The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483323	Streptococcus pyogenes strain NCTC8300 chromosome 1	1797476	36317	48630	1797476		Synechococcus_phage(28.57%)	8	NA	NA
WP_002987703.1|36317_40043_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	26.3	1.1e-38
WP_002987705.1|40203_41658_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	8.3e-54
WP_002987707.1|41685_42708_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	41.8	4.0e-63
WP_002987709.1|42875_43430_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.6	6.8e-25
WP_002987711.1|43613_45161_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.4	3.4e-45
WP_002987712.1|45218_46343_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
WP_002987714.1|46595_47861_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002987716.1|48138_48630_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	3.2e-18
>prophage 2
NZ_LS483323	Streptococcus pyogenes strain NCTC8300 chromosome 1	1797476	946188	1042802	1797476	transposase,head,capsid,portal,integrase,terminase,tail,tRNA	Streptococcus_phage(36.84%)	102	987996:988044	1028456:1028504
WP_002987950.1|946188_947322_-|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
WP_002989949.1|948326_948989_-	type II-A CRISPR-associated protein Csn2	NA	NA	NA	NA	NA
WP_002989951.1|948978_949320_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_002989953.1|949316_950186_-	type II CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_111689242.1|950185_954292_-	type II CRISPR RNA-guided endonuclease Cas9	NA	NA	NA	NA	NA
WP_002984851.1|954736_955369_-	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_002989958.1|955368_956133_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_011527617.1|956132_956885_-	acyl-[acyl-carrier-protein] thioesterase	NA	NA	NA	NA	NA
WP_002989962.1|956894_958025_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_002989964.1|958087_958729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002989965.1|958852_960208_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_002989967.1|960261_961218_-	YbbR-like domain-containing protein	NA	NA	NA	NA	NA
WP_002989969.1|961214_962066_-	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_002989971.1|962172_963516_+	Mur ligase family protein	NA	NA	NA	NA	NA
WP_002989973.1|963515_964307_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_002984861.1|964415_965405_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	23.9	4.1e-12
WP_111675087.1|965637_968055_+	polysaccharide lyase 8 family protein	NA	NA	NA	NA	NA
WP_002989978.1|968728_970492_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.5	1.2e-33
WP_002984866.1|970818_972228_-	dihydrolipoamide acetyltransferase	NA	NA	NA	NA	NA
WP_002989981.1|972412_973411_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_002989983.1|973469_974438_-	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_002989985.1|974724_976632_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.9	3.4e-55
WP_002989987.1|976677_977004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002989989.1|977033_977819_-	esterase family protein	NA	NA	NA	NA	NA
WP_002984872.1|977951_979613_-	ribonuclease J	NA	NA	NA	NA	NA
WP_002989991.1|979816_980575_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.3	5.9e-11
WP_002989993.1|980571_981441_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002989997.1|981785_982784_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002989998.1|983137_984790_+	PavA family fibronectin-binding protein Fbp54	NA	A0A1J0F9J4	Only_Syngen_Nebraska_virus	41.0	1.7e-07
WP_002990000.1|984848_986096_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_002990002.1|986085_987267_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002984880.1|987324_987801_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
987996:988044	attL	TTGATATGACAAGGTTCTTTAATGTTTTATTTAATCACTTCTTGAGTTT	NA	NA	NA	NA
WP_002987985.1|988383_989247_+|transposase	IS982-like element ISSpy2 family transposase	transposase	NA	NA	NA	NA
WP_002990004.1|989373_990084_-	streptococcal pyrogenic exotoxin SpeH	NA	NA	NA	NA	NA
WP_047373492.1|990109_990787_-	streptococcal pyrogenic exotoxin SpeI	NA	A0A075M4C7	Staphylococcus_phage	32.4	2.4e-27
WP_044565069.1|991060_992350_-	lysin	NA	Q5MY96	Streptococcus_phage	92.7	2.6e-237
WP_002990010.1|992435_992621_-	hypothetical protein	NA	Q938J5	Temperate_phage	95.1	1.9e-24
WP_002990012.1|992617_992914_-	hypothetical protein	NA	Q938J6	Temperate_phage	98.0	3.7e-46
WP_002990014.1|992924_993536_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	91.1	5.7e-81
WP_002987333.1|993538_993700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002990016.1|993713_995627_-	gp58-like family protein	NA	Q938J9	Temperate_phage	61.3	2.7e-92
WP_002990017.1|995639_996761_-	hyaluronoglucosaminidase	NA	A7J2A8	Streptococcus_phage	73.3	1.9e-127
WP_002990019.1|996757_998809_-|tail	phage tail protein	tail	A3F656	Streptococcus_phage	83.8	0.0e+00
WP_002988434.1|998805_999585_-|tail	phage tail family protein	tail	A3F655	Streptococcus_phage	55.6	9.2e-68
WP_010922222.1|999617_1003253_-	tape measure protein	NA	U6E979	Streptococcus_phage	28.0	4.0e-04
WP_002988428.1|1003267_1003597_-	hypothetical protein	NA	A0A1P8BLR3	Lactococcus_phage	40.6	5.7e-11
WP_002990023.1|1003638_1003992_-	hypothetical protein	NA	Q77RZ7	Lactococcus_phage	48.6	5.5e-20
WP_002990025.1|1004051_1004705_-|tail	phage major tail protein, TP901-1 family	tail	D7RWD5	Brochothrix_phage	53.3	6.6e-43
WP_002990026.1|1004714_1005104_-	hypothetical protein	NA	Q38611	Lactococcus_phage	69.0	1.6e-44
WP_002984399.1|1005100_1005466_-	HK97 gp10 family phage protein	NA	A0A097BY98	Enterococcus_phage	46.3	7.7e-17
WP_002990028.1|1005446_1005755_-	hypothetical protein	NA	A0A2P1JTW8	Anoxybacillus_phage	40.2	5.7e-13
WP_002990030.1|1005751_1006105_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4J002	uncultured_Caudovirales_phage	49.6	7.4e-25
WP_002990031.1|1006116_1006383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002990034.1|1006394_1007444_-|capsid	major capsid protein	capsid	B0YL60	Streptococcus_virus	56.9	2.6e-105
WP_002990036.1|1007446_1007827_-	structural protein	NA	A0A0K2CNR0	Brevibacillus_phage	36.3	6.4e-06
WP_002990039.1|1007836_1008370_-	DUF4355 domain-containing protein	NA	A0A141E0S7	Streptococcus_phage	82.5	1.8e-14
WP_002988396.1|1008513_1008780_-	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	72.7	1.7e-26
WP_002988389.1|1009165_1009351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002988386.1|1009354_1010917_-|head	phage head morphogenesis protein	head	U6E9F1	Streptococcus_phage	44.2	1.6e-47
WP_002988384.1|1010897_1012400_-|portal	phage portal protein	portal	C9W9H5	Streptococcus_virus	54.5	1.6e-140
WP_002988380.1|1012411_1013701_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4IYR5	uncultured_Caudovirales_phage	74.9	1.5e-184
WP_002990047.1|1013678_1014161_-|terminase	terminase small subunit	terminase	E0Y3R8	Staphylococcus_virus	40.3	3.3e-15
WP_002990048.1|1014366_1014579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002990050.1|1014668_1015583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002990052.1|1015897_1016338_-	ArpU family transcriptional regulator	NA	Q938L8	Temperate_phage	98.6	4.2e-78
WP_002990055.1|1016787_1017249_-	DUF1642 domain-containing protein	NA	A0A097PAV5	Streptococcus_pyogenes_phage	60.1	4.5e-46
WP_002990058.1|1017300_1017546_-	hypothetical protein	NA	A0A1P8VVL2	Streptococcus_phage	92.5	4.5e-21
WP_002990061.1|1017542_1017737_-	hypothetical protein	NA	A3F626	Streptococcus_phage	86.5	9.7e-11
WP_002990064.1|1017723_1018236_-	hypothetical protein	NA	Q708P9	Streptococcus_phage	73.2	2.9e-62
WP_002990067.1|1018232_1018571_-	hypothetical protein	NA	M1PKX3	Streptococcus_phage	37.5	4.0e-12
WP_002990069.1|1018766_1019795_-	DUF1351 domain-containing protein	NA	E8ZD61	Streptococcus_phage	65.6	7.2e-121
WP_002990071.1|1019804_1020596_-	phage recombination protein Bet	NA	A0A1S5SFP4	Streptococcus_phage	82.0	1.4e-119
WP_002988359.1|1020598_1020928_-	hypothetical protein	NA	J7KGX3	Streptococcus_phage	83.5	2.1e-45
WP_002990074.1|1020983_1021190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002988354.1|1021198_1021339_-	hypothetical protein	NA	A0A1X9I6Y1	Streptococcus_phage	54.5	3.4e-05
WP_002988350.1|1021335_1021569_-	hypothetical protein	NA	Q938N1	Temperate_phage	94.8	1.8e-35
WP_002990076.1|1021549_1021936_-	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	47.3	1.1e-24
WP_002990078.1|1022418_1022604_-	hypothetical protein	NA	Q938N3	Temperate_phage	90.2	1.2e-21
WP_002990080.1|1022605_1022917_-	hypothetical protein	NA	A0A1S5SA25	Streptococcus_phage	78.4	4.1e-43
WP_002990081.1|1023059_1023296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002990083.1|1023437_1024244_+	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	81.7	2.3e-122
WP_010922204.1|1024178_1024445_-	hypothetical protein	NA	A0A1S5SC19	Streptococcus_phage	66.3	1.1e-23
WP_002990086.1|1024476_1025202_-	phage antirepressor KilAC domain-containing protein	NA	A0A141E1D3	Streptococcus_phage	72.4	1.8e-94
WP_002990088.1|1025252_1025480_-	hypothetical protein	NA	A0A141E1R7	Streptococcus_phage	60.0	4.5e-15
WP_002990090.1|1025639_1026395_+	helix-turn-helix domain-containing protein	NA	A0A097PBE5	Streptococcus_pyogenes_phage	64.5	2.2e-82
WP_002990092.1|1026432_1027113_+	hypothetical protein	NA	A0A097PAS7	Streptococcus_pyogenes_phage	88.3	4.7e-76
WP_002990094.1|1027248_1028388_+|integrase	site-specific integrase	integrase	A1EAB7	Streptococcus_phage	56.3	3.4e-119
WP_002990096.1|1028481_1029522_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.9	1.5e-68
1028456:1028504	attR	TTGATATGACAAGGTTCTTTAATGTTTTATTTAATCACTTCTTGAGTTT	NA	NA	NA	NA
WP_002990099.1|1029765_1030359_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	H9NC63	Sphingomonas_phage	28.2	3.7e-08
WP_002990101.1|1030358_1031228_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	64.2	2.7e-100
WP_002990103.1|1031285_1032392_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_002984887.1|1032426_1033215_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_002990104.1|1033204_1033891_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_002990106.1|1033962_1034619_-	endonuclease III	NA	NA	NA	NA	NA
WP_002984890.1|1034615_1035299_-	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	36.8	2.9e-09
WP_002990109.1|1035379_1035898_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.4	3.9e-30
WP_002990110.1|1036048_1038259_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.2	3.9e-71
WP_002990111.1|1038255_1039020_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002984894.1|1039019_1039949_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_002990114.1|1039963_1040599_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_002990116.1|1040591_1041830_-	GTPase HflX	NA	NA	NA	NA	NA
WP_002990117.1|1041902_1042802_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_LS483323	Streptococcus pyogenes strain NCTC8300 chromosome 1	1797476	1134229	1144832	1797476		Streptococcus_phage(57.14%)	9	NA	NA
WP_002990253.1|1134229_1135372_-	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.5	7.7e-23
WP_002990255.1|1135606_1136047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002990257.1|1136076_1137345_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_111689245.1|1137432_1138785_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.0	4.5e-30
WP_111689246.1|1139005_1139347_-	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	42.0	6.9e-20
WP_002990262.1|1139407_1140574_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	4.5e-34
WP_002985140.1|1140667_1141354_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_002985142.1|1141350_1142514_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	3.4e-143
WP_024623374.1|1142621_1144832_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	68.8	2.5e-267
>prophage 4
NZ_LS483323	Streptococcus pyogenes strain NCTC8300 chromosome 1	1797476	1366504	1466291	1797476	transposase,head,protease,capsid,portal,bacteriocin,integrase,terminase,tail,tRNA	Streptococcus_phage(67.69%)	107	1424270:1424287	1466392:1466409
WP_002990771.1|1366504_1366705_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_002990774.1|1366717_1366945_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002985741.1|1368557_1369034_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_002985743.1|1369053_1369950_-	GTPase Era	NA	NA	NA	NA	NA
WP_002985746.1|1370069_1370477_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_002985748.1|1370457_1370955_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_002990783.1|1371113_1371689_-	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_002990786.1|1371734_1372787_-	PhoH family protein	NA	W8D063	Erwinia_phage	50.0	1.2e-46
WP_002990789.1|1372945_1374718_-	oleate hydratase	NA	NA	NA	NA	NA
WP_002990792.1|1375032_1376202_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XB61	Gordonia_phage	40.5	5.5e-16
WP_002985757.1|1376357_1376573_-	YozE family protein	NA	NA	NA	NA	NA
WP_002990794.1|1376569_1377079_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002990797.1|1377151_1378009_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002985763.1|1378117_1378675_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002985765.1|1378703_1379432_-	UMP kinase	NA	NA	NA	NA	NA
WP_002985768.1|1379753_1380443_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002990800.1|1380548_1380974_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002990803.1|1381217_1381571_+	DUF3397 domain-containing protein	NA	NA	NA	NA	NA
WP_002990805.1|1381640_1384046_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	51.4	2.2e-88
WP_002990808.1|1384262_1385069_+	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	36.6	1.5e-20
WP_002990814.1|1385216_1386071_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_002985780.1|1386071_1386797_-	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.6	1.4e-17
WP_002990817.1|1386860_1387793_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002990820.1|1387938_1388586_+	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_011527496.1|1388682_1388901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002990823.1|1389013_1389709_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_002990826.1|1389728_1389980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002990829.1|1389979_1390534_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_002990832.1|1390567_1391950_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L4K9	Tupanvirus	36.4	3.8e-32
WP_002985796.1|1392123_1393461_-	MFS transporter	NA	NA	NA	NA	NA
WP_002990834.1|1393793_1394753_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002990841.1|1394828_1395527_-	3-oxoacyl-ACP reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.2	1.6e-10
WP_002990844.1|1395519_1395756_-	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_011054856.1|1396415_1396598_-	hypothetical protein	NA	A3F673	Streptococcus_phage	83.3	1.5e-21
WP_011106647.1|1396830_1397817_+	DNA/RNA non-specific endonuclease	NA	A7J2B8	Streptococcus_phage	100.0	1.4e-169
WP_023077389.1|1397930_1398446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111689249.1|1398767_1399964_-	streptodornase Sda1	NA	A7J2B5	Streptococcus_phage	81.5	1.2e-194
WP_002988802.1|1400074_1400260_-	hypothetical protein	NA	Q938J5	Temperate_phage	93.4	9.5e-24
WP_111689250.1|1400256_1400553_-	hypothetical protein	NA	Q938J6	Temperate_phage	98.0	6.4e-46
WP_111689251.1|1400562_1401174_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	88.2	1.2e-78
WP_023613191.1|1401170_1401608_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	89.5	1.3e-63
WP_111689252.1|1401619_1403638_-	gp58-like family protein	NA	Q938J9	Temperate_phage	72.5	3.3e-178
WP_111689253.1|1403647_1404766_-	hyaluronoglucosaminidase	NA	A7J2A8	Streptococcus_phage	73.6	1.6e-126
WP_111689254.1|1404762_1406742_-|tail	phage tail protein	tail	A7J2A7	Streptococcus_phage	93.8	0.0e+00
WP_011054865.1|1406751_1407594_-	hypothetical protein	NA	A7J2A6	Streptococcus_phage	97.9	8.8e-157
WP_111689255.1|1407605_1411988_-	tape measure protein	NA	A7J2A5	Streptococcus_phage	76.0	1.5e-223
WP_011054867.1|1412002_1412236_-	hypothetical protein	NA	A7J2A4	Streptococcus_phage	97.4	6.4e-33
WP_111689256.1|1412310_1412766_-	hypothetical protein	NA	A7J2A3	Streptococcus_phage	98.0	4.5e-75
WP_011054869.1|1412819_1413419_-|tail	phage major tail protein, TP901-1 family	tail	A7J2A2	Streptococcus_phage	97.1	1.7e-90
WP_011054870.1|1413430_1413790_-	hypothetical protein	NA	A7J2A1	Streptococcus_phage	98.3	1.2e-57
WP_011106640.1|1413793_1414138_-	HK97 gp10 family phage protein	NA	A7J2A0	Streptococcus_phage	98.2	5.1e-55
WP_011054872.1|1414134_1414413_-	hypothetical protein	NA	A7J299	Streptococcus_phage	100.0	1.9e-47
WP_011054873.1|1414423_1414780_-|head,tail	phage head-tail connector protein	head,tail	A7J298	Streptococcus_phage	100.0	4.6e-59
WP_002983429.1|1414791_1415679_-	hypothetical protein	NA	A7J297	Streptococcus_phage	100.0	2.1e-161
WP_011054874.1|1415691_1416261_-	DUF4355 domain-containing protein	NA	A7J296	Streptococcus_phage	99.5	7.4e-83
WP_011054875.1|1416428_1416695_-	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	1.1e-36
WP_011054876.1|1416699_1416888_-	hypothetical protein	NA	A7J294	Streptococcus_phage	100.0	7.4e-24
WP_011054877.1|1416915_1418364_-|capsid	minor capsid protein	capsid	A7J293	Streptococcus_phage	99.6	1.3e-277
WP_011106638.1|1418323_1419856_-|portal	phage portal protein	portal	A7J292	Streptococcus_phage	99.6	9.9e-292
WP_011054879.1|1419871_1421149_-|terminase	PBSX family phage terminase large subunit	terminase	A7J291	Streptococcus_phage	100.0	1.1e-246
WP_011106637.1|1421138_1421591_-|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	100.0	6.9e-76
WP_011054881.1|1421680_1422097_-	transcriptional regulator	NA	A7J289	Streptococcus_phage	99.3	3.3e-72
WP_011054882.1|1422229_1422502_-	hypothetical protein	NA	A7J287	Streptococcus_phage	73.3	5.7e-25
WP_011054883.1|1422494_1422665_-	hypothetical protein	NA	A7J285	Streptococcus_phage	94.2	3.1e-21
WP_011054884.1|1422665_1423988_-	DEAD/DEAH box helicase family protein	NA	A7J284	Streptococcus_phage	97.3	7.3e-251
WP_011054885.1|1423984_1424260_-	VRR-NUC domain-containing protein	NA	A7J283	Streptococcus_phage	96.7	2.9e-45
1424270:1424287	attL	TTTGGTCAATAAAGGTCA	NA	NA	NA	NA
WP_011054886.1|1424625_1427010_-	DNA primase	NA	A7J282	Streptococcus_phage	98.0	5.7e-286
WP_011054887.1|1427014_1428937_-	DNA polymerase	NA	A7J280	Streptococcus_phage	98.3	0.0e+00
WP_011054888.1|1428979_1429543_-	DUF2815 family protein	NA	D2J040	Enterococcus_phage	57.9	5.6e-51
WP_011054889.1|1429556_1430714_-	DUF2800 domain-containing protein	NA	A7J278	Streptococcus_phage	99.2	8.5e-219
WP_000573833.1|1430713_1431013_-	hypothetical protein	NA	A7J277	Streptococcus_phage	99.0	2.3e-43
WP_011054890.1|1431100_1431304_-	hypothetical protein	NA	A7J276	Streptococcus_phage	94.0	1.2e-30
WP_011054892.1|1431449_1431833_-	hypothetical protein	NA	A7J274	Streptococcus_phage	93.7	5.9e-60
WP_021734004.1|1431829_1432036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011054894.1|1432028_1432199_-	hypothetical protein	NA	A7J273	Streptococcus_phage	92.9	9.0e-21
WP_011054895.1|1432227_1432485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011054896.1|1432572_1432803_-	hypothetical protein	NA	A7J271	Streptococcus_phage	92.0	3.4e-31
WP_001283052.1|1432823_1433015_-	hypothetical protein	NA	A7J270	Streptococcus_phage	100.0	7.3e-27
WP_011184049.1|1433653_1434004_+	helix-turn-helix transcriptional regulator	NA	M1I9X0	Streptococcus_phage	85.3	1.2e-48
WP_011054898.1|1434017_1434401_+	hypothetical protein	NA	A7J268	Streptococcus_phage	99.2	1.5e-68
WP_011054899.1|1434411_1434963_+	hypothetical protein	NA	A7J267	Streptococcus_phage	94.0	1.5e-88
WP_011054900.1|1435138_1436227_+|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	72.6	6.4e-152
WP_002990848.1|1436446_1437415_+	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	52.3	1.2e-88
WP_002990849.1|1437926_1438559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002990852.1|1438652_1438904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011527491.1|1439144_1439558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002990857.1|1440000_1440435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019418816.1|1440930_1441413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002990865.1|1441877_1442630_+	ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_002990868.1|1442834_1445015_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	43.3	4.3e-171
WP_111689257.1|1444981_1445470_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	37.5	7.6e-12
WP_010921941.1|1445473_1446487_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	53.7	2.5e-97
WP_002990879.1|1446980_1448981_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.1	3.5e-87
WP_002990882.1|1449220_1449928_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_111689258.1|1450699_1455643_-|protease	CXC chemokine-degrading serine protease SpyCEP	protease	NA	NA	NA	NA
WP_012560476.1|1455907_1457089_-	L-lactate oxidase	NA	NA	NA	NA	NA
WP_002990895.1|1457322_1458150_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.5	2.9e-128
WP_002990897.1|1458223_1458580_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.0	1.1e-39
WP_002990900.1|1458878_1459508_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_002985833.1|1459554_1459947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002990904.1|1459973_1460837_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	74.7	1.5e-114
WP_002985838.1|1460841_1461165_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_002990914.1|1461828_1462704_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	43.8	1.0e-62
WP_002990917.1|1462721_1463357_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.4	2.7e-65
WP_111689259.1|1463519_1464653_-|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
WP_002990928.1|1464912_1465206_-	YlbG family protein	NA	NA	NA	NA	NA
WP_002985850.1|1465700_1466291_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	55.7	2.6e-54
1466392:1466409	attR	TTTGGTCAATAAAGGTCA	NA	NA	NA	NA
