The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT906621	Limosilactobacillus fermentum strain IMDO 130101 chromosome I	2089202	86494	223419	2089202	tRNA,transposase	Streptococcus_phage(18.42%)	111	NA	NA
WP_057194972.1|86494_87793_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.6	3.1e-92
WP_104877724.1|88295_89309_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_086439508.1|89565_90819_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	42.0	5.1e-84
WP_104877725.1|91287_92742_+	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_003685732.1|92745_93489_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.9	1.2e-32
WP_104877726.1|93947_95321_+	amino acid permease	NA	NA	NA	NA	NA
WP_086439505.1|96201_97401_+	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_104877727.1|97636_98557_+	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_104877728.1|98745_99483_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_104877729.1|99501_100437_+	nucleoid occlusion protein	NA	I3NLC2	Bifidobacterium_phage	33.6	6.2e-10
WP_104877730.1|100450_101284_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	32.9	1.0e-16
WP_003682416.1|101296_101497_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_057194965.1|101512_102610_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_104877731.1|102643_103417_+	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_104877732.1|103678_104821_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	32.6	6.7e-59
WP_104877733.1|105169_106165_+	LCP family protein	NA	NA	NA	NA	NA
WP_104877734.1|106164_106935_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_104877735.1|106951_107692_+	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_104877736.1|107715_108486_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_104877737.1|108516_109458_+	GDP-mannose 4,6-dehydratase	NA	A0A1V0SAI6	Catovirus	35.8	1.9e-43
WP_104877738.1|109411_110101_+	exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase	NA	NA	NA	NA	NA
WP_104877739.1|110137_110971_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_003688751.1|111765_112053_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010011610.1|112076_112955_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	2.0e-42
WP_104877741.1|113255_114467_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_104877742.1|114456_115356_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_104877743.1|115356_116343_+	Stealth CR1 domain-containing protein	NA	NA	NA	NA	NA
WP_158660361.1|117517_118963_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_104877745.1|119051_119279_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_104877746.1|119282_119975_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	35.2	1.3e-25
WP_158660362.1|120032_120269_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_104877748.1|120382_120889_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_031274475.1|121085_121775_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.6	2.4e-35
WP_104877749.1|121972_123115_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.0	1.9e-29
WP_104877750.1|123114_124410_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_104877751.1|124625_125501_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_086439459.1|125500_125920_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_014081459.1|126103_126502_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	1.1e-45
WP_104877752.1|126501_127677_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0ICY9	Lactobacillus_phage	54.9	2.0e-114
WP_069775946.1|127955_128501_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_104877753.1|128891_130106_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_086439787.1|130572_131613_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_099032535.1|131700_133362_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_086439785.1|133648_134134_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.5	5.2e-21
WP_104877754.1|134117_135257_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003686529.1|135297_136593_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.7	8.2e-21
WP_104877755.1|136954_137971_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_104877756.1|137982_139533_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_046025600.1|140067_140790_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SPE1	Cyanophage	36.4	1.2e-34
WP_012390750.1|140792_141035_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_099032496.1|141035_141716_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_104877757.1|141719_143945_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.6	1.8e-145
WP_104877758.1|143920_145384_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.5	2.7e-60
WP_104877759.1|145383_146421_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	39.8	9.4e-60
WP_046025598.1|146429_147011_+	phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_057195096.1|147012_148548_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.2	5.8e-74
WP_104877760.1|148821_150096_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_173677565.1|150123_150576_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.0	3.3e-33
WP_104877762.1|150644_151895_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.2	1.9e-54
WP_003682507.1|152311_153007_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_104877763.1|153130_154309_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_104877764.1|154421_155426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057195422.1|155910_156282_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_057195421.1|156295_156604_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_104877765.1|156603_158535_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.3	1.3e-91
WP_057195419.1|158815_160198_+	MFS transporter	NA	NA	NA	NA	NA
WP_003682515.1|160245_160722_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	35.2	7.7e-17
WP_158660363.1|166695_167850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104877752.1|167987_169163_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0ICY9	Lactobacillus_phage	54.9	2.0e-114
WP_014081459.1|169162_169561_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	1.1e-45
WP_104877768.1|169892_170528_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_099032586.1|170653_171043_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_081011462.1|171037_171172_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157950662.1|171149_171545_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_104877770.1|171779_172436_+	nitroreductase	NA	M1I6Q5	Acanthocystis_turfacea_Chlorella_virus	25.7	6.0e-12
WP_162495483.1|172850_173105_+	short-chain dehydrogenase/reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_062813485.1|174079_174274_+	CsbD family protein	NA	NA	NA	NA	NA
WP_104877771.1|174767_175136_+	DUF2255 family protein	NA	NA	NA	NA	NA
WP_104877772.1|175923_176508_+	cadmium resistance transporter	NA	NA	NA	NA	NA
WP_086439393.1|176606_177059_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.1e-32
WP_104877773.1|177137_178388_+|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	36.8	2.9e-55
WP_057195328.1|178737_179076_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_104877774.1|179617_181114_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_104877775.1|181309_183166_+	NEAT domain-containing protein	NA	NA	NA	NA	NA
WP_057195325.1|183155_183947_+	NEAT domain-containing protein	NA	NA	NA	NA	NA
WP_057195324.1|183961_184840_+	heme ABC transporter substrate-binding protein IsdE	NA	NA	NA	NA	NA
WP_104877776.1|184841_185768_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_104877777.1|185760_186522_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.5	3.0e-15
WP_104877778.1|186626_187559_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.7	1.5e-27
WP_057195321.1|187828_189133_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.5	4.8e-45
WP_086439392.1|189453_190293_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	62.8	1.4e-98
WP_104877779.1|196097_197069_+	2-hydroxyacid dehydrogenase family protein	NA	M1H502	Paramecium_bursaria_Chlorella_virus	31.7	5.4e-25
WP_164879419.1|197238_198450_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_086439934.1|198625_200284_-	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086439935.1|200373_201201_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_104877780.1|201336_202695_-	cytosine permease	NA	NA	NA	NA	NA
WP_104877781.1|203281_204640_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_104877782.1|204809_206030_+	allantoate deiminase	NA	NA	NA	NA	NA
WP_104877783.1|206045_206831_+	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_086439940.1|206850_207915_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_104877784.1|207935_209696_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_173677543.1|209695_210964_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_099032516.1|211784_212729_+	carbamate kinase	NA	NA	NA	NA	NA
WP_104877785.1|212846_213785_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_104877786.1|213861_214509_+	nitroreductase	NA	NA	NA	NA	NA
WP_104877787.1|214518_215250_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_104877788.1|215260_215575_+	MazG-like family protein	NA	A0A2R3ZXQ3	Staphylococcus_phage	39.4	5.1e-17
WP_046025890.1|216207_217458_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.5	2.9e-55
WP_104877789.1|217699_218740_+	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_104877790.1|218942_221468_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	26.5	9.3e-69
WP_046025890.1|222168_223419_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.5	2.9e-55
>prophage 2
NZ_LT906621	Limosilactobacillus fermentum strain IMDO 130101 chromosome I	2089202	259146	326661	2089202	protease,transposase,tRNA	Streptococcus_phage(11.76%)	50	NA	NA
WP_104877809.1|259146_260397_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.5	2.9e-55
WP_049184311.1|260582_261047_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_104877810.1|261183_261741_+	LemA family protein	NA	NA	NA	NA	NA
WP_057195290.1|261751_262651_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_057195291.1|262825_264205_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_104877811.1|264375_265854_+	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	38.0	1.1e-66
WP_003684028.1|265857_266217_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_003684030.1|266219_267341_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.9	3.2e-29
WP_021815621.1|267352_267706_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A2K9VCH5	Lactobacillus_phage	38.5	3.0e-10
WP_104877812.1|267838_268474_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003684038.1|268661_269222_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_104877813.1|269239_272779_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_012390804.1|272778_273051_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_003686487.1|273139_273496_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_057195299.1|273625_274132_+	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_104877814.1|274131_275481_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	25.9	2.6e-09
WP_104877815.1|275497_276046_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.1	6.1e-10
WP_099032501.1|276129_278295_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0CCN8	Ostreococcus_mediterraneus_virus	48.8	9.6e-107
WP_012390806.1|278371_279253_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_003684059.1|279341_280343_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003686497.1|280358_281852_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	41.4	1.6e-89
WP_104877816.1|289059_289473_+	glucose starvation-inducible protein B	NA	NA	NA	NA	NA
WP_104877817.1|289647_290520_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	40.2	7.0e-40
WP_068805819.1|291214_291574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104877778.1|291901_292834_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.7	1.5e-27
WP_104877819.1|293050_294613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104877820.1|294707_294896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104877821.1|294885_295242_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_104877822.1|295243_295465_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_104877823.1|295641_300078_+	KxYKxGKxW signal peptide domain-containing protein	NA	NA	NA	NA	NA
WP_104877824.1|301473_303699_+	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_104877825.1|303931_305428_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.5	2.3e-67
WP_104877826.1|305521_306367_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_104877827.1|306663_307305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004563349.1|307387_308101_+	amino acid racemase	NA	NA	NA	NA	NA
WP_003684331.1|308715_309879_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	71.7	1.8e-160
WP_104877828.1|310080_310782_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_104877829.1|310812_312273_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.9	2.8e-110
WP_104877830.1|312289_313120_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	56.5	3.6e-78
WP_104877831.1|313123_315301_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_104877832.1|315293_315749_+	SprT family protein	NA	NA	NA	NA	NA
WP_104877833.1|316035_317916_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	33.0	1.5e-95
WP_104877834.1|317899_318862_+	beta-galactosidase small subunit	NA	NA	NA	NA	NA
WP_062813458.1|319004_319961_+	AEC family transporter	NA	NA	NA	NA	NA
WP_104877835.1|320249_320927_+	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_104877836.1|320930_321806_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_104877837.1|322122_323460_-	C1 family peptidase	NA	A0A2H4UU28	Bodo_saltans_virus	27.6	9.6e-49
WP_057194463.1|323523_324138_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_104877838.1|324165_324852_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_046025890.1|325410_326661_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.5	2.9e-55
>prophage 3
NZ_LT906621	Limosilactobacillus fermentum strain IMDO 130101 chromosome I	2089202	665228	727156	2089202	tRNA,transposase,protease	Bacillus_phage(16.67%)	58	NA	NA
WP_086439447.1|665228_668021_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	25.0	2.4e-78
WP_003686347.1|668161_668374_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_104877982.1|668375_668924_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_057195043.1|668924_669161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003682112.1|669173_669881_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_104877983.1|669880_670225_+	DUF1831 domain-containing protein	NA	NA	NA	NA	NA
WP_003682110.1|670331_671465_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_086439458.1|671882_673478_+	amidohydrolase	NA	NA	NA	NA	NA
WP_086439446.1|673585_674518_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003682107.1|674726_675383_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003682106.1|675397_676087_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_104877984.1|676087_678634_+	AAA family ATPase	NA	A0A1P8DII4	Virus_Rctr197k	28.9	1.2e-31
WP_104877985.1|678704_679691_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	33.0	8.1e-37
WP_003686362.1|679722_680151_-	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_104877986.1|680374_681349_-	YegS/Rv2252/BmrU family lipid kinase	NA	NA	NA	NA	NA
WP_003682101.1|681608_681824_-	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_003682098.1|681950_682397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003686366.1|682502_683072_-	peptide deformylase	NA	A0A2I7S809	Vibrio_phage	41.3	5.8e-11
WP_104877987.1|683199_683487_+	UPF0223 family protein	NA	NA	NA	NA	NA
WP_104877988.1|683490_684255_+	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_104877989.1|684332_686180_+	translational GTPase TypA	NA	NA	NA	NA	NA
WP_104877990.1|686282_687482_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_003686372.1|687468_687765_+	YlbG family protein	NA	NA	NA	NA	NA
WP_003682085.1|687767_688328_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_057195368.1|688332_688854_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	38.0	1.4e-24
WP_104877991.1|688837_689887_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_173677550.1|689958_690627_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003682078.1|690681_691161_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	56.7	4.1e-34
WP_104877993.1|691161_693399_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	30.6	4.6e-27
WP_003682073.1|693416_694445_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_057195225.1|695753_696008_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_003682069.1|696253_696523_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_104877994.1|698215_700015_+	ribonuclease J	NA	NA	NA	NA	NA
WP_057195227.1|700105_701002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086439436.1|701182_702373_+	elongation factor Tu	NA	A0A1V0SGC3	Hokovirus	27.8	8.6e-33
WP_104877995.1|702544_703852_+	trigger factor	NA	NA	NA	NA	NA
WP_057195230.1|704002_705253_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.9	8.2e-135
WP_057195231.1|705266_705860_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003682052.1|705859_706159_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A1S7FYY8	Listeria_phage	51.5	6.9e-24
WP_003682050.1|706425_706572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173677567.1|706774_707506_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.2	4.6e-29
WP_104877996.1|707784_709596_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_104877997.1|709660_710968_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_003682045.1|710994_711927_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_173677551.1|711953_712787_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_104877999.1|712859_715157_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	3.4e-70
WP_024500798.1|715176_715698_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.0	2.3e-30
WP_104878000.1|716029_716407_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_003682040.1|716486_717485_-	D-2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	36.3	7.7e-51
WP_104878001.1|717986_718796_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_003682036.1|719145_719568_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_104878002.1|719570_720107_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003682029.1|720847_721156_-	membrane protein	NA	NA	NA	NA	NA
WP_104878003.1|721570_722758_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	2.0e-37
WP_104878004.1|722840_723719_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	1.2e-42
WP_003688751.1|723742_724030_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_104878005.1|724387_725608_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.0	1.4e-94
WP_104878006.1|726232_727156_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	1.5e-32
>prophage 4
NZ_LT906621	Limosilactobacillus fermentum strain IMDO 130101 chromosome I	2089202	731870	790941	2089202	tRNA,transposase,protease	unidentified_phage(16.67%)	50	NA	NA
WP_104878010.1|731870_732803_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.4	4.2e-27
WP_104878011.1|733053_734643_-	asparagine synthase B	NA	A0A0G2Y369	Acanthamoeba_polyphaga_mimivirus	39.9	5.6e-104
WP_104878012.1|737022_737967_+	3-hydroxyacyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_057194895.1|738048_738489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104878013.1|738499_739489_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003682001.1|739510_739957_-	nucleoside 2-deoxyribosyltransferase	NA	A0A1D3SPR3	Enterococcus_phage	36.7	2.4e-20
WP_104878014.1|740058_740679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057195093.1|740936_741155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057195092.1|741382_741649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104878015.1|742799_743633_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_154070666.1|743716_743878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057195090.1|743862_744171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076810712.1|744394_745075_+	serine dehydratase	NA	NA	NA	NA	NA
WP_086439354.1|745075_745963_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_003681984.1|745959_746274_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_046025890.1|747305_748556_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.5	2.9e-55
WP_057195086.1|749164_750334_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_104878016.1|750564_751191_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	52.9	3.8e-16
WP_057727693.1|751346_751598_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003685231.1|751674_751902_+	YneF family protein	NA	NA	NA	NA	NA
WP_086439860.1|751968_752601_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_057195082.1|752696_753449_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_057195081.1|753441_753732_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_021815938.1|753885_754665_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_057195080.1|754755_755634_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_003681954.1|755714_756440_+	UMP kinase	NA	NA	NA	NA	NA
WP_021815941.1|756439_757000_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_104878017.1|757126_757900_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	35.3	7.8e-19
WP_099032419.1|757916_758705_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_086439858.1|758726_759998_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_104878018.1|760031_761753_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	25.9	1.8e-07
WP_104878019.1|761892_766236_+	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	35.3	1.7e-14
WP_003681934.1|766627_767107_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_057195073.1|767126_768353_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003681930.1|768389_768692_+	YlxR family protein	NA	NA	NA	NA	NA
WP_057195072.1|768684_769008_+	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_104878020.1|769012_771346_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.6	5.6e-20
WP_104878021.1|771358_771721_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_104878022.1|771790_772687_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_096493789.1|772697_773663_+	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_104878023.1|776853_778254_+	amino acid permease	NA	NA	NA	NA	NA
WP_173677568.1|778982_779696_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_104878024.1|780650_781529_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	2.0e-42
WP_003688751.1|781552_781840_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_104878026.1|781995_782904_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	30.2	1.4e-11
WP_099032578.1|784503_785490_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_104878029.1|785647_787342_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_104878030.1|787350_788688_+	SLC45 family MFS transporter	NA	NA	NA	NA	NA
WP_081540359.1|788896_790036_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.6	1.0e-43
WP_104878031.1|790068_790941_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_LT906621	Limosilactobacillus fermentum strain IMDO 130101 chromosome I	2089202	1202980	1259532	2089202	tRNA,transposase	Bacillus_phage(27.27%)	48	NA	NA
WP_104878266.1|1202980_1203187_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_104878267.1|1203342_1204509_-	MFS transporter	NA	NA	NA	NA	NA
WP_104878268.1|1205134_1206058_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.0	3.7e-31
WP_104878269.1|1206166_1206982_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_104878270.1|1206985_1207840_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_104878271.1|1207845_1209144_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_104878272.1|1209271_1210411_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.3	2.4e-24
WP_104878273.1|1211860_1213000_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	5.1e-43
WP_104878274.1|1213174_1214086_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_104878275.1|1214203_1214830_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_104878276.1|1214884_1217389_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_062813825.1|1217390_1218473_-	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_104878752.1|1218502_1219378_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_104878277.1|1219418_1219856_-	signal peptidase II	NA	NA	NA	NA	NA
WP_003683310.1|1219855_1220290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104878278.1|1220302_1220704_+	ribonuclease HI family protein	NA	NA	NA	NA	NA
WP_104878279.1|1220859_1221462_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_104878280.1|1221685_1222549_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_104878281.1|1222762_1223452_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_187344546.1|1223538_1223706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010011610.1|1224370_1225249_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	2.0e-42
WP_003688751.1|1225272_1225560_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_104878282.1|1226321_1227800_+	amidase	NA	NA	NA	NA	NA
WP_104878283.1|1229480_1230812_+	Sapep family Mn(2+)-dependent dipeptidase	NA	NA	NA	NA	NA
WP_104878284.1|1231049_1232183_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_104878285.1|1232225_1232675_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_104878286.1|1232678_1233860_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_104878287.1|1233967_1235902_-	GTP-binding protein	NA	E4ZFJ7	Streptococcus_phage	30.7	2.1e-65
WP_015639179.1|1236554_1236914_-	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_104878288.1|1237021_1237618_-	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_086439759.1|1237708_1238344_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	36.6	8.7e-24
WP_104878289.1|1238336_1240601_+	transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_104878290.1|1240707_1241619_-	EamA family transporter	NA	NA	NA	NA	NA
WP_104878291.1|1241741_1242761_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_104878292.1|1243077_1244085_-	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_104878293.1|1244184_1244913_-	DnaD domain protein	NA	A0A0N7AE27	Bacillus_phage	43.5	2.7e-13
WP_004563225.1|1245004_1246300_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	29.2	7.4e-54
WP_057194687.1|1246326_1246845_-	DUF5590 domain-containing protein	NA	NA	NA	NA	NA
WP_104878294.1|1246895_1249736_-	3'-5' exoribonuclease	NA	A0A1X9I5C8	Streptococcus_phage	34.4	8.0e-61
WP_104878295.1|1249964_1250900_+	mevalonate kinase	NA	NA	NA	NA	NA
WP_104878296.1|1250901_1251891_+	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_104878297.1|1251910_1253020_+	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_057194692.1|1253075_1254161_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_004563232.1|1254316_1255114_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.8	1.5e-12
WP_104878298.1|1255124_1256006_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_104878299.1|1256001_1256937_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_057194695.1|1256908_1257772_-	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046025890.1|1258281_1259532_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.5	2.9e-55
>prophage 6
NZ_LT906621	Limosilactobacillus fermentum strain IMDO 130101 chromosome I	2089202	1264111	1323000	2089202	tRNA,transposase	Bacillus_phage(18.18%)	49	NA	NA
WP_157950660.1|1264111_1264270_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_104878303.1|1264283_1265030_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_157950661.1|1265139_1265262_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_086031793.1|1265428_1265656_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_104878304.1|1265832_1267605_-	oleate hydratase	NA	NA	NA	NA	NA
WP_035437582.1|1268090_1269422_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_104878305.1|1270053_1271793_+	pyruvate oxidase	NA	NA	NA	NA	NA
WP_162495478.1|1272832_1273054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003606447.1|1273744_1273993_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_104878306.1|1274236_1275253_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.1	2.7e-35
WP_104878307.1|1275409_1276516_-	anion permease	NA	NA	NA	NA	NA
WP_104878308.1|1278025_1279246_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.0	1.6e-95
WP_157950665.1|1279265_1279439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010579558.1|1279438_1279657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104878309.1|1280344_1281304_+	D-2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	30.9	2.3e-28
WP_010011610.1|1281556_1282435_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	2.0e-42
WP_003688751.1|1282458_1282746_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_104878310.1|1283163_1284303_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	32.8	7.4e-42
WP_104878311.1|1284552_1285470_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_104878312.1|1285482_1288662_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_104878313.1|1288661_1289744_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.9	1.7e-56
WP_057195398.1|1289745_1291035_-	dihydroorotase	NA	NA	NA	NA	NA
WP_057195397.1|1291034_1292000_-	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	29.9	4.5e-24
WP_104878314.1|1292334_1293129_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_104878315.1|1293237_1294206_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_104878316.1|1296983_1297862_-	type I-E CRISPR-associated endoribonuclease Cas2	NA	NA	NA	NA	NA
WP_104878317.1|1297865_1298804_-	type I-E CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_104878318.1|1298800_1299457_-	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_104878753.1|1299469_1300177_-	type I-E CRISPR-associated protein Cas5/CasD	NA	NA	NA	NA	NA
WP_104878319.1|1300157_1301267_-	type I-E CRISPR-associated protein Cas7/Cse4/CasC	NA	NA	NA	NA	NA
WP_104878320.1|1301275_1301860_-	type I-E CRISPR-associated protein Cse2/CasB	NA	NA	NA	NA	NA
WP_104878321.1|1301876_1303541_-	type I-E CRISPR-associated protein Cse1/CasA	NA	NA	NA	NA	NA
WP_104878322.1|1303521_1306266_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_003683897.1|1306495_1306855_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_104878323.1|1306975_1308403_-	amino acid permease	NA	NA	NA	NA	NA
WP_057194208.1|1308413_1309172_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_104878324.1|1309171_1309681_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003684331.1|1309835_1310999_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	71.7	1.8e-160
WP_004563246.1|1311570_1311831_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_003683887.1|1311845_1312121_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_104878326.1|1312250_1312955_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_104878327.1|1312969_1313725_-	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.0	6.1e-16
WP_104878328.1|1313737_1314619_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_104878329.1|1314620_1315520_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_104878330.1|1315519_1316395_-	phosphate ABC transporter substrate-binding protein	NA	E3SM63	Prochlorococcus_phage	28.5	7.8e-07
WP_004563250.1|1316677_1317382_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_104878331.1|1318429_1319380_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_104878754.1|1321807_1322098_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041812692.1|1322121_1323000_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.8	5.2e-43
>prophage 7
NZ_LT906621	Limosilactobacillus fermentum strain IMDO 130101 chromosome I	2089202	1346767	1408677	2089202	capsid,transposase,integrase,terminase,plate,tRNA,head,holin,protease,portal,tail	Lactobacillus_phage(86.0%)	74	1364883:1364901	1408678:1408696
WP_057194227.1|1346767_1347718_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	32.7	1.5e-11
WP_104878342.1|1347740_1350158_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_104878343.1|1350129_1351359_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	37.7	3.0e-49
WP_057194230.1|1351429_1351714_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_049182629.1|1351710_1352331_-	guanylate kinase	NA	A0A0M5KCK5	Mollivirus	38.9	2.2e-11
WP_104878344.1|1352523_1352841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104878345.1|1352932_1354627_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_104878346.1|1354644_1355094_-	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_104878347.1|1355107_1355923_-	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_104878348.1|1355932_1356808_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_057194235.1|1356807_1357101_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_104878349.1|1357100_1358549_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	30.7	2.8e-33
WP_104878350.1|1358549_1359407_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.3	2.2e-38
WP_057194237.1|1359584_1360004_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_003683803.1|1360003_1360444_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_104878351.1|1360534_1361611_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_104878352.1|1361754_1362678_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.7	1.8e-30
WP_003683800.1|1362754_1363036_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003683798.1|1363059_1363383_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003683797.1|1363395_1363704_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_104878353.1|1363867_1364509_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
1364883:1364901	attL	TGGTGCACATTTGGTGCAC	NA	NA	NA	NA
WP_104878354.1|1365476_1365938_-	GNAT family N-acetyltransferase	NA	E9LUK4	Lactobacillus_phage	99.3	5.1e-82
WP_104878355.1|1367033_1368281_-	LysM peptidoglycan-binding domain-containing protein	NA	E9LUK3	Lactobacillus_phage	98.6	1.7e-220
WP_104878356.1|1368283_1368751_-|holin	phage holin	holin	E9LUK2	Lactobacillus_phage	91.7	1.1e-65
WP_016058037.1|1368763_1369099_-	hypothetical protein	NA	E9LUK1	Lactobacillus_phage	100.0	6.5e-55
WP_104878755.1|1369117_1369819_-	hypothetical protein	NA	E9LUK0	Lactobacillus_phage	38.6	5.8e-29
WP_104878357.1|1369919_1370990_-|plate	BppU family phage baseplate upper protein	plate	NA	NA	NA	NA
WP_104878358.1|1371001_1372138_-	SGNH/GDSL hydrolase family protein	NA	D2KRC2	Lactobacillus_phage	30.5	1.6e-15
WP_104878359.1|1372149_1372407_-	hypothetical protein	NA	E9LUJ7	Lactobacillus_phage	63.3	4.7e-21
WP_164879406.1|1372409_1372586_-	hypothetical protein	NA	E9LUJ6	Lactobacillus_phage	93.1	2.7e-20
WP_104878360.1|1372582_1376020_-	hypothetical protein	NA	E9LUJ5	Lactobacillus_phage	43.3	3.8e-81
WP_104878361.1|1376023_1378105_-|tail	phage tail protein	tail	E9LUJ4	Lactobacillus_phage	95.7	0.0e+00
WP_104878362.1|1378116_1378944_-|tail	phage tail family protein	tail	E9LUJ3	Lactobacillus_phage	94.2	1.9e-151
WP_104878363.1|1378972_1383265_-|tail	phage tail tape measure protein	tail	E9LUJ2	Lactobacillus_phage	97.2	0.0e+00
WP_104878364.1|1383463_1383808_-	hypothetical protein	NA	E9LUJ0	Lactobacillus_phage	94.7	1.6e-56
WP_104878365.1|1383872_1384484_-|tail	phage tail protein	tail	E9LUI9	Lactobacillus_phage	96.1	7.1e-108
WP_104878366.1|1384499_1384904_-	hypothetical protein	NA	E9LUI8	Lactobacillus_phage	80.6	1.1e-59
WP_104878367.1|1384900_1385284_-	HK97 gp10 family phage protein	NA	E9LUI7	Lactobacillus_phage	84.3	6.1e-57
WP_031274812.1|1385267_1385615_-|head	phage head closure protein	head	E9LUI6	Lactobacillus_phage	99.1	1.4e-60
WP_016058021.1|1385601_1385910_-|head,tail	phage head-tail connector protein	head,tail	E9LUI5	Lactobacillus_phage	100.0	2.1e-52
WP_158660368.1|1385920_1386034_-	hypothetical protein	NA	L0P8M2	Lactobacillus_phage	62.2	1.2e-05
WP_104878368.1|1386057_1387176_-|capsid	phage major capsid protein	capsid	E9LUI4	Lactobacillus_phage	98.1	2.6e-201
WP_173677573.1|1387193_1387793_-|head,protease	HK97 family phage prohead protease	head,protease	D2KRA8	Lactobacillus_phage	97.0	4.7e-88
WP_104878370.1|1387764_1389030_-|portal	phage portal protein	portal	E9LUI2	Lactobacillus_phage	99.0	1.4e-238
WP_164879407.1|1389038_1389197_-	hypothetical protein	NA	D2KRA6	Lactobacillus_phage	98.1	3.2e-20
WP_104878371.1|1389209_1390919_-|terminase	terminase large subunit	terminase	E9LUI0	Lactobacillus_phage	98.9	0.0e+00
WP_104878372.1|1390915_1391371_-|terminase	P27 family phage terminase small subunit	terminase	E9LUH9	Lactobacillus_phage	99.3	2.7e-80
WP_104878373.1|1391542_1392328_-	AAA family ATPase	NA	E9LUN5	Lactobacillus_phage	97.7	4.6e-152
WP_104878374.1|1392732_1392939_+	CsbD family protein	NA	NA	NA	NA	NA
WP_104878375.1|1393012_1393462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104878376.1|1393616_1394450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104878377.1|1394979_1396131_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	69.3	2.3e-152
WP_104878378.1|1396364_1396838_-	hypothetical protein	NA	E9LUN3	Lactobacillus_phage	64.6	4.3e-52
WP_104878756.1|1396852_1397221_-	DUF3310 domain-containing protein	NA	E9LUN2	Lactobacillus_phage	58.2	2.4e-34
WP_104878379.1|1397216_1397699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173677557.1|1397822_1397981_-	hypothetical protein	NA	D2KRE6	Lactobacillus_phage	88.5	6.4e-21
WP_104878380.1|1397984_1398803_-	ATP-binding protein	NA	E9LUM7	Lactobacillus_phage	97.8	9.7e-153
WP_104878381.1|1398811_1399561_-	hypothetical protein	NA	E9LUM6	Lactobacillus_phage	97.2	9.6e-139
WP_104878382.1|1399575_1400010_-	single-stranded DNA-binding protein	NA	E9LUM5	Lactobacillus_phage	99.3	4.6e-77
WP_016058060.1|1400010_1400859_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	E9LUM4	Lactobacillus_phage	100.0	4.1e-170
WP_016058059.1|1400851_1401850_-	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	100.0	3.3e-171
WP_016058058.1|1401852_1402062_-	hypothetical protein	NA	E9LUM2	Lactobacillus_phage	100.0	2.8e-32
WP_173677558.1|1402272_1402410_-	hypothetical protein	NA	E9LUM0	Lactobacillus_phage	88.9	1.2e-12
WP_104878383.1|1402421_1402748_-	hypothetical protein	NA	E9LUL9	Lactobacillus_phage	99.1	2.1e-58
WP_104878384.1|1402946_1403135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104878385.1|1403227_1403419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104878386.1|1403430_1404210_-	Rha family transcriptional regulator	NA	E9LUL6	Lactobacillus_phage	95.7	6.2e-141
WP_104878387.1|1404249_1404465_-	helix-turn-helix transcriptional regulator	NA	E9LUL5	Lactobacillus_phage	98.6	1.9e-31
WP_104878388.1|1404614_1404944_+	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	84.0	3.2e-46
WP_104878389.1|1404947_1406021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158660369.1|1406361_1406499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104878390.1|1406515_1406956_+	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	37.4	1.9e-17
WP_104878391.1|1407003_1407516_+	hypothetical protein	NA	E9LUL0	Lactobacillus_phage	95.3	2.8e-65
WP_104878392.1|1407588_1408677_+|integrase	site-specific integrase	integrase	E9LUK6	Lactobacillus_phage	99.4	8.0e-203
1408678:1408696	attR	TGGTGCACATTTGGTGCAC	NA	NA	NA	NA
>prophage 8
NZ_LT906621	Limosilactobacillus fermentum strain IMDO 130101 chromosome I	2089202	1454874	1491943	2089202	tRNA,transposase,protease	Staphylococcus_phage(16.67%)	36	NA	NA
WP_003686193.1|1454874_1455507_-|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_057194279.1|1455630_1455948_-	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	30.9	2.4e-06
WP_003683689.1|1456123_1456456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003683688.1|1456662_1457310_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_104878416.1|1457327_1458512_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003686186.1|1458504_1459230_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	2.4e-22
WP_104878417.1|1459378_1459807_+	HIT family protein	NA	NA	NA	NA	NA
WP_104878418.1|1459808_1460042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104878419.1|1460120_1461113_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_104878420.1|1461204_1462161_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_104878421.1|1462312_1462675_-	YlbF family regulator	NA	NA	NA	NA	NA
WP_104878422.1|1462733_1464854_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_104878423.1|1466126_1467347_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.0	2.0e-93
WP_104878424.1|1467641_1468529_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_104878425.1|1469127_1469634_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_087717460.1|1469542_1469917_+|transposase	transposase	transposase	A0A1X9I619	Streptococcus_phage	42.0	6.0e-17
WP_003688751.1|1470006_1470294_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_104878426.1|1471307_1472369_-	hypothetical protein	NA	A0A1G5SA08	Enterococcus_phage	28.7	4.5e-25
WP_104878757.1|1472870_1473569_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	31.8	3.1e-22
WP_104878427.1|1474554_1475460_-	DUF2382 domain-containing protein	NA	NA	NA	NA	NA
WP_104878428.1|1476579_1477998_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_104878429.1|1478973_1480662_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	31.7	1.5e-67
WP_104878430.1|1481080_1481440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104878431.1|1481438_1481921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104878432.1|1481921_1483055_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	24.5	1.4e-08
WP_104878433.1|1483038_1483629_-	non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_057194291.1|1483609_1484890_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_104878434.1|1484886_1485459_-	GTP cyclohydrolase I FolE	NA	A0A2I7S8W4	Vibrio_phage	43.4	2.6e-35
WP_057194292.1|1485440_1485959_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003683659.1|1485948_1486320_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003686163.1|1486535_1487219_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_057194294.1|1487237_1488245_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_057194295.1|1488318_1488927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104878435.1|1489056_1489689_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	46.8	1.5e-47
WP_104878436.1|1489788_1490907_-	glycoside hydrolase family 73 protein	NA	A0A0K2CP65	Brevibacillus_phage	43.8	3.5e-20
WP_104878437.1|1491010_1491943_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	30.1	1.9e-27
>prophage 9
NZ_LT906621	Limosilactobacillus fermentum strain IMDO 130101 chromosome I	2089202	1609406	1640000	2089202	protease,transposase,tRNA	Bacillus_phage(33.33%)	25	NA	NA
WP_104878502.1|1609406_1610000_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_004563006.1|1610016_1610238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104878503.1|1610274_1610964_-	class I SAM-dependent methyltransferase	NA	A0A097BYE1	Leuconostoc_phage	40.7	5.9e-34
WP_104878504.1|1611168_1611741_-	NADPH-dependent F420 reductase	NA	NA	NA	NA	NA
WP_187344547.1|1611743_1612160_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_104878506.1|1612730_1614269_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_086439213.1|1614332_1614839_-|tRNA	prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_104878507.1|1616085_1617483_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_104878508.1|1617938_1618979_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_104878509.1|1619640_1620555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104878510.1|1621042_1622164_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_104878511.1|1622312_1622600_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_104878761.1|1622665_1623493_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	34.0	2.8e-38
WP_104878044.1|1623579_1624140_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_104878045.1|1624151_1624337_+	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_104878046.1|1624364_1624907_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_104878047.1|1624921_1625173_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_104878512.1|1625549_1626473_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	3.3e-32
WP_104878513.1|1626818_1627727_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	30.2	6.4e-12
WP_104878762.1|1627663_1628362_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	31.7	1.4e-22
WP_104878514.1|1629608_1630379_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_104878515.1|1630589_1633307_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_086440013.1|1634964_1635666_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	29.3	8.1e-23
WP_104878516.1|1635655_1638340_-	sensor histidine kinase KdpD	NA	NA	NA	NA	NA
WP_104878517.1|1638641_1640000_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_LT906621	Limosilactobacillus fermentum strain IMDO 130101 chromosome I	2089202	1789256	1862274	2089202	transposase,integrase	Streptococcus_phage(17.65%)	56	1779681:1779701	1829905:1829925
1779681:1779701	attL	CCAACCTCCTCGACGGGCCGT	NA	NA	NA	NA
WP_014081459.1|1789256_1789655_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	1.1e-45
WP_104878586.1|1791889_1792618_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_086439766.1|1792720_1792954_+	cytochrome B5	NA	NA	NA	NA	NA
WP_104878587.1|1793126_1793690_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q8W6R2	Burkholderia_virus	33.1	2.4e-09
WP_086439975.1|1793902_1794913_-	HoxN/HupN/NixA family nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_104878588.1|1794941_1795769_-	ATP-dependent sacrificial sulfur transferase LarE	NA	NA	NA	NA	NA
WP_086439973.1|1795793_1796504_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_104878589.1|1796505_1797870_-	nickel pincer cofactor biosynthesis protein LarC	NA	NA	NA	NA	NA
WP_099032569.1|1797869_1798628_-	nickel pincer cofactor biosynthesis protein LarB	NA	A0A288TYA6	Enterococcus_phage	47.2	3.7e-21
WP_104878590.1|1798635_1799919_-	nickel-dependent lactate racemase	NA	NA	NA	NA	NA
WP_086439969.1|1800159_1800831_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_086439317.1|1803045_1803582_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003681394.1|1803808_1804285_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_104878591.1|1804345_1805461_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	40.9	2.7e-73
WP_104878593.1|1806003_1807254_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	4.5e-56
WP_086439393.1|1807332_1807785_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	2.1e-32
WP_086439613.1|1807858_1808557_-	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_104878765.1|1808566_1809619_-	aspartate--ammonia ligase	NA	NA	NA	NA	NA
WP_104878594.1|1809769_1810366_+	glycoside hydrolase family 73 protein	NA	A0A0A7RUS8	Clostridium_phage	42.8	1.5e-22
WP_104878595.1|1810384_1810906_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_173677560.1|1811167_1812724_+	LytTR family transcriptional regulator	NA	O64031	Bacillus_phage	25.3	3.3e-32
WP_086439610.1|1812720_1813179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173677561.1|1814258_1814975_+	5-oxoprolinase subunit PxpB	NA	NA	NA	NA	NA
WP_086439608.1|1814975_1815992_+	biotin-dependent carboxyltransferase family protein	NA	NA	NA	NA	NA
WP_003681368.1|1815994_1816423_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_104878597.1|1816394_1817783_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_104878598.1|1817769_1818519_+	5-oxoprolinase subunit PxpA	NA	NA	NA	NA	NA
WP_104878599.1|1818531_1819743_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_104878600.1|1819834_1821004_-	MFS transporter	NA	NA	NA	NA	NA
WP_086439597.1|1821463_1822795_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.1	6.3e-24
WP_057727893.1|1823072_1823387_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	39.6	6.8e-14
WP_104878601.1|1823534_1824461_+	AEC family transporter	NA	NA	NA	NA	NA
WP_057194642.1|1824401_1824650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104878602.1|1824726_1826079_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	23.6	2.6e-17
WP_104878603.1|1826059_1827514_-	amino acid permease	NA	NA	NA	NA	NA
WP_104878604.1|1828438_1829269_-	YbgC/FadM family acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_104878605.1|1830119_1831502_-	argininosuccinate lyase	NA	NA	NA	NA	NA
1829905:1829925	attR	CCAACCTCCTCGACGGGCCGT	NA	NA	NA	NA
WP_104878606.1|1831501_1832791_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_104878607.1|1833000_1834878_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_104878608.1|1835041_1835743_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.3	1.9e-35
WP_162495480.1|1835752_1838314_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_104878610.1|1838406_1839456_-	G5 domain-containing protein	NA	NA	NA	NA	NA
WP_104878611.1|1839638_1841624_-	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	38.3	7.1e-32
WP_057194653.1|1841710_1842379_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015639495.1|1844812_1845133_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_104878612.1|1845218_1845962_-	arginase family protein	NA	NA	NA	NA	NA
WP_104878613.1|1846069_1847020_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_003681317.1|1847088_1847409_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_104878614.1|1847456_1848029_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_104878615.1|1852855_1855198_-	nitric-oxide reductase large subunit	NA	NA	NA	NA	NA
WP_104878616.1|1855858_1857412_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.6	1.7e-17
WP_057195360.1|1857726_1858338_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
WP_104878617.1|1858351_1859023_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	29.1	1.2e-18
WP_104878618.1|1859035_1860289_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_104877752.1|1860700_1861876_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A0P0ICY9	Lactobacillus_phage	54.9	2.0e-114
WP_104878766.1|1861875_1862274_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	61.4	2.1e-44
>prophage 11
NZ_LT906621	Limosilactobacillus fermentum strain IMDO 130101 chromosome I	2089202	1875293	1883703	2089202	transposase	Salmonella_phage(16.67%)	7	NA	NA
WP_003685341.1|1875293_1876016_-	nicotinamide mononucleotide transporter	NA	G3BLP7	Salmonella_phage	24.3	1.5e-11
WP_057194723.1|1876364_1877963_-	APC family permease	NA	NA	NA	NA	NA
WP_075667411.1|1878033_1878498_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	52.5	3.6e-35
WP_104878626.1|1878580_1879909_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	37.6	3.7e-61
WP_104878627.1|1880005_1881145_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.4	1.6e-44
WP_104878628.1|1881537_1882527_-	D-2-hydroxyacid dehydrogenase	NA	M1H9J0	Paramecium_bursaria_Chlorella_virus	34.0	3.4e-43
WP_162495481.1|1882590_1883703_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.2	3.5e-28
>prophage 12
NZ_LT906621	Limosilactobacillus fermentum strain IMDO 130101 chromosome I	2089202	2045197	2054285	2089202		Brazilian_cedratvirus(16.67%)	9	NA	NA
WP_104878714.1|2045197_2046136_+	phosphoglycerate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	32.9	3.5e-29
WP_104878715.1|2046137_2046620_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_031265527.1|2046836_2047631_+	nicotinamide mononucleotide transporter	NA	A0A0C5K6M3	Enterococcus_phage	33.9	1.8e-26
WP_104878716.1|2047736_2048246_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	50.6	1.1e-37
WP_104878717.1|2048254_2050159_-	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.5	4.8e-70
WP_173677578.1|2050295_2051597_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.7	1.0e-47
WP_104878719.1|2051703_2051997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057194137.1|2051989_2053150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104878720.1|2053142_2054285_-	AAA family ATPase	NA	A0A141HRX4	Bacillus_phage	31.1	1.7e-22
