The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LT962936	Brucella melitensis isolate 1 chromosome 1	2116986	1040483	1050504	2116986	integrase,transposase	Brucella_phage(37.5%)	15	1035481:1035521	1050582:1050622
1035481:1035521	attL	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
WP_006135932.1|1040483_1041935_-	hypothetical protein	NA	A0A141GEY6	Brucella_phage	56.9	1.1e-135
WP_006135935.1|1042346_1043039_-	hypothetical protein	NA	A0A141GEY5	Brucella_phage	97.5	4.4e-106
WP_095833205.1|1043039_1043797_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.2	6.1e-16
WP_002966807.1|1044637_1044883_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_004683740.1|1044882_1045197_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	42.1	2.0e-05
WP_002964095.1|1045544_1045715_+	DUF1508 domain-containing protein	NA	A0A2P1N580	Mycobacterium_phage	45.1	3.1e-05
WP_004683739.1|1046062_1046773_-	porin family protein	NA	O11861	Bartonella_henselae_phage	36.8	5.1e-41
WP_002966806.1|1047118_1047595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964092.1|1047617_1047893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964091.1|1047889_1048120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005968944.1|1048116_1048821_-	hypothetical protein	NA	A0A076GD06	Sinorhizobium_phage	46.8	4.5e-05
WP_002964088.1|1048870_1049074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005968947.1|1049070_1049286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683737.1|1049288_1049492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004686457.1|1049478_1050504_+|integrase	site-specific integrase	integrase	A0A141GEZ3	Brucella_phage	36.7	5.6e-49
1050582:1050622	attR	TGCGGGTATGATGTAATGGTAGCCTGTCAGCTTCCCAAGCT	NA	NA	NA	NA
>prophage 2
NZ_LT962936	Brucella melitensis isolate 1 chromosome 1	2116986	1119531	1131443	2116986	tRNA	uncultured_Mediterranean_phage(90.0%)	13	NA	NA
WP_014490079.1|1119531_1121859_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.5	6.2e-51
WP_002964021.1|1121977_1122319_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	9.1e-12
WP_002964020.1|1122478_1123345_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002964019.1|1123393_1124692_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	41.1	1.0e-18
WP_002964018.1|1124740_1124926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683704.1|1125070_1125739_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	38.5	6.6e-14
WP_004683703.1|1125735_1126503_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.2	1.0e-39
WP_004683702.1|1126651_1127935_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.2	2.6e-104
WP_002964014.1|1128011_1128836_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.1	9.8e-44
WP_006094283.1|1128832_1129399_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_002964012.1|1129509_1129728_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.1	1.5e-07
WP_070329561.1|1129873_1130599_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.7	1.5e-43
WP_004683698.1|1130591_1131443_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.5	4.4e-31
>prophage 3
NZ_LT962936	Brucella melitensis isolate 1 chromosome 1	2116986	1356154	1404556	2116986	portal,protease,integrase,tail	Paracoccus_phage(27.27%)	45	1346958:1346972	1360396:1360410
1346958:1346972	attL	CCGCTTCGCACTTTT	NA	NA	NA	NA
WP_004683363.1|1356154_1357081_+|integrase	site-specific integrase	integrase	A0A076YL28	Mesorhizobium_phage	31.6	5.9e-29
WP_004686530.1|1357443_1358577_+	pyridoxal phosphate-dependent aminotransferase	NA	A0A1X7QHI1	Faustovirus	24.2	2.4e-16
WP_006154343.1|1358594_1358969_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_004683357.1|1359013_1359664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683355.1|1360318_1361089_+	YitT family protein	NA	NA	NA	NA	NA
1360396:1360410	attR	CCGCTTCGCACTTTT	NA	NA	NA	NA
WP_004683353.1|1361148_1361406_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004686532.1|1361675_1361915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002963776.1|1361911_1362259_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_004683348.1|1362317_1363028_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002971518.1|1363222_1363390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683346.1|1363386_1363554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004683344.1|1363594_1365097_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_006136161.1|1365149_1366226_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_004683340.1|1366341_1368033_-	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_002963769.1|1368421_1369294_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_005969556.1|1369455_1370712_+	MFS transporter	NA	NA	NA	NA	NA
WP_002963767.1|1370716_1371676_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004685516.1|1371901_1374553_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_002963765.1|1374943_1377295_+	PAS-domain containing protein	NA	A0A1V0SGX0	Hokovirus	34.8	6.3e-27
WP_002966727.1|1377565_1379677_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_004685514.1|1379721_1382673_-	bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase	NA	NA	NA	NA	NA
WP_005969562.1|1382795_1384202_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_006154346.1|1384198_1384906_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004683321.1|1384999_1386541_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	1.7e-28
WP_006142039.1|1386682_1387159_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_002963758.1|1387155_1389147_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_002963757.1|1389166_1389664_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_004686536.1|1389660_1390800_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_002971524.1|1390900_1391353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969444.1|1391446_1392757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963753.1|1392831_1393521_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002971526.1|1393599_1393896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002969445.1|1394057_1394264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006136163.1|1394328_1396986_-|tail	glycoside hydrolase/phage tail family protein	tail	A0A0B5A7K5	Paracoccus_phage	35.4	2.7e-143
WP_006136169.1|1397002_1398190_-	hypothetical protein	NA	A0A0B5A7K5	Paracoccus_phage	34.7	1.3e-36
WP_004683307.1|1398193_1398628_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_004683305.1|1398624_1399500_-	DUF2163 domain-containing protein	NA	A0A0K1Y6Z2	Rhodobacter_phage	38.9	4.5e-47
WP_002963747.1|1399496_1400129_-	TIGR02217 family protein	NA	A0A0B5A2K3	Paracoccus_phage	47.6	2.9e-48
WP_002970984.1|1400131_1400677_-|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	46.4	2.8e-07
WP_004683301.1|1400681_1400852_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_004683300.1|1400895_1401237_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_002963743.1|1401233_1401647_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_002967499.1|1401697_1402075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002963736.1|1402071_1403265_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	40.0	7.0e-67
WP_005969588.1|1403296_1404556_-	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	40.6	1.3e-71
