The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483329	Streptococcus pyogenes strain NCTC12058 chromosome 1	1768863	36623	48937	1768863		Synechococcus_phage(28.57%)	8	NA	NA
WP_111711311.1|36623_40349_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	27.4	6.0e-40
WP_111711312.1|40509_41964_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	8.3e-54
WP_111711313.1|41991_43014_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	41.8	3.1e-63
WP_031488746.1|43181_43736_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	1.8e-25
WP_111711314.1|43919_45467_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	51.8	2.8e-44
WP_010921776.1|45524_46649_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
WP_111711315.1|46901_48167_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_023079557.1|48445_48937_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	3.2e-18
>prophage 2
NZ_LS483329	Streptococcus pyogenes strain NCTC12058 chromosome 1	1768863	93360	104759	1768863	tRNA	Streptococcus_phage(55.56%)	19	NA	NA
WP_111711319.1|93360_93978_+	phage repressor protein	NA	A0A2H4JB17	uncultured_Caudovirales_phage	44.0	2.6e-41
WP_172450282.1|94004_94247_+	phage antirepressor protein	NA	NA	NA	NA	NA
WP_000074663.1|94503_94677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000916926.1|94818_95271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023611295.1|95372_95714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010922763.1|95700_95922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010922764.1|95924_96116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003058810.1|96127_96457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100459.1|96459_96732_+	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	60.0	6.1e-19
WP_023609951.1|96732_97599_+	primase C-terminal domain-containing protein	NA	A0A1X9I6L2	Streptococcus_phage	73.1	4.0e-120
WP_111711323.1|97925_99005_+	virulence-associated protein E	NA	A0A1W6JQD6	Staphylococcus_phage	41.0	3.2e-42
WP_022555265.1|99297_99552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022555266.1|99548_99722_+	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	57.9	5.6e-10
WP_168391529.1|99727_99901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014407945.1|99902_100412_+	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	63.5	1.1e-29
WP_111711324.1|100485_100974_+	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	54.3	4.0e-45
WP_111711325.1|101376_101739_+	DUF1492 domain-containing protein	NA	A0A2H4JFS1	uncultured_Caudovirales_phage	29.9	3.9e-05
WP_111711326.1|102286_102856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111711327.1|103499_104759_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	40.5	1.0e-71
>prophage 3
NZ_LS483329	Streptococcus pyogenes strain NCTC12058 chromosome 1	1768863	351433	357468	1768863		Streptococcus_phage(100.0%)	8	NA	NA
WP_014635306.1|351433_352069_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.4	2.0e-65
WP_011528291.1|352086_352962_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	47.9	1.8e-72
WP_002985838.1|353624_353948_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_002990904.1|353952_354816_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	74.7	1.5e-114
WP_002985833.1|354842_355235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009880724.1|355281_355911_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_002995120.1|356210_356567_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	66.7	2.8e-40
WP_014635309.1|356640_357468_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.5	4.2e-127
>prophage 4
NZ_LS483329	Streptococcus pyogenes strain NCTC12058 chromosome 1	1768863	452458	557345	1768863	holin,protease,integrase,portal,tRNA,terminase,capsid,tail	Streptococcus_phage(45.59%)	110	474832:474851	516247:516266
WP_109991718.1|452458_455260_+|tRNA	isoleucine--tRNA ligase	tRNA	H2EEZ0	Moumouvirus	26.9	3.2e-70
WP_002983878.1|455523_455826_-	DUF1827 family protein	NA	NA	NA	NA	NA
WP_002989103.1|455876_456332_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_031488535.1|456459_458742_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CYX3	Yersinia_phage	39.6	1.1e-124
WP_002983885.1|459040_459271_+	YkuJ family protein	NA	NA	NA	NA	NA
WP_011018000.1|459396_460083_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002989107.1|460082_460817_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	2.8e-34
WP_111711351.1|460965_462375_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.8	4.4e-60
WP_002993334.1|462552_464247_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	42.4	1.6e-128
WP_010922486.1|464453_465308_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	39.8	2.0e-39
WP_111711352.1|465460_466801_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	30.9	1.1e-39
WP_002983901.1|466778_466994_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_011284950.1|466993_467866_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_031488538.1|467858_468686_+	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_111711353.1|468672_469143_+	arginine repressor	NA	NA	NA	NA	NA
WP_031488539.1|469164_470826_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_111711354.1|471033_472008_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002983913.1|472223_473075_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.7	5.4e-13
WP_002992620.1|473067_473910_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_111711355.1|473887_474475_+	YpmS family protein	NA	NA	NA	NA	NA
WP_002983920.1|474573_474849_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	73.0	2.6e-25
474832:474851	attL	AAAGACGCTGTTAAATAATT	NA	NA	NA	NA
WP_003051793.1|474938_476081_-|integrase	site-specific integrase	integrase	M1NRJ9	Streptococcus_phage	77.4	2.4e-173
WP_076634078.1|476209_476476_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_111711356.1|476487_476868_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1S5SFH2	Streptococcus_phage	61.9	6.1e-41
WP_111688316.1|476871_477219_-	helix-turn-helix transcriptional regulator	NA	Q7Y4M0	Streptococcus_phage	69.2	1.8e-39
WP_020837421.1|477640_477736_-	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_002993390.1|478371_478563_+	hypothetical protein	NA	A7J270	Streptococcus_phage	92.1	4.0e-25
WP_111688314.1|478574_479228_+	phage antirepressor KilAC domain-containing protein	NA	A0A2H4IZX7	uncultured_Caudovirales_phage	59.7	4.4e-71
WP_023611024.1|479326_479587_-	hypothetical protein	NA	M1PS67	Streptococcus_phage	70.9	5.8e-27
WP_011017885.1|479728_479938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023611035.1|480017_480266_+	hypothetical protein	NA	A0A141E1M0	Streptococcus_phage	69.5	1.6e-26
WP_023611028.1|480239_480455_-	hypothetical protein	NA	A0A1S5SA41	Streptococcus_phage	61.4	1.9e-15
WP_014411880.1|480561_480873_+	hypothetical protein	NA	A0A1S5SA25	Streptococcus_phage	78.6	1.4e-43
WP_023611037.1|480874_481045_+	hypothetical protein	NA	A7J273	Streptococcus_phage	87.5	2.9e-19
WP_111694890.1|481250_481637_+	hypothetical protein	NA	A7J274	Streptococcus_phage	87.4	1.4e-56
WP_023611025.1|482126_482330_+	hypothetical protein	NA	A7J276	Streptococcus_phage	98.5	1.6e-32
WP_002988708.1|482418_482718_+	hypothetical protein	NA	A7J277	Streptococcus_phage	100.0	1.8e-43
WP_023611034.1|482717_483875_+	DUF2800 domain-containing protein	NA	A7J278	Streptococcus_phage	97.9	3.0e-216
WP_111674646.1|483883_484447_+	DUF2815 family protein	NA	D2J040	Enterococcus_phage	59.0	8.7e-52
WP_111674645.1|484489_486412_+	DNA polymerase	NA	A7J280	Streptococcus_phage	98.4	0.0e+00
WP_111688312.1|486416_488801_+	DNA primase	NA	A7J282	Streptococcus_phage	94.6	8.2e-277
WP_050320439.1|489186_489462_+	VRR-NUC domain-containing protein	NA	A7J283	Streptococcus_phage	98.9	3.5e-46
WP_111694889.1|489458_490781_+	DEAD/DEAH box helicase family protein	NA	A7J284	Streptococcus_phage	97.7	3.0e-252
WP_164972002.1|490781_490952_+	hypothetical protein	NA	A7J285	Streptococcus_phage	92.3	9.0e-21
WP_011054882.1|490944_491217_+	hypothetical protein	NA	A7J287	Streptococcus_phage	73.3	5.7e-25
WP_011054881.1|491349_491766_+	transcriptional regulator	NA	A7J289	Streptococcus_phage	99.3	3.3e-72
WP_050318691.1|491885_492581_+|terminase	terminase	terminase	A0A2H4J4R0	uncultured_Caudovirales_phage	34.5	4.4e-29
WP_165363098.1|492573_493869_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1S5SA45	Streptococcus_phage	85.0	7.8e-221
WP_010922075.1|493882_495385_+|portal	phage portal protein	portal	Q938L2	Temperate_phage	99.6	5.9e-281
WP_111694888.1|495389_496868_+|capsid	phage minor capsid protein	capsid	Q938L1	Temperate_phage	99.6	9.0e-274
WP_002986829.1|496839_497079_+	hypothetical protein	NA	Q938L0	Temperate_phage	100.0	2.8e-36
WP_111694887.1|497140_497407_+	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	1.1e-36
WP_010922079.1|497532_498147_+	hypothetical protein	NA	Q938K8	Temperate_phage	95.0	3.1e-95
WP_111711357.1|498150_498969_+|capsid	N4-gp56 family major capsid protein	capsid	Q79S85	Temperate_phage	99.3	9.8e-145
WP_111694886.1|499022_499439_+	hypothetical protein	NA	Q938K7	Temperate_phage	98.2	3.6e-55
WP_010922082.1|499428_499761_+	hypothetical protein	NA	Q79S86	Temperate_phage	100.0	9.6e-59
WP_010922083.1|499760_500117_+	hypothetical protein	NA	Q79S88	Temperate_phage	100.0	4.5e-62
WP_010922084.1|500113_500512_+|capsid	phage capsid protein	capsid	Q79S87	Temperate_phage	100.0	3.5e-71
WP_011527917.1|500511_500982_+|tail	major tail shaft protein	tail	Q938K6	Temperate_phage	100.0	8.0e-83
WP_010922086.1|501034_501469_+	hypothetical protein	NA	Q938K5	Temperate_phage	99.3	2.9e-71
WP_010922087.1|501472_502054_+	hypothetical protein	NA	Q938K4	Temperate_phage	98.4	1.6e-104
WP_111711358.1|502043_505304_+	tape measure protein	NA	Q938K3	Temperate_phage	98.3	0.0e+00
WP_111674636.1|505300_506017_+|tail	phage tail family protein	tail	Q938K2	Temperate_phage	98.7	3.6e-135
WP_111694884.1|506013_508161_+|tail	phage tail protein	tail	Q938K1	Temperate_phage	94.9	0.0e+00
WP_030127718.1|508157_509381_+	hypothetical protein	NA	A3F657	Streptococcus_phage	41.3	6.7e-49
WP_032460574.1|509367_509697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111711359.1|509707_511531_+	gp58-like family protein	NA	Q938J9	Temperate_phage	79.9	1.1e-212
WP_111694882.1|511539_511968_+	DUF1617 family protein	NA	A3F661	Streptococcus_phage	92.2	2.8e-66
WP_111694881.1|511970_512582_+	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	88.2	3.7e-80
WP_111694880.1|512592_512922_+	hypothetical protein	NA	A3F663	Streptococcus_phage	99.0	6.2e-50
WP_003052353.1|512923_513256_+|holin	phage holin	holin	A3F664	Streptococcus_phage	100.0	5.7e-51
WP_023611694.1|513257_514010_+	SH3 domain-containing protein	NA	A3F665	Streptococcus_phage	97.2	2.1e-141
WP_002985327.1|514078_514786_-	streptococcal pyrogenic exotoxin SpeC	NA	A0A097PAT7	Streptococcus_pyogenes_phage	27.1	3.9e-09
WP_011184727.1|514896_515655_-	DNase Mf2	NA	NA	NA	NA	NA
WP_011184726.1|515894_516077_+	hypothetical protein	NA	A3F673	Streptococcus_phage	81.7	2.0e-21
WP_031488540.1|516597_518460_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.7	7.0e-90
516247:516266	attR	AAAGACGCTGTTAAATAATT	NA	NA	NA	NA
WP_031488541.1|518759_519695_-	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	45.1	7.9e-66
WP_002983928.1|519933_520629_+	phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_002983930.1|520735_521257_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_002989140.1|521417_521960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014407680.1|522083_522863_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_002983939.1|523659_524256_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_002989146.1|524356_525403_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_031488542.1|525593_526985_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_031488543.1|527064_527760_+	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
WP_031488544.1|528007_529552_+	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	29.1	8.3e-36
WP_111711360.1|529858_531478_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.5	1.9e-59
WP_053039059.1|531604_533605_+	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	34.0	1.1e-64
WP_011017953.1|533628_533907_-	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	36.0	7.9e-06
WP_014407673.1|533896_534751_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_172450284.1|534790_535531_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_002983967.1|535730_536393_+	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_111711362.1|536373_538617_+	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	59.2	4.0e-55
WP_031488548.1|538687_539728_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_111711363.1|539824_540430_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	52.7	3.9e-58
WP_002983979.1|540596_540830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111711364.1|541054_541645_+	serine hydrolase	NA	NA	NA	NA	NA
WP_111711365.1|541758_542979_-	DUF3114 domain-containing protein	NA	NA	NA	NA	NA
WP_111711366.1|542983_544012_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_002995779.1|544213_544918_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_002995774.1|545036_545753_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_002983995.1|546048_547011_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_011054652.1|547023_548829_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_002995765.1|549204_550401_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_002984000.1|550466_551174_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	27.2	2.0e-08
WP_002984003.1|551236_552292_+	peptidylprolyl isomerase PrsA	NA	NA	NA	NA	NA
WP_111689539.1|552678_555297_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.1	5.1e-62
WP_002989220.1|555657_555873_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_111711367.1|555869_556631_+	DUF3169 family protein	NA	NA	NA	NA	NA
WP_002995750.1|556649_557345_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 5
NZ_LS483329	Streptococcus pyogenes strain NCTC12058 chromosome 1	1768863	967611	978214	1768863		Streptococcus_phage(57.14%)	9	NA	NA
WP_002985123.1|967611_968754_-	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.0	4.1e-24
WP_023612835.1|968988_969429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002990257.1|969458_970727_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_002985132.1|970814_972167_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.0	4.5e-30
WP_010922140.1|972387_972729_-	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	41.1	5.9e-19
WP_002990262.1|972789_973956_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	4.5e-34
WP_031488373.1|974049_974736_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	69.3	2.4e-88
WP_002985142.1|974732_975896_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	3.4e-143
WP_011054348.1|976003_978214_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	69.1	2.9e-268
>prophage 6
NZ_LS483329	Streptococcus pyogenes strain NCTC12058 chromosome 1	1768863	1687586	1705792	1768863	integrase,holin	Streptococcus_phage(53.33%)	22	1689554:1689574	1703093:1703113
WP_031488761.1|1687586_1689569_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.3	2.3e-62
1689554:1689574	attL	CAATAATGTTTGTCATAATTT	NA	NA	NA	NA
WP_014635780.1|1689663_1690815_-|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	44.9	7.9e-84
WP_011185066.1|1691063_1691207_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_003058809.1|1692077_1692845_-	helix-turn-helix domain-containing protein	NA	Q76TK4	Streptococcus_pyogenes_phage	83.1	3.6e-72
WP_002992503.1|1692998_1693205_+	helix-turn-helix transcriptional regulator	NA	X2KUC2	Streptococcus_phage	47.0	2.4e-07
WP_080277853.1|1693238_1694006_+	hypothetical protein	NA	A0A0A7S0G2	Clostridium_phage	53.7	5.0e-26
WP_010922760.1|1694015_1694639_+	phage repressor protein	NA	A0A1W6JPC3	Staphylococcus_phage	43.3	2.5e-39
WP_000648623.1|1694665_1694908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010922762.1|1695163_1695505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010922763.1|1695491_1695713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010922764.1|1695715_1695907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003058810.1|1695918_1696248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100459.1|1696250_1696523_+	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	60.0	6.1e-19
WP_010922767.1|1696523_1697381_+	replication protein	NA	A0A1X9I6L2	Streptococcus_phage	74.8	4.5e-124
WP_002992487.1|1697349_1699038_+	DNA primase	NA	A0A1X9I717	Streptococcus_phage	82.1	2.5e-259
WP_000694577.1|1699324_1699498_+	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	59.6	1.9e-10
WP_014635784.1|1699503_1699677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023611171.1|1699678_1700188_+	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	63.5	1.1e-29
WP_023080239.1|1700261_1700750_+	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	54.3	5.2e-45
WP_010922770.1|1701153_1701516_+	DUF1492 domain-containing protein	NA	A0A2H4JFS1	uncultured_Caudovirales_phage	30.8	3.5e-06
WP_010922771.1|1701490_1701874_+	ArpU family transcriptional regulator	NA	Q938L8	Temperate_phage	42.1	3.7e-14
WP_002993100.1|1703236_1705792_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	23.3	5.2e-43
1703093:1703113	attR	CAATAATGTTTGTCATAATTT	NA	NA	NA	NA
