The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT962932	Brucella melitensis isolate 1 chromosome 1	2117009	1040461	1050482	2117009	transposase,integrase	Brucella_phage(37.5%)	15	1035459:1035499	1050560:1050600
1035459:1035499	attL	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
WP_006135932.1|1040461_1041913_-	hypothetical protein	NA	A0A141GEY6	Brucella_phage	56.9	1.1e-135
WP_006135935.1|1042324_1043017_-	hypothetical protein	NA	A0A141GEY5	Brucella_phage	97.5	4.4e-106
WP_080723468.1|1043017_1043775_-|transposase	IS5-like element IS711 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	1.8e-15
WP_002966807.1|1044615_1044861_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_004683740.1|1044860_1045175_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	42.1	2.0e-05
WP_002964095.1|1045522_1045693_+	DUF1508 domain-containing protein	NA	A0A2P1N580	Mycobacterium_phage	45.1	3.1e-05
WP_004683739.1|1046040_1046751_-	porin family protein	NA	O11861	Bartonella_henselae_phage	36.8	5.1e-41
WP_002966806.1|1047096_1047573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964092.1|1047595_1047871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964091.1|1047867_1048098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005968944.1|1048094_1048799_-	hypothetical protein	NA	A0A076GD06	Sinorhizobium_phage	46.8	4.5e-05
WP_002964088.1|1048848_1049052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005968947.1|1049048_1049264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683737.1|1049266_1049470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004686457.1|1049456_1050482_+|integrase	site-specific integrase	integrase	A0A141GEZ3	Brucella_phage	36.7	5.6e-49
1050560:1050600	attR	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
>prophage 2
NZ_LT962932	Brucella melitensis isolate 1 chromosome 1	2117009	1119508	1131420	2117009	tRNA	uncultured_Mediterranean_phage(90.0%)	13	NA	NA
WP_014490079.1|1119508_1121836_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.5	6.2e-51
WP_002964021.1|1121954_1122296_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	9.1e-12
WP_002964020.1|1122455_1123322_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002964019.1|1123370_1124669_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	41.1	1.0e-18
WP_002964018.1|1124717_1124903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683704.1|1125047_1125716_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	38.5	6.6e-14
WP_004683703.1|1125712_1126480_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.2	1.0e-39
WP_004683702.1|1126628_1127912_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.2	2.6e-104
WP_002964014.1|1127988_1128813_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.1	9.8e-44
WP_006094283.1|1128809_1129376_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_002964012.1|1129486_1129705_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.1	1.5e-07
WP_070329561.1|1129850_1130576_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.7	1.5e-43
WP_004683698.1|1130568_1131420_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.5	4.4e-31
>prophage 3
NZ_LT962932	Brucella melitensis isolate 1 chromosome 1	2117009	1356153	1404555	2117009	integrase,portal,protease,tail	Paracoccus_phage(27.27%)	45	1346957:1346971	1360395:1360409
1346957:1346971	attL	CCGCTTCGCACTTTT	NA	NA	NA	NA
WP_004683363.1|1356153_1357080_+|integrase	site-specific integrase	integrase	A0A076YL28	Mesorhizobium_phage	31.6	5.9e-29
WP_004686530.1|1357442_1358576_+	pyridoxal phosphate-dependent aminotransferase	NA	A0A1X7QHI1	Faustovirus	24.2	2.4e-16
WP_006154343.1|1358593_1358968_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_004683357.1|1359012_1359663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683355.1|1360317_1361088_+	YitT family protein	NA	NA	NA	NA	NA
1360395:1360409	attR	CCGCTTCGCACTTTT	NA	NA	NA	NA
WP_004683353.1|1361147_1361405_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004686532.1|1361674_1361914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963776.1|1361910_1362258_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_004683348.1|1362316_1363027_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002971518.1|1363221_1363389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683346.1|1363385_1363553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683344.1|1363593_1365096_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_006136161.1|1365148_1366225_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_004683340.1|1366340_1368032_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_002963769.1|1368420_1369293_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_005969556.1|1369454_1370711_+	MFS transporter	NA	NA	NA	NA	NA
WP_002963767.1|1370715_1371675_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004685516.1|1371900_1374552_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_002963765.1|1374942_1377294_+	PAS-domain containing protein	NA	A0A1V0SGX0	Hokovirus	34.8	6.3e-27
WP_002966727.1|1377564_1379676_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_004685514.1|1379720_1382672_-	bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase	NA	NA	NA	NA	NA
WP_005969562.1|1382794_1384201_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_006154346.1|1384197_1384905_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004683321.1|1384998_1386540_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	1.7e-28
WP_075630328.1|1386681_1387158_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_002963758.1|1387154_1389146_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_002963757.1|1389165_1389663_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_004686536.1|1389659_1390799_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_002971524.1|1390899_1391352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969444.1|1391445_1392756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963753.1|1392830_1393520_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002971526.1|1393598_1393895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969445.1|1394056_1394263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006136163.1|1394327_1396985_-|tail	glycoside hydrolase/phage tail family protein	tail	A0A0B5A7K5	Paracoccus_phage	35.4	2.7e-143
WP_006136169.1|1397001_1398189_-	hypothetical protein	NA	A0A0B5A7K5	Paracoccus_phage	34.7	1.3e-36
WP_075630327.1|1398192_1398627_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_004683305.1|1398623_1399499_-	DUF2163 domain-containing protein	NA	A0A0K1Y6Z2	Rhodobacter_phage	38.9	4.5e-47
WP_002963747.1|1399495_1400128_-	TIGR02217 family protein	NA	A0A0B5A2K3	Paracoccus_phage	47.6	2.9e-48
WP_002970984.1|1400130_1400676_-|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	46.4	2.8e-07
WP_004683301.1|1400680_1400851_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_004683300.1|1400894_1401236_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_002963743.1|1401232_1401646_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_002967499.1|1401696_1402074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963736.1|1402070_1403264_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	40.0	7.0e-67
WP_005969588.1|1403295_1404555_-	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	40.6	1.3e-71
