The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT905062	Salmonella enterica subsp. enterica serovar Typhi isolate 403Ty-sc-1979084 chromosome 1	4676595	176965	249871	4676595	tRNA,capsid,plate,tail,protease,transposase	Burkholderia_virus(45.71%)	81	NA	NA
WP_000168626.1|176965_178240_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
WP_000765713.1|178988_179594_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000100913.1|179698_181204_-	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_001030324.1|181804_182440_-	endonuclease III	NA	NA	NA	NA	NA
WP_001289628.1|182439_183132_-	electron transport complex subunit E	NA	NA	NA	NA	NA
WP_000920820.1|183134_183755_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_000231887.1|183758_184817_-	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_000915581.1|184817_186839_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_001092600.1|186831_187410_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000133179.1|187409_187991_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_000214061.1|188067_188508_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000217946.1|188596_188812_-	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_031608772.1|189110_189236_-	division septum protein Blr	NA	NA	NA	NA	NA
WP_000998242.1|189443_190484_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000565566.1|190557_191559_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000753325.1|192264_193773_-	YdgA family protein	NA	NA	NA	NA	NA
WP_001170615.1|193875_195051_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000066606.1|195250_196897_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_000259129.1|197064_198468_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_000092483.1|198464_199394_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000928668.1|200880_202587_-	amidohydrolase	NA	NA	NA	NA	NA
WP_000824321.1|202739_203891_-	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
WP_001080045.1|204371_205103_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000524877.1|205229_205565_+	GlpM family protein	NA	NA	NA	NA	NA
WP_000412353.1|205626_207009_-	amino acid permease	NA	NA	NA	NA	NA
WP_001165548.1|207289_207862_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
WP_155522220.1|210271_210838_-|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	70.8	8.0e-37
WP_000852584.1|210840_211419_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
WP_001219103.1|211411_212515_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
WP_000859114.1|212505_212853_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
WP_000148263.1|212909_213437_-|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
WP_000808000.1|213433_214588_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
WP_000478221.1|214575_214788_-|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
WP_000458383.1|214787_215672_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.0	7.5e-50
WP_000135574.1|215671_218137_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.6	2.2e-168
WP_001148841.1|218230_218368_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084228.1|218312_218648_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110118.1|218745_219027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162828734.1|219029_219554_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.2	4.7e-68
WP_000729859.1|219550_220978_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
WP_000666498.1|220967_221219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|221218_221683_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|221682_222129_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|222130_222469_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286905.1|222478_223432_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
WP_001273072.1|223446_224562_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
WP_000135517.1|224776_225235_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
WP_000117561.1|225237_226059_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
WP_000090679.1|226039_227536_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
WP_170825686.1|227535_229077_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.0e-184
WP_000124060.1|229127_229673_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_000227700.1|229672_229984_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000175097.1|229983_230310_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000264664.1|230306_230957_-	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
WP_001104436.1|230940_231669_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.4	2.7e-61
WP_000793143.1|231671_232022_-	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
WP_100208317.1|232265_232862_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_144079282.1|232905_233289_+	hypothetical protein	NA	A4JWN3	Burkholderia_virus	58.9	1.7e-27
WP_000567463.1|233298_233463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000960673.1|235246_236413_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
WP_000843446.1|236415_236685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140134.1|236712_237243_+	host-nuclease inhibitor Gam family protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
WP_000632575.1|237531_237804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000197790.1|237813_238116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001315283.1|238112_238496_+	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
WP_153781233.1|238503_238704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000131941.1|238700_239384_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
WP_000631816.1|239380_239611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989166.1|239600_239816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001315282.1|239808_240258_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.6	9.4e-25
WP_001281695.1|240229_240619_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
WP_000769298.1|240800_241745_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001219360.1|242271_243801_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000014056.1|243811_245200_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_001118268.1|245374_246409_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000500278.1|246825_247188_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_001183821.1|247174_247504_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000549642.1|247538_248360_-|protease	serine protease	protease	NA	NA	NA	NA
WP_048659080.1|248628_248880_-	acid shock protein	NA	NA	NA	NA	NA
WP_000431187.1|249273_249456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000502119.1|249412_249871_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_LT905062	Salmonella enterica subsp. enterica serovar Typhi isolate 403Ty-sc-1979084 chromosome 1	4676595	693528	771727	4676595	terminase,plate,tail,head,protease,holin,transposase	Salmonella_phage(70.0%)	91	NA	NA
WP_000938184.1|693528_694209_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.1	4.1e-80
WP_000502118.1|694416_694875_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000374046.1|695537_696197_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904446.1|696283_696613_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|696609_696891_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000502118.1|697627_698086_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000140485.1|699217_700429_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|700486_700804_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|700848_701262_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|701435_702098_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|702192_702651_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420526.1|702686_704741_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
WP_001261222.1|704864_705311_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950867.1|705329_707483_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202371.1|707469_708075_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|708291_708801_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_010989142.1|709155_710208_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877174.1|710279_710732_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156455.1|710917_712678_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|712746_713265_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001764860.1|713364_713532_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|713785_714349_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433416.1|714345_715986_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|715990_717244_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053045.1|717258_719166_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_050159212.1|719178_721287_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
WP_000224084.1|721385_722495_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|722491_723034_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291724.1|723199_724210_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193884.1|724417_727030_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
WP_000480169.1|728046_728748_+	DUF1076 domain-containing protein	NA	NA	NA	NA	NA
WP_000421106.1|729669_730188_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
WP_001681975.1|730202_731714_-	hypothetical protein	NA	S4TP62	Salmonella_phage	59.4	1.5e-111
WP_000049938.1|731713_732394_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
WP_001197092.1|732390_733590_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
WP_001270647.1|733590_733944_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
WP_001685627.1|734184_734940_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
WP_001144794.1|734998_735427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050472.1|735426_736158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000826019.1|736352_736688_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
WP_000042301.1|736684_737716_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
WP_000388505.1|737718_738021_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
WP_000346974.1|738024_738675_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
WP_000990867.1|738674_740627_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
WP_000389047.1|740804_741257_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
WP_000257259.1|741260_741701_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
WP_001135544.1|741712_742858_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
WP_000389379.1|742861_743425_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
WP_001142488.1|743399_743789_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
WP_000008737.1|743775_744330_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
WP_001125675.1|744326_744734_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
WP_001040702.1|744699_745068_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
WP_000627464.1|745109_746051_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
WP_000128060.1|746062_746560_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
WP_000873182.1|746564_747797_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
WP_138010671.1|747811_748549_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	88.1	7.8e-101
WP_000113511.1|748433_749903_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
WP_000204794.1|749902_751306_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
WP_001118118.1|751271_752024_-	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
WP_001070544.1|752113_752341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000495544.1|752437_752815_-	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
WP_001050879.1|752857_753397_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	38.4	2.5e-08
WP_001075998.1|753393_754008_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
WP_000226307.1|754007_754289_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001294876.1|754275_754665_-|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
WP_001534733.1|755465_755591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047634.1|755989_756787_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
WP_001617856.1|756776_756923_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096560.1|756919_757531_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
WP_000929790.1|757739_758342_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001217670.1|758676_758916_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
WP_000963896.1|759100_759598_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000509711.1|759608_759788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208074.1|760633_761206_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
WP_000445792.1|761209_761683_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_000065105.1|761682_762207_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000113623.1|762203_762551_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000800010.1|762561_763311_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_001681803.1|763313_764297_-	replication protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
WP_001574095.1|764381_764756_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000869365.1|764721_764958_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	98.7	1.1e-37
WP_001009036.1|765087_765492_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
WP_000186242.1|765780_765981_+	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_000995349.1|766071_766368_+	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
WP_001764962.1|766373_767159_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
WP_000187053.1|767155_767836_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
WP_000034527.1|767913_768978_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
WP_010989138.1|768974_769856_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
WP_001754984.1|769861_770101_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	96.2	9.7e-37
WP_000065276.1|770141_770390_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262313.1|770434_771727_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	5.0e-252
>prophage 3
NZ_LT905062	Salmonella enterica subsp. enterica serovar Typhi isolate 403Ty-sc-1979084 chromosome 1	4676595	840685	847996	4676595	protease,integrase	Ralstonia_phage(16.67%)	7	835554:835568	846732:846746
835554:835568	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_001539594.1|840685_841063_+|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_001117984.1|841224_841422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934058.1|841633_843910_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
WP_000520789.1|843939_844260_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|844583_844805_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125880.1|844934_846881_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
846732:846746	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
WP_001201759.1|846877_847996_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
>prophage 4
NZ_LT905062	Salmonella enterica subsp. enterica serovar Typhi isolate 403Ty-sc-1979084 chromosome 1	4676595	1460408	1547567	4676595	tail,tRNA,plate	Salmonella_phage(42.11%)	65	NA	NA
WP_000118732.1|1460408_1461752_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001007105.1|1461755_1462292_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000312802.1|1462358_1462844_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_001171575.1|1463080_1463506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001147174.1|1463477_1463879_-	BPSL0067 family protein	NA	NA	NA	NA	NA
WP_000996818.1|1465463_1466006_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000175184.1|1466069_1466360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449770.1|1466445_1469109_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	34.8	9.8e-77
WP_000750542.1|1470364_1471189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000108006.1|1471185_1471680_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000371495.1|1471695_1473579_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000145233.1|1473575_1474571_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001670675.1|1476165_1476897_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
WP_000917872.1|1476960_1477428_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
WP_000801233.1|1477424_1478147_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052766.1|1478181_1478937_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644706.1|1479008_1480376_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
WP_000207227.1|1480431_1481202_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230964.1|1481279_1482080_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001127546.1|1482211_1483387_-	MFS transporter	NA	NA	NA	NA	NA
WP_000648539.1|1483491_1484406_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000154870.1|1484426_1485230_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.4	2.7e-38
WP_001235094.1|1491261_1493835_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
WP_000992642.1|1493964_1494696_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|1494692_1495673_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197667.1|1495804_1496542_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|1496813_1497152_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|1497255_1497303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200079.1|1497402_1498563_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210976.1|1498523_1499432_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225191.1|1499489_1500611_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|1500620_1501691_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212373.1|1502130_1502649_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030993.1|1502641_1503862_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	37.0	1.7e-07
WP_000065257.1|1504018_1504366_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469802.1|1504406_1505174_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|1505218_1505767_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|1505785_1506034_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|1506377_1507739_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|1507904_1508696_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|1508715_1510002_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001682111.1|1510122_1510680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|1510761_1511352_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|1511475_1512354_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880973.1|1512439_1514101_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|1514249_1514588_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|1514753_1515044_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|1515033_1515510_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|1515659_1516142_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237656.1|1516761_1527636_+	Ig-like domain repeat protein	NA	NA	NA	NA	NA
WP_000533850.1|1527699_1529109_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_010989217.1|1531292_1532456_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000151542.1|1532998_1533772_-	reverse transcriptase	NA	NA	NA	NA	NA
WP_000380485.1|1533740_1533914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972389.1|1534175_1534394_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
WP_001011760.1|1534484_1535585_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
WP_000980381.1|1535581_1536067_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
WP_001282796.1|1536063_1539141_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
WP_000763311.1|1539133_1539253_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001280897.1|1539267_1539570_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
WP_001207656.1|1539624_1540140_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_000046142.1|1540149_1541322_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
WP_000905027.1|1541464_1542031_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.1e-86
WP_001221113.1|1542714_1543830_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_001111827.1|1543910_1547567_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 5
NZ_LT905062	Salmonella enterica subsp. enterica serovar Typhi isolate 403Ty-sc-1979084 chromosome 1	4676595	1865576	1908758	4676595	bacteriocin,tRNA,integrase,protease,transposase	Bacillus_virus(25.0%)	47	1855692:1855705	1914689:1914702
1855692:1855705	attL	TTCACAACGCCAGC	NA	NA	NA	NA
WP_001204111.1|1865576_1866035_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000034386.1|1866224_1867304_-	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000111274.1|1867405_1868569_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_000218338.1|1868590_1869637_-	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000218564.1|1870010_1870436_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000124001.1|1870461_1871040_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_000553254.1|1871040_1871748_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_001775599.1|1871735_1872413_+	energy-coupling factor ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000956919.1|1872406_1873063_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
WP_000502119.1|1873167_1873626_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000098658.1|1873814_1875806_-	transketolase	NA	NA	NA	NA	NA
WP_000701830.1|1876081_1876840_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000105550.1|1876940_1877861_-	agmatinase	NA	NA	NA	NA	NA
WP_001278580.1|1878088_1880065_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_000729109.1|1880073_1880205_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_077905074.1|1880338_1880503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001803086.1|1880499_1880799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001062140.1|1880854_1882009_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
WP_001113171.1|1882501_1883896_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000856775.1|1883974_1884472_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286121.1|1884567_1885275_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001800534.1|1885351_1886083_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593242.1|1886102_1887050_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053167.1|1887265_1887829_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_001285491.1|1887828_1888245_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000098333.1|1888291_1888978_-	global regulatory protein	NA	NA	NA	NA	NA
WP_001055657.1|1889107_1890088_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997790.1|1890105_1890810_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_001094848.1|1890828_1891395_+	YggT family protein	NA	NA	NA	NA	NA
WP_001277205.1|1891391_1891682_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174773.1|1891689_1892283_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001096530.1|1892275_1893412_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000252198.1|1893502_1894510_-	DUF1202 domain-containing protein	NA	NA	NA	NA	NA
WP_000394189.1|1894642_1895689_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000502119.1|1896007_1896466_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000984827.1|1896588_1897308_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107559.1|1897357_1897684_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786887.1|1897683_1898403_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001148958.1|1898557_1899610_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091706.1|1899637_1899913_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000976287.1|1900025_1901111_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
WP_001049802.1|1901327_1902584_+	nucleoside permease	NA	NA	NA	NA	NA
WP_000234466.1|1905194_1905902_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001681938.1|1906243_1906528_+	DUF4102 domain-containing protein	NA	A0A0P0IRB7	Acinetobacter_phage	35.2	3.2e-10
WP_014341481.1|1906712_1907057_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_001141622.1|1908177_1908495_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_000768134.1|1908491_1908758_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
1914689:1914702	attR	TTCACAACGCCAGC	NA	NA	NA	NA
>prophage 6
NZ_LT905062	Salmonella enterica subsp. enterica serovar Typhi isolate 403Ty-sc-1979084 chromosome 1	4676595	2746426	2838781	4676595	lysis,tRNA,terminase,capsid,integrase,tail,plate,head,portal,protease,holin	Escherichia_phage(35.56%)	101	2779231:2779277	2808879:2808925
WP_000560975.1|2746426_2746864_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001259009.1|2747863_2748310_-	type II toxin-antitoxin system HigA family antitoxin	NA	NA	NA	NA	NA
WP_000558160.1|2748306_2748618_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_001162859.1|2748703_2749633_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001523745.1|2749837_2750080_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000238494.1|2750079_2750454_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_000027727.1|2750491_2751421_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829025.1|2751417_2752053_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331359.1|2752049_2752952_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_010989259.1|2752964_2756015_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	4.6e-06
WP_001059746.1|2756209_2757046_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000710970.1|2757321_2758353_-	YiiG family protein	NA	NA	NA	NA	NA
WP_000828046.1|2758534_2759635_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_000683586.1|2760300_2760960_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_010989258.1|2761042_2761609_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000619478.1|2761697_2762012_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000009255.1|2762008_2763157_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_000211475.1|2764167_2765427_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000143961.1|2765423_2766893_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217112.1|2767180_2768017_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000013291.1|2768169_2769018_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063537.1|2769014_2770049_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000378721.1|2770667_2771351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000566798.1|2771506_2772814_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_001091409.1|2772806_2773322_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000122632.1|2774651_2775272_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
WP_000559225.1|2775341_2776031_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000133445.1|2776042_2776438_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000580402.1|2776488_2777862_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_001033727.1|2777858_2778557_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	6.9e-06
WP_001233466.1|2778707_2779208_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
2779231:2779277	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000023386.1|2779392_2780373_-|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	99.7	2.3e-185
WP_001192857.1|2780442_2780736_-	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000453534.1|2780888_2781161_+	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_001333116.1|2781136_2781334_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	98.5	3.6e-29
WP_000217679.1|2781330_2781831_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	100.0	1.0e-91
WP_000557701.1|2781894_2782119_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_001277945.1|2782118_2782418_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	93.9	5.6e-42
WP_001113276.1|2782420_2782645_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	98.6	1.5e-34
WP_000027664.1|2782641_2782917_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_048659689.1|2782906_2785189_+	replication endonuclease	NA	Q858T4	Yersinia_virus	98.3	0.0e+00
WP_016236400.1|2785365_2785563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000556577.1|2785559_2786666_-	Fic family protein	NA	S4TP71	Salmonella_phage	78.0	7.2e-159
WP_000038161.1|2787216_2788251_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000156853.1|2788250_2790023_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_001085952.1|2790196_2791051_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_001248583.1|2791109_2792183_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	100.0	6.7e-202
WP_016239051.1|2792186_2792930_+|terminase	terminase endonuclease subunit	terminase	Q94MH8	Enterobacteria_phage	99.6	1.2e-125
WP_000988633.1|2793029_2793539_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_001773438.1|2793538_2793742_+|tail	tail protein X	tail	A0A0F7LCK1	Escherichia_phage	98.5	8.8e-31
WP_000123124.1|2793745_2794027_+|holin	phage holin family protein	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001144098.1|2794026_2794524_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	6.9e-93
WP_000736558.1|2794538_2794964_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	97.2	2.3e-60
WP_000040653.1|2794951_2795377_+|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	95.7	2.7e-66
WP_000917182.1|2795484_2795952_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.9e-81
WP_001001771.1|2795944_2796397_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	97.3	1.0e-74
WP_001093738.1|2796463_2797099_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	5.9e-113
WP_000127160.1|2797095_2797443_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	99.1	1.1e-57
WP_001121475.1|2797447_2798356_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	100.0	3.4e-162
WP_001000067.1|2798348_2798879_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	97.7	9.5e-101
WP_000104690.1|2798889_2800707_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	61.4	8.9e-122
WP_001761804.1|2800706_2801285_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	66.0	1.5e-67
WP_001286727.1|2801413_2802604_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	4.8e-225
WP_001251408.1|2802616_2803135_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031307.1|2803191_2803467_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|2803499_2803619_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069969.1|2803611_2806059_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.4	0.0e+00
WP_000978916.1|2806073_2806553_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	2.5e-84
WP_000882956.1|2806552_2807716_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	4.1e-205
WP_000468308.1|2807796_2808015_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001145759.1|2808283_2808796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001077323.1|2809003_2809900_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
2808879:2808925	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591793.1|2810084_2811047_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_050159237.1|2811250_2812240_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000750765.1|2812340_2813096_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000646490.1|2814706_2815666_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000557877.1|2815675_2816716_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_001764005.1|2816778_2817501_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000061016.1|2817598_2817769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001173084.1|2818074_2818356_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000113082.1|2818369_2819962_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001283049.1|2820048_2821008_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001167253.1|2821263_2822799_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	3.7e-20
WP_000911130.1|2822792_2823836_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_000981827.1|2823832_2824834_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000090739.1|2824862_2825885_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774152.1|2825913_2826789_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_001543603.1|2826871_2827162_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001088043.1|2827171_2827936_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_001216342.1|2828027_2828795_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802241.1|2828907_2829504_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155237.1|2829604_2830033_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000796307.1|2830139_2830886_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250624.1|2830982_2831993_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000137244.1|2832104_2833610_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084284.1|2833630_2834476_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000051368.1|2834874_2835114_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872918.1|2835335_2835821_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139635.1|2835913_2836843_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293355.1|2836909_2838241_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.5	6.4e-45
WP_000208240.1|2838250_2838781_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 7
NZ_LT905062	Salmonella enterica subsp. enterica serovar Typhi isolate 403Ty-sc-1979084 chromosome 1	4676595	2878625	2970198	4676595	lysis,tRNA,terminase,capsid,integrase,plate,tail,head,portal,transposase	Salmonella_phage(68.75%)	83	2868125:2868139	2970998:2971012
2868125:2868139	attL	GCGCGCCGCCACGGC	NA	NA	NA	NA
WP_000186987.1|2878625_2879726_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_000591414.1|2880099_2881944_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	30.0	2.2e-11
WP_000201804.1|2881888_2882740_+	glutamate racemase	NA	NA	NA	NA	NA
WP_000149790.1|2888650_2889679_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_000655746.1|2889675_2890638_+	bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA	NA	NA	NA	NA	NA
WP_000023068.1|2890672_2891623_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.5	7.9e-29
WP_001775645.1|2891831_2892005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000031748.1|2892581_2893766_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
WP_001275691.1|2893995_2894379_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_001287521.1|2894380_2894926_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_001085926.1|2895083_2895512_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_001096676.1|2895515_2896220_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_001207203.1|2896635_2897133_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_000028882.1|2897199_2897565_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_000263105.1|2897882_2901911_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653965.1|2901987_2906211_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.1	5.0e-67
WP_001576436.1|2906252_2906576_+	membrane protein	NA	NA	NA	NA	NA
WP_031624270.1|2906581_2906926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000359982.1|2907379_2907595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000643282.1|2907675_2908809_-	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_000944065.1|2908805_2909576_-	thiazole synthase	NA	NA	NA	NA	NA
WP_001166848.1|2909577_2909778_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_000999774.1|2909758_2910517_-	HesA/MoeB/ThiF family protein	NA	A0A1V0SAV8	Catovirus	28.5	7.0e-12
WP_000284626.1|2910509_2911145_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_048660668.1|2911144_2913040_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_000934311.1|2913403_2913892_-	sigma D regulator	NA	NA	NA	NA	NA
WP_000373954.1|2913984_2914758_+	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_000137619.1|2914798_2915863_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_000362359.1|2915872_2916544_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	2.1e-20
WP_000940092.1|2916585_2917176_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044509.1|2917362_2917635_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	57.8	5.5e-20
WP_000828129.1|2918379_2918835_-	zinc resistance sensor/chaperone ZraP	NA	NA	NA	NA	NA
WP_001772857.1|2919088_2920486_+	two-component system sensor histidine kinase ZraS	NA	NA	NA	NA	NA
WP_000617932.1|2920491_2921817_+	sigma-54-dependent response regulator transcription factor ZraR	NA	NA	NA	NA	NA
WP_000866776.1|2921813_2923103_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_001187501.1|2923118_2924708_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.4	8.4e-68
WP_001541181.1|2930767_2931616_-	HTH-type transcriptional regulator HdfR	NA	NA	NA	NA	NA
WP_000840996.1|2931722_2932061_+	macrodomain Ori organization protein MaoP	NA	NA	NA	NA	NA
WP_000502114.1|2932168_2932627_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000972391.1|2934208_2934427_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001011760.1|2934517_2935618_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
WP_000980381.1|2935614_2936100_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
WP_001282796.1|2936096_2939174_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
WP_000763311.1|2939166_2939286_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001280897.1|2939300_2939603_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
WP_001207656.1|2939657_2940173_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_000046142.1|2940182_2941355_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
WP_000905046.1|2941497_2942064_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.1e-86
WP_001086816.1|2944980_2945586_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
WP_000268271.1|2945578_2946487_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
WP_000177595.1|2946473_2946833_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
WP_000993754.1|2946829_2947408_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
WP_000829146.1|2947476_2947923_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
WP_001039939.1|2947915_2948347_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
WP_001080928.1|2948442_2948871_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	2.2e-47
WP_000727853.1|2948867_2949245_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_001069905.1|2949246_2949759_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000171568.1|2949739_2949955_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|2949958_2950162_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673504.1|2950161_2950626_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.4e-76
WP_000059191.1|2950721_2951372_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000742518.1|2951375_2952434_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
WP_000216244.1|2952450_2953284_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
WP_001098422.1|2953426_2955193_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000518064.1|2955192_2956230_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
WP_000185757.1|2956264_2957005_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_001146827.1|2957001_2957916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001251692.1|2958529_2959408_+	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	49.4	6.1e-52
WP_000822803.1|2959516_2959816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001580533.1|2959883_2960072_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
WP_000017503.1|2960225_2962640_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_000104152.1|2962636_2963494_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
WP_000752613.1|2963490_2963718_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244218.1|2963717_2963951_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
WP_000996717.1|2964018_2964360_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956176.1|2964477_2964774_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000460893.1|2964781_2965291_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_001247706.1|2965323_2965545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047327.1|2965670_2966240_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
WP_000900883.1|2966255_2966447_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_000290950.1|2966635_2967688_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_001311244.1|2968313_2968412_+	ilv operon leader peptide	NA	NA	NA	NA	NA
WP_001012546.1|2968551_2970198_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	1.5e-64
2970998:2971012	attR	GCGCGCCGCCACGGC	NA	NA	NA	NA
>prophage 8
NZ_LT905062	Salmonella enterica subsp. enterica serovar Typhi isolate 403Ty-sc-1979084 chromosome 1	4676595	3347548	3360202	4676595	integrase	Enterobacteria_phage(50.0%)	12	3338083:3338096	3351214:3351227
3338083:3338096	attL	GTTAATGTTAAAAC	NA	NA	NA	NA
WP_000152561.1|3347548_3349039_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	36.1	4.0e-11
WP_000772672.1|3349509_3350775_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	1.6e-74
WP_000573583.1|3350837_3351914_-	serine/threonine protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
3351214:3351227	attR	GTTTTAACATTAAC	NA	NA	NA	NA
WP_000700163.1|3351910_3352969_-	serine/threonine protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	4.9e-56
WP_000493739.1|3352958_3354122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214423.1|3354397_3354964_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
WP_000468230.1|3354979_3355219_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
WP_001779443.1|3355222_3355966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015701354.1|3356761_3357313_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.1e-30
WP_001216603.1|3357309_3357537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000795388.1|3357533_3357854_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783716.1|3357868_3360202_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	86.5	0.0e+00
>prophage 9
NZ_LT905062	Salmonella enterica subsp. enterica serovar Typhi isolate 403Ty-sc-1979084 chromosome 1	4676595	4013622	4019653	4676595		Salmonella_virus(50.0%)	6	NA	NA
WP_106417237.1|4013622_4013769_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	73.9	1.1e-14
WP_106417236.1|4013784_4013928_+	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	87.8	9.0e-14
WP_000400611.1|4014917_4016840_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.2	5.6e-300
WP_000703599.1|4016856_4017111_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_001682026.1|4017079_4017469_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	91.5	6.9e-56
WP_000377769.1|4018711_4019653_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	88.2	2.4e-147
>prophage 10
NZ_LT905062	Salmonella enterica subsp. enterica serovar Typhi isolate 403Ty-sc-1979084 chromosome 1	4676595	4254160	4263331	4676595	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|4254160_4255108_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|4255091_4255823_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|4255803_4255911_-	protein YohO	NA	NA	NA	NA	NA
WP_001240415.1|4255970_4256702_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272853.1|4256924_4258610_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
WP_000598632.1|4258606_4259326_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|4259372_4259840_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|4259896_4260427_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|4260598_4261057_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195338.1|4261297_4263331_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 11
NZ_LT905062	Salmonella enterica subsp. enterica serovar Typhi isolate 403Ty-sc-1979084 chromosome 1	4676595	4339222	4348389	4676595		Enterobacteria_phage(42.86%)	9	NA	NA
WP_001111852.1|4339222_4340626_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
WP_000981469.1|4340803_4341697_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|4342073_4343159_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023656.1|4343158_4344058_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
WP_000857536.1|4344105_4344984_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
WP_000973711.1|4344984_4345536_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
WP_000018220.1|4345541_4346516_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|4346531_4347305_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565909.1|4347309_4348389_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
>prophage 12
NZ_LT905062	Salmonella enterica subsp. enterica serovar Typhi isolate 403Ty-sc-1979084 chromosome 1	4676595	4433470	4440704	4676595		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|4433470_4433890_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457648.1|4433892_4435161_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
WP_000208507.1|4435606_4435819_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
WP_024131163.1|4435829_4436018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080666.1|4436278_4437463_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
WP_000107435.1|4438113_4438425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377043.1|4438504_4439200_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.5	2.1e-07
WP_001157299.1|4439273_4440704_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 13
NZ_LT905062	Salmonella enterica subsp. enterica serovar Typhi isolate 403Ty-sc-1979084 chromosome 1	4676595	4644367	4648779	4676595		Escherichia_phage(50.0%)	6	NA	NA
WP_000281950.1|4644367_4644781_+	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
WP_001766395.1|4644797_4645526_+	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
WP_000158843.1|4645717_4646260_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_001277616.1|4646407_4646785_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_001529135.1|4646857_4647667_-	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
WP_000497451.1|4648539_4648779_-	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
