The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483331	Streptococcus pyogenes strain NCTC12057 chromosome 1	1848740	36638	48950	1848740		Synechococcus_phage(28.57%)	8	NA	NA
WP_023612102.1|36638_40364_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	26.8	2.1e-40
WP_023612105.1|40524_41979_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.3	6.3e-54
WP_023612098.1|42006_43029_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	41.5	4.0e-63
WP_002986700.1|43196_43751_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	2.4e-25
WP_023612109.1|43934_45482_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.4	4.4e-45
WP_010921776.1|45538_46663_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
WP_023612108.1|46915_48181_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_023612097.1|48458_48950_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.1	3.8e-19
>prophage 2
NZ_LS483331	Streptococcus pyogenes strain NCTC12057 chromosome 1	1848740	346471	352506	1848740		Streptococcus_phage(100.0%)	8	NA	NA
WP_002990917.1|346471_347107_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.4	2.7e-65
WP_002985844.1|347124_348000_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	46.6	2.1e-68
WP_002985838.1|348662_348986_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_021733048.1|348990_349854_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	74.7	3.8e-115
WP_002985833.1|349880_350273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009880724.1|350319_350949_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_011284536.1|351248_351605_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.8	6.3e-40
WP_023078944.1|351678_352506_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.5	3.8e-128
>prophage 3
NZ_LS483331	Streptococcus pyogenes strain NCTC12057 chromosome 1	1848740	647559	658163	1848740		Streptococcus_phage(57.14%)	9	NA	NA
WP_044559748.1|647559_649770_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	68.9	6.5e-268
WP_023612435.1|649877_651041_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	3.4e-143
WP_002985140.1|651037_651724_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_002990262.1|651817_652984_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	4.5e-34
WP_002990260.1|653044_653386_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	41.1	2.6e-19
WP_023612440.1|653607_654960_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.7	5.9e-30
WP_002990257.1|655047_656316_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_012560601.1|656345_656786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011184383.1|657020_658163_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.3	1.4e-24
>prophage 4
NZ_LS483331	Streptococcus pyogenes strain NCTC12057 chromosome 1	1848740	958078	1032795	1848740	capsid,protease,head,holin,integrase,tRNA,tail,portal,terminase	Streptococcus_phage(52.24%)	97	991431:991490	1032838:1032933
WP_023612481.1|958078_958963_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_023612473.1|959078_960419_-	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
WP_023612470.1|960515_961472_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_002993908.1|961482_962079_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_023612475.1|962170_964807_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_023612464.1|964821_965523_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	1.3e-36
WP_023612443.1|965640_966183_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002984480.1|966325_966967_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023612454.1|967129_967618_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_023612456.1|967628_967829_-	CsbD family protein	NA	J7KJ36	Streptococcus_phage	51.5	1.8e-07
WP_002984475.1|967869_968409_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002984473.1|968421_968610_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002984470.1|968620_969232_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002984469.1|969268_969517_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_023612212.1|969879_972198_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	40.9	2.3e-130
WP_023612223.1|972726_974049_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_023612209.1|974168_975404_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_023612220.1|975773_976547_-	CAMP factor pore-forming toxin Cfa	NA	NA	NA	NA	NA
WP_002989634.1|976916_977753_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023612213.1|977768_978398_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	1.7e-27
WP_002992417.1|978407_979049_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002989626.1|979155_979491_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_023612218.1|979686_981501_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	38.6	6.8e-98
WP_023612216.1|981676_982234_-	signal peptidase I	NA	NA	NA	NA	NA
WP_002984447.1|982451_983954_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_002984444.1|984016_985030_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_023612222.1|985109_988220_-	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	29.9	8.3e-120
WP_002989617.1|988404_988776_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002984437.1|988775_989474_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.3	6.6e-09
WP_002984433.1|989483_990269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023612208.1|990395_991010_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	51.8	4.0e-50
991431:991490	attL	ACTCCCACCAGCTCCATCAATGCTTACCGTAAGTAATCATAACTTACTAAAACCTTGTTA	NA	NA	NA	NA
WP_032461628.1|991600_991789_-	hypothetical protein	NA	A3F673	Streptococcus_phage	81.4	6.5e-20
WP_011184727.1|992028_992787_+	DNase Mf2	NA	NA	NA	NA	NA
WP_021733756.1|992897_993605_+	streptococcal pyrogenic exotoxin SpeC	NA	A0A097PAT7	Streptococcus_pyogenes_phage	26.7	5.1e-09
WP_023611694.1|993673_994426_-	SH3 domain-containing protein	NA	A3F665	Streptococcus_phage	97.2	2.1e-141
WP_021733507.1|994427_994760_-|holin	phage holin	holin	A3F664	Streptococcus_phage	98.2	2.8e-50
WP_021733504.1|994772_995093_-	hypothetical protein	NA	A3F663	Streptococcus_phage	99.1	1.2e-50
WP_032461629.1|995103_995715_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	93.6	1.1e-84
WP_002987513.1|995717_996149_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	100.0	1.1e-73
WP_032461630.1|996160_998044_-	gp58-like family protein	NA	Q938J9	Temperate_phage	96.5	8.0e-251
WP_032461631.1|998058_999072_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	98.5	9.5e-182
WP_032461632.1|999068_1001213_-|tail	phage tail protein	tail	Q938K1	Temperate_phage	98.2	0.0e+00
WP_024623478.1|1001209_1001917_-	hypothetical protein	NA	Q938K2	Temperate_phage	70.6	1.7e-92
WP_032461633.1|1001916_1005840_-|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	49.1	2.6e-243
WP_021299462.1|1005852_1006002_-	hypothetical protein	NA	J7KBS0	Streptococcus_phage	85.7	1.7e-15
WP_021733367.1|1006049_1006376_-	hypothetical protein	NA	J7KK85	Streptococcus_phage	75.0	6.4e-39
WP_021341058.1|1006428_1007040_-|tail	phage major tail protein	tail	J7KKC8	Streptococcus_phage	73.0	1.8e-74
WP_021341057.1|1007056_1007482_-	hypothetical protein	NA	J7KBZ9	Streptococcus_phage	85.8	2.9e-68
WP_021340627.1|1007478_1007856_-	HK97 gp10 family phage protein	NA	J7KDM3	Streptococcus_phage	73.6	1.8e-45
WP_029714354.1|1007852_1008200_-|head	phage head closure protein	head	J7KJ42	Streptococcus_phage	84.5	2.1e-48
WP_021341088.1|1008196_1008499_-|head,tail	phage head-tail connector protein	head,tail	J7KC36	Streptococcus_phage	87.8	2.6e-42
WP_021341090.1|1008643_1009828_-|capsid	phage major capsid protein	capsid	J7KJ82	Streptococcus_phage	76.1	1.2e-162
WP_021341143.1|1009851_1010517_-|protease	Clp protease ClpP	protease	M1Q115	Streptococcus_phage	78.6	5.4e-93
WP_032461634.1|1010494_1011715_-|portal	phage portal protein	portal	J7KDU3	Streptococcus_phage	81.7	3.4e-186
WP_002985363.1|1011748_1011973_-	hypothetical protein	NA	Q938K9	Temperate_phage	61.4	3.6e-17
WP_002985365.1|1011965_1012136_-	hypothetical protein	NA	J7KK43	Streptococcus_phage	62.5	2.3e-08
WP_032461635.1|1012132_1013887_-|terminase	terminase large subunit	terminase	J7KKD1	Streptococcus_phage	96.2	0.0e+00
WP_002985371.1|1013901_1014369_-|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	98.7	3.9e-82
WP_021340284.1|1014536_1014878_-	HNH endonuclease	NA	J7KH36	Streptococcus_phage	90.7	2.5e-54
WP_032461637.1|1015475_1015910_-	ArpU family transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	94.4	2.2e-71
WP_002987493.1|1016192_1016363_-	hypothetical protein	NA	A0A097PAS8	Streptococcus_pyogenes_phage	100.0	2.9e-27
WP_032461638.1|1016359_1016863_-	DUF1642 domain-containing protein	NA	A0A097PAV5	Streptococcus_pyogenes_phage	99.4	1.5e-92
WP_032461639.1|1016859_1017153_-	hypothetical protein	NA	A0A097PAR1	Streptococcus_pyogenes_phage	100.0	4.2e-50
WP_011054812.1|1017149_1017335_-	hypothetical protein	NA	A0A097PBF0	Streptococcus_pyogenes_phage	100.0	7.0e-27
WP_021733098.1|1017359_1017548_-	hypothetical protein	NA	A0A097PAU8	Streptococcus_pyogenes_phage	97.1	1.2e-13
WP_011054813.1|1017550_1017886_-	hypothetical protein	NA	A0A097PAS4	Streptococcus_pyogenes_phage	100.0	4.7e-45
WP_032461310.1|1017888_1018173_-	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	91.5	5.0e-40
WP_164977039.1|1018169_1018340_-	hypothetical protein	NA	Q938M0	Temperate_phage	100.0	8.5e-11
WP_011054815.1|1018336_1018750_-	hypothetical protein	NA	Q938M1	Temperate_phage	63.1	1.2e-34
WP_032461640.1|1018746_1019031_-	DUF3310 domain-containing protein	NA	A0A1P8VVP5	Streptococcus_phage	96.8	1.3e-48
WP_011018138.1|1019272_1019629_-	hypothetical protein	NA	A0A1P8VVP9	Streptococcus_phage	100.0	5.0e-61
WP_011018139.1|1019625_1020066_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A097PAS0	Streptococcus_pyogenes_phage	98.6	1.6e-80
WP_011106686.1|1020065_1020269_-	hypothetical protein	NA	Q938M6	Temperate_phage	100.0	4.7e-32
WP_021341162.1|1020274_1020766_-	single-stranded DNA-binding protein	NA	A0A286QNX2	Streptococcus_phage	74.2	7.6e-60
WP_021340879.1|1020758_1021433_-	ERF family protein	NA	Q938M8	Temperate_phage	96.9	2.0e-103
WP_021341163.1|1021433_1021916_-	siphovirus Gp157 family protein	NA	Q938M9	Temperate_phage	98.8	1.6e-49
WP_021341161.1|1021937_1022192_-	hypothetical protein	NA	Q938N0	Temperate_phage	97.6	6.3e-42
WP_021341157.1|1022172_1022529_-	HTH domain-containing protein	NA	A0A097PAU3	Streptococcus_pyogenes_phage	99.2	3.0e-50
WP_011018145.1|1022539_1022677_-	hypothetical protein	NA	J7KBQ4	Streptococcus_phage	78.4	2.7e-07
WP_021341158.1|1022667_1023450_-	ATP-binding protein	NA	A0A097PAQ0	Streptococcus_pyogenes_phage	98.1	2.7e-144
WP_021340639.1|1023436_1024240_-	DnaD domain protein	NA	A0A2P0VI76	Streptococcus_phage	53.8	2.4e-63
WP_012560973.1|1024355_1024799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000568478.1|1024854_1025235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370473.1|1025224_1025497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012560974.1|1025669_1025849_-	hypothetical protein	NA	A0A1X9I5M8	Streptococcus_phage	65.5	1.2e-12
WP_021733370.1|1026110_1026407_-	hypothetical protein	NA	A0A097PAT8	Streptococcus_pyogenes_phage	96.9	1.2e-47
WP_021341082.1|1026542_1026686_+	hypothetical protein	NA	M1PFC9	Streptococcus_phage	72.3	2.4e-11
WP_021341081.1|1026848_1027088_-	helix-turn-helix transcriptional regulator	NA	A0A097PBE6	Streptococcus_pyogenes_phage	96.2	9.1e-35
WP_014635527.1|1027181_1027853_+	DUF4145 domain-containing protein	NA	A0A1S5S8U0	Streptococcus_phage	39.9	7.0e-40
WP_014635529.1|1027969_1028128_-	hypothetical protein	NA	J7KH24	Streptococcus_phage	90.4	1.3e-21
WP_014635530.1|1028186_1028402_+	hypothetical protein	NA	J7KBX0	Streptococcus_phage	97.1	8.8e-29
WP_014635531.1|1028387_1028537_-	hypothetical protein	NA	J7KH12	Streptococcus_phage	89.8	9.7e-19
WP_021341138.1|1028907_1029696_+	peptidase S24	NA	A0A1S5SD15	Streptococcus_phage	63.8	1.4e-87
WP_021341136.1|1029774_1030671_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_021341135.1|1030685_1031045_+	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_021341137.1|1031041_1031587_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_021341141.1|1031706_1032795_+|integrase	site-specific integrase	integrase	Q38159	Streptococcus_phage	99.7	7.2e-204
1032838:1032933	attR	ACTCCCACCAGCTCCATCAATGCTTACCGTAAGTAATCATAACTTACTAAAACCTTGTTACATCAAGGTTTTTTCTTTTTGTCTTGTTCATGAGTT	NA	NA	NA	NA
