The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT906451	Legionella lansingensis strain NCTC12830 chromosome 1	2989256	578558	588484	2989256		Micromonas_pusilla_virus(16.67%)	7	NA	NA
WP_028372241.1|578558_580499_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	48.8	2.4e-149
WP_028372242.1|580761_581895_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	36.2	6.7e-27
WP_028372243.1|581990_583130_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.8	2.0e-50
WP_028372244.1|583126_584275_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.8	6.0e-124
WP_028372245.1|584294_585620_+	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	30.0	8.9e-47
WP_028372246.1|585813_586632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028372247.1|586807_588484_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	30.2	1.9e-14
>prophage 2
NZ_LT906451	Legionella lansingensis strain NCTC12830 chromosome 1	2989256	608343	720747	2989256	protease,transposase,integrase	Bacillus_phage(18.75%)	95	605488:605518	682706:682805
605488:605518	attL	TGGATACCGTGGTCAAGCCACGGTAATTCGG	NA	NA	NA	NA
WP_058387169.1|608343_609306_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
605488:605518	attL	TGGATACCGTGGTCAAGCCACGGTAATTCGG	NA	NA	NA	NA
WP_028374241.1|609448_610318_+	YicC family protein	NA	NA	NA	NA	NA
WP_028374240.1|610324_610954_+	guanylate kinase	NA	U5J9X2	Bacillus_phage	27.0	1.9e-15
WP_028374239.1|611139_611343_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_028374238.1|611544_613668_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	34.6	2.0e-08
WP_028374237.1|613667_614051_+	RidA family protein	NA	NA	NA	NA	NA
WP_028374236.1|614207_614717_+|protease	retroviral-like aspartic protease family protein	protease	NA	NA	NA	NA
WP_028374235.1|614858_615338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095141706.1|615667_616630_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_028373596.1|616898_618743_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.9	2.3e-48
WP_028373595.1|618745_619165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028373594.1|619350_623274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028373593.1|623345_624167_+	glutamate racemase	NA	NA	NA	NA	NA
WP_028373592.1|624297_625527_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_028373591.1|626310_627645_+	trigger factor	NA	NA	NA	NA	NA
WP_035915700.1|627649_628288_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	3.5e-57
WP_028373589.1|628544_629813_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.3	7.8e-133
WP_051546182.1|630078_632529_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	50.2	3.9e-213
WP_028373587.1|632654_632930_+	HU family DNA-binding protein	NA	B5TA87	Burkholderia_phage	47.2	1.2e-14
WP_028373586.1|633175_635053_+	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_028373585.1|635072_636323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028373584.1|636527_637973_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_028373583.1|638138_638489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028373582.1|638526_639312_-	enoyl-ACP reductase	NA	NA	NA	NA	NA
WP_028373581.1|639313_639976_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.2	3.2e-29
WP_028373580.1|640194_640749_-	Smr/MutS family protein	NA	NA	NA	NA	NA
WP_028373579.1|641034_641958_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
640825:640855	attR	CCGAATTACCGTGGCTTGACCACGGTATCCA	NA	NA	NA	NA
WP_028373578.1|641961_643020_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	45.7	8.1e-83
640825:640855	attR	CCGAATTACCGTGGCTTGACCACGGTATCCA	NA	NA	NA	NA
WP_028373577.1|643034_644057_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_028373576.1|644758_646180_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_081778090.1|646194_647034_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_051546180.1|647155_649084_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_028373575.1|649823_650759_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_028373574.1|650807_651479_+	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_028373573.1|651475_652054_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_028373572.1|652488_653220_+	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_051546179.1|653231_653801_-|protease	DUF922 domain-containing Zn-dependent protease	protease	NA	NA	NA	NA
WP_028373571.1|653821_654811_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_028373570.1|654816_655302_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_028373569.1|655309_655564_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	41.9	1.5e-11
WP_028373568.1|655581_656004_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_028373567.1|656072_656909_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_028373566.1|656967_658593_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_028373565.1|658868_659567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035915706.1|659628_659901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035915695.1|659903_660812_-	DMT family transporter	NA	NA	NA	NA	NA
WP_028373562.1|661038_662328_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_028373561.1|662354_663308_+	glutathione synthase	NA	NA	NA	NA	NA
WP_095141844.1|663503_664814_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_028373558.1|665004_665682_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_028373557.1|665856_666384_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	36.2	2.3e-14
WP_035915704.1|666558_667146_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_028373555.1|667148_667835_-	MCE family protein	NA	NA	NA	NA	NA
WP_028373554.1|667902_668658_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_131796085.1|668829_669957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095141685.1|670220_671402_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_095141708.1|671401_671758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157737126.1|672025_672937_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_028374233.1|673055_674351_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_028374232.1|674473_674782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028374231.1|674954_675338_-	VOC family protein	NA	NA	NA	NA	NA
WP_028374230.1|675425_676277_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_035916279.1|676291_679999_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	71.4	4.0e-20
WP_051546283.1|680046_680505_-	7-cyano-7-deazaguanine reductase	NA	E7DN65	Pneumococcus_phage	36.8	1.5e-09
WP_035916277.1|680501_681023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095141712.1|681118_681484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095141685.1|681483_682665_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_028373915.1|682856_684500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028373916.1|684549_685746_-	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_154660319.1|685759_685936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028373918.1|686152_686611_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_028373919.1|688393_689578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028373920.1|689677_690625_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_065236345.1|690695_691778_-	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_051546223.1|691872_696105_-	NAD-dependent ubiquitin ligase	NA	NA	NA	NA	NA
WP_035915934.1|696540_698364_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.1	6.5e-32
WP_028373922.1|698538_699282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028373923.1|699496_700279_+	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_028373924.1|700282_701236_+	GNAT family N-acetyltransferase	NA	A0A2K5B2B6	Erysipelothrix_phage	46.0	6.0e-37
WP_035915941.1|701253_702042_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_028373926.1|702610_703609_-	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_131796103.1|704098_704770_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_028373928.1|705305_706082_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_028373929.1|706181_707126_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_028373930.1|707746_708223_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_028373931.1|708367_709156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028373932.1|709253_709685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051546224.1|709725_711498_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	40.0	1.2e-35
WP_028373934.1|711783_713106_+	amino acid permease	NA	NA	NA	NA	NA
WP_028373935.1|713156_714461_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_131796102.1|714741_715317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051546225.1|715681_716386_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_051546226.1|716517_718464_-	DotI/IcmL/TraM family protein	NA	NA	NA	NA	NA
WP_028373937.1|718672_719398_+	membrane protein	NA	NA	NA	NA	NA
WP_095141691.1|719439_720747_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_LT906451	Legionella lansingensis strain NCTC12830 chromosome 1	2989256	952210	959002	2989256		Acinetobacter_phage(42.86%)	9	NA	NA
WP_028374444.1|952210_952990_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	51.2	1.9e-57
WP_028374443.1|952986_954009_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.4	1.7e-74
WP_028374442.1|953986_954565_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	53.2	4.6e-56
WP_028374441.1|954743_955469_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	3.0e-20
WP_028374440.1|955465_955972_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_028374439.1|955964_956537_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_028374438.1|956533_957061_-	HAD hydrolase family protein	NA	A0A140XBD6	Dickeya_phage	50.0	1.8e-27
WP_028374437.1|957071_958034_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	33.1	1.1e-35
WP_028374436.1|958204_959002_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.2	3.0e-21
