNA	Bacillus_phage(16.67%)	53	NA	NA
WP_095123404.1|1850945_1851878_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	31.8	2.6e-08
WP_095123406.1|1851992_1854380_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_095123408.1|1854769_1855087_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_095123410.1|1855110_1855731_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.0	6.7e-21
WP_095123412.1|1856050_1857658_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_017769195.1|1857807_1858290_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_095123415.1|1858342_1859860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095123417.1|1859862_1861029_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_095123419.1|1861482_1861833_-	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_095123421.1|1861958_1862477_-	DUF1273 family protein	NA	NA	NA	NA	NA
WP_017769200.1|1862554_1863154_+	Holliday junction resolvase RecU	NA	A0A0S2MVB5	Bacillus_phage	31.3	4.3e-17
WP_017769201.1|1863155_1865405_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_095123424.1|1866268_1867297_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_172843159.1|1867312_1868080_-	response regulator	NA	NA	NA	NA	NA
WP_095123428.1|1868072_1869716_-	histidine kinase	NA	NA	NA	NA	NA
WP_017769961.1|1870181_1871009_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_095123430.1|1871005_1871815_-	PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC	NA	NA	NA	NA	NA
WP_095123434.1|1871833_1872325_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_017769964.1|1872346_1872772_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_172843133.1|1873521_1873941_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_095123437.1|1874086_1874934_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	24.0	4.4e-07
WP_095123439.1|1876379_1877333_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	37.8	1.8e-41
WP_095123441.1|1877622_1878108_+	type III toxin-antitoxin system ToxN/AbiQ family toxin	NA	NA	NA	NA	NA
WP_095123443.1|1878554_1878923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095123444.1|1879217_1879442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095123445.1|1879461_1880259_-	ParA family protein	NA	NA	NA	NA	NA
WP_095123446.1|1880635_1882516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095123447.1|1882577_1884536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095123448.1|1884536_1884797_-	hypothetical protein	NA	A0A1X9I6D4	Streptococcus_phage	48.3	1.3e-10
WP_095123729.1|1885068_1885926_-	Rgg/GadR/MutR family transcriptional regulator	NA	A0A1X9I6E0	Streptococcus_phage	41.3	1.6e-36
WP_172843138.1|1886071_1887094_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.5	7.4e-41
WP_095121687.1|1887212_1888076_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_095123449.1|1888349_1889597_+	MFS transporter	NA	NA	NA	NA	NA
WP_095123450.1|1889593_1890463_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.1	2.9e-38
WP_095123451.1|1890473_1891172_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_095123452.1|1891289_1891904_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	41.7	1.7e-21
WP_095123453.1|1892052_1892745_-	primase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_095123454.1|1893028_1893745_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_095123731.1|1893847_1894948_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_095123730.1|1894959_1895703_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017769969.1|1895886_1896240_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_095123455.1|1896247_1896841_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_095123456.1|1896837_1897470_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_095123457.1|1897507_1897822_-	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_095123458.1|1897997_1899116_-	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
WP_029691564.1|1899115_1899676_-	YqeG family HAD IIIA-type phosphatase	NA	NA	NA	NA	NA
WP_095123459.1|1899960_1900656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095122611.1|1901305_1902153_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	23.5	1.2e-07
WP_017770317.1|1902959_1904399_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_095123460.1|1904398_1905865_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_095123461.1|1905864_1906167_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_095123462.1|1907676_1907973_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_095123463.1|1908251_1909415_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	27.6	2.9e-25
>prophage 19
NZ_LT906454	Streptococcus acidominimus strain NCTC11291 chromosome 1	2330811	1962622	2097413	2330811	protease,bacteriocin,transposase,tRNA	Streptococcus_phage(18.18%)	112	NA	NA
WP_095121738.1|1962622_1963486_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_095121422.1|1963793_1964798_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_095123493.1|1964978_1966385_-	6-phospho-beta-galactosidase	NA	NA	NA	NA	NA
WP_095123494.1|1966454_1968134_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_095123495.1|1968133_1968451_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_095123496.1|1968482_1969316_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_095123497.1|1970324_1970591_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_095123498.1|1971643_1972540_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_095123499.1|1972631_1973618_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_095123500.1|1973620_1974550_-	tagatose-6-phosphate kinase	NA	NA	NA	NA	NA
WP_017769720.1|1974680_1975196_-	galactose-6-phosphate isomerase subunit LacB	NA	NA	NA	NA	NA
WP_095123501.1|1975210_1975636_-	galactose-6-phosphate isomerase subunit LacA	NA	NA	NA	NA	NA
WP_095123502.1|1975660_1977109_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_017769723.1|1977135_1977441_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_017769724.1|1977433_1977907_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_095121738.1|1978140_1979004_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017769725.1|1979077_1979836_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_017769726.1|1980052_1980823_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_017769727.1|1980819_1981683_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_017769728.1|1981694_1983074_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_017769729.1|1983123_1983546_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_017769730.1|1983542_1984016_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_095123503.1|1984018_1985251_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_095123504.1|1985326_1986061_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	A0A0M4JSW6	Mollivirus	25.2	2.4e-09
WP_095123505.1|1986072_1986993_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_017769734.1|1987007_1987973_-	enoyl-[acyl-carrier-protein] reductase FabK	NA	NA	NA	NA	NA
WP_017769735.1|1988094_1988319_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_095123506.1|1988378_1989347_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_017769737.1|1989346_1989781_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095123507.1|1989872_1990676_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_095123508.1|1990866_1992219_+	aspartate kinase	NA	NA	NA	NA	NA
WP_095123509.1|1992454_1992952_-	competence protein ComX	NA	NA	NA	NA	NA
WP_095122744.1|1999317_2000322_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_095123510.1|2000904_2002062_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_095122744.1|2002111_2003116_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_172843161.1|2003280_2003919_-	HAD family phosphatase	NA	M1I080	Acanthocystis_turfacea_Chlorella_virus	29.5	9.0e-13
WP_029692074.1|2004049_2004367_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	46.2	2.3e-17
WP_095123512.1|2006533_2006977_-	VOC family protein	NA	NA	NA	NA	NA
WP_100244334.1|2007058_2007493_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_095123514.1|2008182_2008401_-	DUF4649 family protein	NA	NA	NA	NA	NA
WP_095123515.1|2008410_2008767_-	DUF2200 domain-containing protein	NA	NA	NA	NA	NA
WP_095123516.1|2008776_2010093_-	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	43.7	7.9e-96
WP_029692082.1|2010327_2010831_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	54.8	4.7e-41
WP_095123517.1|2010957_2012442_+	DUF1846 domain-containing protein	NA	NA	NA	NA	NA
WP_095123518.1|2012574_2014914_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	52.4	4.3e-20
WP_095123519.1|2015026_2015329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017769023.1|2015325_2015874_+	CvpA family protein	NA	NA	NA	NA	NA
WP_017769024.1|2016219_2017245_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017769025.1|2017259_2018171_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	50.9	1.5e-72
WP_095123520.1|2019253_2020101_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	22.0	2.9e-06
WP_037563672.1|2020326_2020851_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_095123521.1|2020850_2021627_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_017769028.1|2021787_2022345_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_095123522.1|2022392_2024249_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_095123523.1|2024631_2025894_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_017769031.1|2025915_2026710_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_017769032.1|2026727_2027477_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	38.8	1.3e-21
WP_017769033.1|2027922_2028264_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_095123524.1|2028362_2028698_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_172843183.1|2028754_2029381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017769036.1|2029405_2030401_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	37.0	4.6e-48
WP_095123525.1|2030415_2031882_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_095123526.1|2031885_2033058_-	galactokinase	NA	NA	NA	NA	NA
WP_095123527.1|2033197_2034196_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.5	3.3e-09
WP_095123528.1|2034325_2035936_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_095123529.1|2036009_2037143_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	31.8	3.6e-20
WP_095123530.1|2037289_2038138_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017769043.1|2038228_2039056_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_095123531.1|2039057_2040731_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.1	1.3e-21
WP_095123532.1|2040815_2041364_-	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_095123533.1|2041381_2042227_-	S-adenosyl-l-methionine hydroxide adenosyltransferase family protein	NA	NA	NA	NA	NA
WP_095123534.1|2042634_2045136_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	65.3	0.0e+00
WP_095123535.1|2045517_2046351_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_017768694.1|2046596_2048099_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_095123536.1|2048116_2048821_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_095123537.1|2048824_2049652_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095123538.1|2049827_2050793_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_095123539.1|2050802_2052179_-	amino acid permease	NA	NA	NA	NA	NA
WP_095123540.1|2052381_2053380_-	YhdH/YhfP family quinone oxidoreductase	NA	NA	NA	NA	NA
WP_017768688.1|2053449_2053992_-	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_017768687.1|2054184_2054361_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_079268432.1|2054371_2054524_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_095123541.1|2054572_2056966_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_095123542.1|2057088_2057958_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_095123543.1|2058046_2058451_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_017768683.1|2058463_2059273_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_095123544.1|2059259_2060162_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_095123545.1|2060316_2060802_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_095123546.1|2060798_2062583_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_095123547.1|2062749_2063466_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095123548.1|2063528_2064512_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_095123549.1|2064520_2065696_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017770357.1|2065706_2066426_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095123550.1|2066907_2068200_-	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	36.9	6.6e-71
WP_095123551.1|2068468_2069518_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_095123552.1|2069682_2070411_+	hypothetical protein	NA	M1PFV6	Streptococcus_phage	47.5	2.6e-32
WP_095123553.1|2070487_2071492_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_095123554.1|2071630_2072905_+	toxic anion resistance protein	NA	M1PLC8	Streptococcus_phage	68.0	2.0e-136
WP_095123555.1|2072991_2073864_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_017770363.1|2073850_2074828_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_095121481.1|2074941_2076219_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_095123556.1|2076776_2077484_-	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_095123557.1|2078391_2079039_-	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_095123558.1|2080439_2082878_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.0	5.9e-121
WP_017770081.1|2082877_2083339_-	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095123559.1|2083840_2084881_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_017770079.1|2085063_2085831_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_017770074.1|2092607_2093012_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A1P8VVW2	Streptococcus_phage	99.3	5.3e-67
WP_095123560.1|2093071_2093257_-	type II toxin-antitoxin system HicA family toxin	NA	A0A1P8VVU8	Streptococcus_phage	98.4	2.2e-28
WP_095121570.1|2094809_2095914_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	50.2	4.8e-70
WP_095123561.1|2096162_2096498_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_095122006.1|2096565_2097413_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	23.7	9.9e-07
>prophage 20
NZ_LT906454	Streptococcus acidominimus strain NCTC11291 chromosome 1	2330811	2113049	2168149	2330811	protease,transposase,tRNA	Streptococcus_phage(33.33%)	44	NA	NA
WP_095123568.1|2113049_2113676_-|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_017770232.1|2113681_2113996_-	thioredoxin family protein	NA	A0A0K2FIM3	Achromobacter_phage	34.5	5.2e-06
WP_037564361.1|2113992_2114274_-	DUF4651 domain-containing protein	NA	NA	NA	NA	NA
WP_017770230.1|2114465_2114666_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	78.5	3.0e-23
WP_095123569.1|2114811_2115876_+	glutamyl aminopeptidase	NA	NA	NA	NA	NA
WP_095123570.1|2115918_2116704_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	38.4	1.4e-36
WP_095123571.1|2117249_2117918_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_095123572.1|2117951_2118404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095123573.1|2118478_2119483_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_017770225.1|2119612_2119810_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_095123574.1|2119838_2120045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017770223.1|2120199_2121390_-	acetate kinase	NA	NA	NA	NA	NA
WP_095123575.1|2121450_2122404_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017770220.1|2122842_2123280_-	competence protein ComGF	NA	NA	NA	NA	NA
WP_095123576.1|2123257_2123557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095123577.1|2123528_2123945_-	competence protein	NA	NA	NA	NA	NA
WP_095123578.1|2123928_2124219_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017770216.1|2124219_2125194_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_017770215.1|2125171_2126125_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_100244363.1|2126244_2126604_-	DUF1033 family protein	NA	NA	NA	NA	NA
WP_095123579.1|2126941_2130574_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	25.2	4.0e-65
WP_017770212.1|2130697_2134267_-	DNA-directed RNA polymerase subunit beta	NA	A0A2P0VMZ3	Tetraselmis_virus	25.6	1.6e-37
WP_172843184.1|2134567_2136865_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_095123581.1|2137096_2138353_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	39.7	5.6e-75
WP_017770208.1|2139738_2140563_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_095123582.1|2140559_2141252_-	metal ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	2.2e-12
WP_095123583.1|2141255_2141693_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095123584.1|2143095_2144157_+|transposase	transposase	transposase	A0A2I7SC85	Paenibacillus_phage	52.0	1.0e-29
WP_095123585.1|2144415_2145672_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	56.6	5.7e-128
WP_095123735.1|2152400_2152958_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	55.0	1.9e-51
WP_172843185.1|2152954_2153455_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017769426.1|2153456_2154389_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_095123736.1|2154711_2156880_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	63.8	1.2e-263
WP_095123587.1|2156993_2158535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095123588.1|2160206_2160506_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_095123589.1|2160520_2160940_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_095123590.1|2160939_2161206_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_095123591.1|2161359_2161887_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_037563881.1|2161886_2162555_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_023649370.1|2162580_2163327_+	peroxide stress protein YaaA	NA	A0A1X9I5I0	Streptococcus_phage	38.3	2.1e-29
WP_095121570.1|2163410_2164516_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	50.2	4.8e-70
WP_095123592.1|2164663_2165161_-	competence protein ComX	NA	NA	NA	NA	NA
WP_095123593.1|2165513_2166716_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	92.0	8.3e-209
WP_095123585.1|2166892_2168149_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	56.6	5.7e-128
>prophage 21
NZ_LT906454	Streptococcus acidominimus strain NCTC11291 chromosome 1	2330811	2191638	2288822	2330811	protease,transposase,tRNA,integrase	Streptococcus_phage(35.29%)	97	2250066:2250082	2289546:2289562
WP_095123599.1|2191638_2192747_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	50.0	4.1e-69
WP_095123601.1|2193184_2193985_+	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	26.3	4.0e-10
WP_095123602.1|2194010_2194616_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_095122274.1|2194616_2195464_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	22.9	8.3e-06
WP_095123603.1|2195475_2196774_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_029691486.1|2196770_2197250_+	transcriptional regulator GutM	NA	NA	NA	NA	NA
WP_095123604.1|2197283_2197826_+	PTS glucitol/sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_095123605.1|2197847_2198831_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_095123606.1|2198863_2199229_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_095123607.1|2199244_2199922_+	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	30.1	2.3e-22
WP_095123608.1|2200067_2200616_+	DUF4352 domain-containing protein	NA	E5DV69	Deep-sea_thermophilic_phage	40.6	5.4e-22
WP_017768831.1|2200712_2201411_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_095123609.1|2201465_2202596_+	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_017768833.1|2202648_2203047_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_029691479.1|2203284_2204445_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	63.5	4.8e-121
WP_095123610.1|2204541_2205798_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_172843162.1|2207218_2207602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095123611.1|2207651_2208656_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_095123613.1|2209138_2209986_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	22.9	8.3e-06
WP_095123614.1|2210180_2210732_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017769066.1|2210832_2211426_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_029691475.1|2211435_2212659_-	MFS transporter	NA	NA	NA	NA	NA
WP_095123615.1|2212695_2214663_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.5	2.8e-65
WP_095123616.1|2214757_2217307_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	24.4	7.2e-37
WP_095123617.1|2217318_2217756_-	arginine repressor	NA	NA	NA	NA	NA
WP_095123618.1|2217913_2219605_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.8	2.6e-75
WP_002982147.1|2221340_2221490_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_029691462.1|2221505_2221688_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_095123619.1|2222002_2223115_+	vitamin B12 independent methionine synthase	NA	A0A218MNE0	uncultured_virus	42.4	7.9e-73
WP_095123620.1|2223169_2223634_+	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_095123621.1|2223618_2225469_-	APC family permease	NA	NA	NA	NA	NA
WP_095123737.1|2225765_2227043_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_095123622.1|2227153_2228905_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SJ84	Klosneuvirus	26.9	9.1e-15
WP_095123623.1|2228897_2229836_+	YitT family protein	NA	NA	NA	NA	NA
WP_017769074.1|2229976_2230852_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	38.4	8.8e-51
WP_095123624.1|2230911_2231358_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_095123625.1|2231640_2232228_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_029691461.1|2233817_2235071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095123626.1|2235346_2236351_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_157737882.1|2237642_2237999_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023649359.1|2238346_2239156_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_023649358.1|2239199_2239331_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_172843186.1|2239294_2239777_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_172843163.1|2240158_2241181_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.5	1.3e-40
WP_161515432.1|2241355_2241670_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_017769273.1|2241704_2241989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095123631.1|2242516_2243461_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_095123633.1|2243992_2245708_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.2	5.0e-58
WP_029691454.1|2245710_2246475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095123634.1|2246477_2247353_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.8	1.8e-27
WP_029691452.1|2247345_2247777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029691451.1|2247787_2248369_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_029691450.1|2248370_2249108_-	amino acid transporter	NA	NA	NA	NA	NA
2250066:2250082	attL	TTATTTTTTGAAACTAG	NA	NA	NA	NA
WP_095123613.1|2250199_2251046_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	22.9	8.3e-06
WP_095121738.1|2251389_2252253_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_095123635.1|2252465_2253221_+	replication initiation protein	NA	NA	NA	NA	NA
WP_095123636.1|2253223_2253634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095123637.1|2253626_2254151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095123638.1|2254431_2254797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157737884.1|2256944_2257043_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_095121570.1|2257399_2258505_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	50.2	4.8e-70
WP_095121738.1|2259047_2259911_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_095123639.1|2260008_2260647_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	39.6	8.2e-22
WP_095123640.1|2260943_2262281_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_029691446.1|2263031_2263364_-	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_095123641.1|2263525_2263963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095123642.1|2264125_2266042_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	36.9	3.8e-91
WP_095123643.1|2266053_2266362_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_017769263.1|2266377_2266749_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_017769262.1|2266915_2267536_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_017769259.1|2268905_2270123_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_017769258.1|2270119_2271013_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.9	2.3e-22
WP_017769257.1|2271249_2271576_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095123644.1|2271562_2272147_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_017769255.1|2272143_2273187_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_172843187.1|2273667_2274960_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	90.2	8.6e-204
WP_095123646.1|2275264_2275618_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_017769319.1|2275777_2275978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029691438.1|2276177_2277689_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	29.5	3.1e-51
WP_095123647.1|2278510_2278765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095123648.1|2278761_2279124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095123649.1|2279110_2279521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157737888.1|2279798_2280026_-	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	58.9	4.2e-21
WP_095123651.1|2280412_2280715_-	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	42.9	2.0e-10
WP_095123652.1|2280716_2281124_-	hypothetical protein	NA	A0A1X9I5V5	Streptococcus_phage	50.8	1.1e-27
WP_095123653.1|2281114_2281309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095123739.1|2281628_2282897_-	virulence-associated protein E	NA	M1PKI6	Streptococcus_phage	30.8	2.8e-50
WP_095123654.1|2283034_2283871_-	primase C-terminal domain-containing protein	NA	A0A1X9I6L2	Streptococcus_phage	53.0	3.0e-80
WP_095123655.1|2283870_2284140_-	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	51.2	2.5e-20
WP_095123656.1|2284123_2284453_-	DNA-binding protein	NA	A0A1X9I5Z6	Streptococcus_phage	41.0	2.2e-10
WP_095123740.1|2284453_2284705_-	hypothetical protein	NA	M1PF88	Streptococcus_phage	49.4	1.6e-10
WP_095123741.1|2284916_2285189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172843164.1|2285267_2285417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095123658.1|2285688_2286309_-	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	29.8	1.0e-13
WP_086163549.1|2286319_2286523_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_095123659.1|2286729_2287248_+	helix-turn-helix domain-containing protein	NA	A0A1X9I723	Streptococcus_phage	61.1	1.4e-16
WP_095123660.1|2287655_2288822_+|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	70.9	2.0e-159
2289546:2289562	attR	TTATTTTTTGAAACTAG	NA	NA	NA	NA
>prophage 22
NZ_LT906454	Streptococcus acidominimus strain NCTC11291 chromosome 1	2330811	2306571	2314583	2330811		Staphylococcus_phage(33.33%)	9	NA	NA
WP_095123672.1|2306571_2307270_-	transglycosylase	NA	Q4Z8Z7	Staphylococcus_phage	70.6	1.7e-28
WP_095123673.1|2307412_2307925_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A288TY55	Enterococcus_phage	35.5	1.9e-21
WP_095123674.1|2308088_2308889_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_095123675.1|2308881_2309724_-	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	28.5	2.8e-14
WP_017769792.1|2309699_2310527_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	32.7	1.8e-21
WP_017769791.1|2310538_2311081_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_095123676.1|2311087_2311969_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_095123677.1|2312040_2313333_-	insulinase family protein	NA	A0A2K9LA15	Tupanvirus	27.7	4.4e-14
WP_095123678.1|2313335_2314583_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	35.3	4.0e-65
