The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT962928	Brucella melitensis isolate 1 chromosome 1	2116992	1040467	1050488	2116992	integrase,transposase	Brucella_phage(37.5%)	15	1035453:1035493	1050566:1050606
1035453:1035493	attL	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
WP_006135932.1|1040467_1041919_-	hypothetical protein	NA	A0A141GEY6	Brucella_phage	56.9	1.1e-135
WP_006135935.1|1042330_1043023_-	hypothetical protein	NA	A0A141GEY5	Brucella_phage	97.5	4.4e-106
WP_101415491.1|1043023_1043781_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	1.8e-15
WP_002966807.1|1044621_1044867_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_004683740.1|1044866_1045181_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	42.1	2.0e-05
WP_002964095.1|1045528_1045699_+	DUF1508 domain-containing protein	NA	A0A2P1N580	Mycobacterium_phage	45.1	3.1e-05
WP_004683739.1|1046046_1046757_-	porin family protein	NA	O11861	Bartonella_henselae_phage	36.8	5.1e-41
WP_002966806.1|1047102_1047579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964092.1|1047601_1047877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964091.1|1047873_1048104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005968944.1|1048100_1048805_-	hypothetical protein	NA	A0A076GD06	Sinorhizobium_phage	46.8	4.5e-05
WP_002964088.1|1048854_1049058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005968947.1|1049054_1049270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683737.1|1049272_1049476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004686457.1|1049462_1050488_+|integrase	site-specific integrase	integrase	A0A141GEZ3	Brucella_phage	36.7	5.6e-49
1050566:1050606	attR	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
>prophage 2
NZ_LT962928	Brucella melitensis isolate 1 chromosome 1	2116992	1119513	1131425	2116992	tRNA	uncultured_Mediterranean_phage(90.0%)	13	NA	NA
WP_014490079.1|1119513_1121841_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.5	6.2e-51
WP_002964021.1|1121959_1122301_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	9.1e-12
WP_002964020.1|1122460_1123327_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002964019.1|1123375_1124674_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	41.1	1.0e-18
WP_002964018.1|1124722_1124908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683704.1|1125052_1125721_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	38.5	6.6e-14
WP_004683703.1|1125717_1126485_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.2	1.0e-39
WP_004683702.1|1126633_1127917_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.2	2.6e-104
WP_002964014.1|1127993_1128818_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.1	9.8e-44
WP_006094283.1|1128814_1129381_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_002964012.1|1129491_1129710_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.1	1.5e-07
WP_002964011.1|1129855_1130581_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.7	1.5e-43
WP_004683698.1|1130573_1131425_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.5	4.4e-31
>prophage 3
NZ_LT962928	Brucella melitensis isolate 1 chromosome 1	2116992	1356121	1404523	2116992	portal,protease,tail,integrase	Paracoccus_phage(27.27%)	45	1346925:1346939	1360363:1360377
1346925:1346939	attL	CCGCTTCGCACTTTT	NA	NA	NA	NA
WP_004683363.1|1356121_1357048_+|integrase	site-specific integrase	integrase	A0A076YL28	Mesorhizobium_phage	31.6	5.9e-29
WP_004686530.1|1357410_1358544_+	pyridoxal phosphate-dependent aminotransferase	NA	A0A1X7QHI1	Faustovirus	24.2	2.4e-16
WP_006136160.1|1358561_1358936_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_004683357.1|1358980_1359631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683355.1|1360285_1361056_+	YitT family protein	NA	NA	NA	NA	NA
1360363:1360377	attR	CCGCTTCGCACTTTT	NA	NA	NA	NA
WP_004683353.1|1361115_1361373_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004686532.1|1361642_1361882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963776.1|1361878_1362226_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_004683348.1|1362284_1362995_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002971518.1|1363189_1363357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683346.1|1363353_1363521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683344.1|1363561_1365064_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_006136161.1|1365116_1366193_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_004683340.1|1366308_1368000_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_002963769.1|1368388_1369261_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_005969556.1|1369422_1370679_+	MFS transporter	NA	NA	NA	NA	NA
WP_002963767.1|1370683_1371643_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004685516.1|1371868_1374520_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_002963765.1|1374910_1377262_+	PAS-domain containing protein	NA	A0A1V0SGX0	Hokovirus	34.8	6.3e-27
WP_002966727.1|1377532_1379644_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_004685514.1|1379688_1382640_-	bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase	NA	NA	NA	NA	NA
WP_005969562.1|1382762_1384169_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_004683323.1|1384165_1384873_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004683321.1|1384966_1386508_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	1.7e-28
WP_004683319.1|1386649_1387126_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_002963758.1|1387122_1389114_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_002963757.1|1389133_1389631_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_004686536.1|1389627_1390767_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_002971524.1|1390867_1391320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969444.1|1391413_1392724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963753.1|1392798_1393488_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002971526.1|1393566_1393863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969445.1|1394024_1394231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006136163.1|1394295_1396953_-|tail	glycoside hydrolase/phage tail family protein	tail	A0A0B5A7K5	Paracoccus_phage	35.4	2.7e-143
WP_006136169.1|1396969_1398157_-	hypothetical protein	NA	A0A0B5A7K5	Paracoccus_phage	34.7	1.3e-36
WP_071152682.1|1398160_1398595_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_004683305.1|1398591_1399467_-	DUF2163 domain-containing protein	NA	A0A0K1Y6Z2	Rhodobacter_phage	38.9	4.5e-47
WP_002963747.1|1399463_1400096_-	TIGR02217 family protein	NA	A0A0B5A2K3	Paracoccus_phage	47.6	2.9e-48
WP_002970984.1|1400098_1400644_-|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	46.4	2.8e-07
WP_004683301.1|1400648_1400819_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_004683300.1|1400862_1401204_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_002963743.1|1401200_1401614_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_002967499.1|1401664_1402042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963736.1|1402038_1403232_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	40.0	7.0e-67
WP_005969588.1|1403263_1404523_-	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	40.6	1.3e-71
