The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT962924	Brucella melitensis isolate 1 chromosome 1	2117017	1040498	1050519	2117017	integrase,transposase	Brucella_phage(37.5%)	15	1035496:1035536	1050597:1050637
1035496:1035536	attL	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
WP_006135932.1|1040498_1041950_-	hypothetical protein	NA	A0A141GEY6	Brucella_phage	56.9	1.1e-135
WP_006135935.1|1042361_1043054_-	hypothetical protein	NA	A0A141GEY5	Brucella_phage	97.5	4.4e-106
WP_101415733.1|1043054_1043812_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	1.0e-15
WP_002966807.1|1044652_1044898_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_004683740.1|1044897_1045212_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	42.1	2.0e-05
WP_002964095.1|1045559_1045730_+	DUF1508 domain-containing protein	NA	A0A2P1N580	Mycobacterium_phage	45.1	3.1e-05
WP_004683739.1|1046077_1046788_-	porin family protein	NA	O11861	Bartonella_henselae_phage	36.8	5.1e-41
WP_002966806.1|1047133_1047610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964092.1|1047632_1047908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964091.1|1047904_1048135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005968944.1|1048131_1048836_-	hypothetical protein	NA	A0A076GD06	Sinorhizobium_phage	46.8	4.5e-05
WP_002964088.1|1048885_1049089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005968947.1|1049085_1049301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683737.1|1049303_1049507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004686457.1|1049493_1050519_+|integrase	site-specific integrase	integrase	A0A141GEZ3	Brucella_phage	36.7	5.6e-49
1050597:1050637	attR	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
>prophage 2
NZ_LT962924	Brucella melitensis isolate 1 chromosome 1	2117017	1119546	1131458	2117017	tRNA	uncultured_Mediterranean_phage(90.0%)	13	NA	NA
WP_014490079.1|1119546_1121874_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.5	6.2e-51
WP_002964021.1|1121992_1122334_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	9.1e-12
WP_002964020.1|1122493_1123360_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002964019.1|1123408_1124707_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	41.1	1.0e-18
WP_002964018.1|1124755_1124941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006267749.1|1125085_1125754_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	38.5	6.6e-14
WP_004683703.1|1125750_1126518_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.2	1.0e-39
WP_004683702.1|1126666_1127950_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.2	2.6e-104
WP_002964014.1|1128026_1128851_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.1	9.8e-44
WP_006094283.1|1128847_1129414_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_002964012.1|1129524_1129743_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.1	1.5e-07
WP_002964011.1|1129888_1130614_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.7	1.5e-43
WP_004683698.1|1130606_1131458_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.5	4.4e-31
>prophage 3
NZ_LT962924	Brucella melitensis isolate 1 chromosome 1	2117017	1356166	1404568	2117017	protease,integrase,tail,portal	Paracoccus_phage(27.27%)	45	1346970:1346984	1360408:1360422
1346970:1346984	attL	CCGCTTCGCACTTTT	NA	NA	NA	NA
WP_004683363.1|1356166_1357093_+|integrase	site-specific integrase	integrase	A0A076YL28	Mesorhizobium_phage	31.6	5.9e-29
WP_004686530.1|1357455_1358589_+	pyridoxal phosphate-dependent aminotransferase	NA	A0A1X7QHI1	Faustovirus	24.2	2.4e-16
WP_006154343.1|1358606_1358981_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_004683357.1|1359025_1359676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683355.1|1360330_1361101_+	YitT family protein	NA	NA	NA	NA	NA
1360408:1360422	attR	CCGCTTCGCACTTTT	NA	NA	NA	NA
WP_004683353.1|1361160_1361418_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004686532.1|1361687_1361927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963776.1|1361923_1362271_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_004683348.1|1362329_1363040_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002971518.1|1363234_1363402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683346.1|1363398_1363566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683344.1|1363606_1365109_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_006136161.1|1365161_1366238_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_004683340.1|1366353_1368045_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_002963769.1|1368433_1369306_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_005969556.1|1369467_1370724_+	MFS transporter	NA	NA	NA	NA	NA
WP_002963767.1|1370728_1371688_-	DMT family transporter	NA	NA	NA	NA	NA
WP_006267928.1|1371913_1374565_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_002963765.1|1374955_1377307_+	PAS-domain containing protein	NA	A0A1V0SGX0	Hokovirus	34.8	6.3e-27
WP_002966727.1|1377577_1379689_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_004685514.1|1379733_1382685_-	bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase	NA	NA	NA	NA	NA
WP_005969562.1|1382807_1384214_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_006154346.1|1384210_1384918_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004683321.1|1385011_1386553_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	1.7e-28
WP_006142039.1|1386694_1387171_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_002963758.1|1387167_1389159_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_002963757.1|1389178_1389676_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_004686536.1|1389672_1390812_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_002971524.1|1390912_1391365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969444.1|1391458_1392769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963753.1|1392843_1393533_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002971526.1|1393611_1393908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969445.1|1394069_1394276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006136163.1|1394340_1396998_-|tail	glycoside hydrolase/phage tail family protein	tail	A0A0B5A7K5	Paracoccus_phage	35.4	2.7e-143
WP_006136169.1|1397014_1398202_-	hypothetical protein	NA	A0A0B5A7K5	Paracoccus_phage	34.7	1.3e-36
WP_004683307.1|1398205_1398640_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_004683305.1|1398636_1399512_-	DUF2163 domain-containing protein	NA	A0A0K1Y6Z2	Rhodobacter_phage	38.9	4.5e-47
WP_002963747.1|1399508_1400141_-	TIGR02217 family protein	NA	A0A0B5A2K3	Paracoccus_phage	47.6	2.9e-48
WP_002970984.1|1400143_1400689_-|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	46.4	2.8e-07
WP_004683301.1|1400693_1400864_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_004683300.1|1400907_1401249_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_002963743.1|1401245_1401659_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_002967499.1|1401709_1402087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963736.1|1402083_1403277_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	40.0	7.0e-67
WP_005969588.1|1403308_1404568_-	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	40.6	1.3e-71
