The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483352	Streptococcus pyogenes strain NCTC12052 chromosome 1	1857727	36638	48952	1857727		Synechococcus_phage(28.57%)	8	NA	NA
WP_109828667.1|36638_40364_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	27.0	6.0e-40
WP_023080049.1|40524_41979_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	1.7e-54
WP_111685626.1|42006_43029_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	41.4	9.0e-63
WP_002986700.1|43196_43751_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	2.4e-25
WP_023610065.1|43934_45482_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.4	3.4e-45
WP_002987712.1|45540_46665_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
WP_023080273.1|46917_48183_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002987716.1|48460_48952_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	3.2e-18
>prophage 2
NZ_LS483352	Streptococcus pyogenes strain NCTC12052 chromosome 1	1857727	88112	104598	1857727	holin,integrase,tRNA	Streptococcus_phage(62.5%)	26	83484:83498	99475:99489
83484:83498	attL	TTTATCAAAAACACA	NA	NA	NA	NA
WP_010921791.1|88112_88832_+	metal ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.8	1.3e-15
WP_021340473.1|88824_89640_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_020833194.1|89679_90063_-	HIT family protein	NA	NA	NA	NA	NA
WP_032465792.1|90226_91372_-|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	50.0	5.1e-99
WP_111685629.1|91626_91770_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_111685630.1|92631_93399_-	helix-turn-helix domain-containing protein	NA	Q76TK4	Streptococcus_pyogenes_phage	84.9	2.5e-73
WP_002992503.1|93552_93759_+	helix-turn-helix transcriptional regulator	NA	X2KUC2	Streptococcus_phage	47.0	2.4e-07
WP_111685631.1|93792_93993_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SE31	Streptococcus_phage	55.0	1.0e-10
WP_111685632.1|94013_94421_+	hypothetical protein	NA	A0A1X9I5V7	Streptococcus_phage	70.1	7.7e-50
WP_111685633.1|94434_95052_+	Rha family transcriptional regulator	NA	A0A159B6D5	Gordonia_phage	38.8	2.2e-11
WP_111685634.1|95296_95629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003058793.1|95625_95847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111685635.1|95849_96041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174505.1|96052_96382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100459.1|96384_96657_+	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	60.0	6.1e-19
WP_111685636.1|96657_97515_+	primase C-terminal domain-containing protein	NA	A0A1X9I6L2	Streptococcus_phage	74.5	7.6e-124
WP_111685637.1|97483_99172_+	DNA primase	NA	A0A1X9I717	Streptococcus_phage	82.1	2.5e-259
WP_023610068.1|99458_99632_+	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	61.4	3.9e-11
99475:99489	attR	TTTATCAAAAACACA	NA	NA	NA	NA
WP_003058787.1|99637_99811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111674798.1|99812_100322_+	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	62.5	5.5e-29
WP_014407946.1|100395_100884_+	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	54.3	2.0e-44
WP_111685638.1|101289_101652_+	DUF1492 domain-containing protein	NA	A0A2H4JFS1	uncultured_Caudovirales_phage	29.9	3.0e-05
WP_111685639.1|101626_102010_+	DUF1492 domain-containing protein	NA	Q938L8	Temperate_phage	42.5	4.9e-14
WP_111685640.1|102218_102854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111685641.1|102816_103068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023610094.1|103338_104598_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	40.0	2.6e-72
>prophage 3
NZ_LS483352	Streptococcus pyogenes strain NCTC12052 chromosome 1	1857727	336592	433522	1857727	bacteriocin,tRNA,protease,transposase	Streptococcus_phage(20.0%)	99	NA	NA
WP_111685664.1|336592_337183_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	55.7	3.4e-54
WP_002985847.1|337674_337950_+	YlbG family protein	NA	NA	NA	NA	NA
WP_010921930.1|338198_338834_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.4	1.2e-65
WP_093974840.1|338851_339727_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	44.5	6.3e-65
WP_020833285.1|339745_339985_+	tpl protein	NA	NA	NA	NA	NA
WP_002985838.1|340389_340713_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_023609789.1|340717_341581_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	74.3	5.5e-114
WP_111685665.1|341607_342000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011528296.1|342046_342676_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_111685666.1|342974_343331_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.0	1.8e-39
WP_021340916.1|343404_344232_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.9	1.7e-128
WP_168393657.1|344464_345646_+	L-lactate oxidase	NA	NA	NA	NA	NA
WP_111685668.1|345911_350855_+|protease	CXC chemokine-degrading serine protease SpyCEP	protease	NA	NA	NA	NA
WP_172450110.1|351248_351524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002985820.1|351625_352333_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_111685669.1|352572_354573_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.1	4.6e-87
WP_010921941.1|355067_356081_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	53.7	2.5e-97
WP_023610055.1|356084_356573_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	37.5	1.3e-11
WP_063632599.1|356539_358720_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	43.3	2.5e-171
WP_111685670.1|358923_359676_-	ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_111685872.1|360133_360538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002990852.1|360725_360977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002990844.1|362028_362265_+	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_111685671.1|362257_362956_+	3-oxoacyl-ACP reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.2	1.2e-10
WP_111685672.1|363031_363991_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002993065.1|364323_365661_+	MFS transporter	NA	NA	NA	NA	NA
WP_111685673.1|365833_367216_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L4K9	Tupanvirus	36.0	1.4e-31
WP_002985793.1|367246_367801_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_021340729.1|367800_368052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010921957.1|368070_368766_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_111685674.1|368916_369258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023078622.1|369357_370005_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_004218965.1|370150_371083_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002985780.1|371146_371872_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.6	1.4e-17
WP_011017448.1|371872_372727_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_002990808.1|372874_373681_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	36.6	1.5e-20
WP_111685675.1|373897_376303_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	51.7	3.8e-88
WP_010921962.1|376372_376726_-	DUF3397 domain-containing protein	NA	NA	NA	NA	NA
WP_002990800.1|376969_377395_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002985768.1|377500_378190_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002985765.1|378511_379240_+	UMP kinase	NA	NA	NA	NA	NA
WP_002985763.1|379268_379826_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_038433941.1|379934_380792_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002990794.1|380864_381374_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002985757.1|381370_381586_+	YozE family protein	NA	NA	NA	NA	NA
WP_111685676.1|381741_382923_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XB61	Gordonia_phage	40.5	5.6e-16
WP_111685677.1|383236_385009_+	oleate hydratase	NA	NA	NA	NA	NA
WP_002990786.1|385167_386220_+	PhoH family protein	NA	W8D063	Erwinia_phage	50.0	1.2e-46
WP_009880369.1|386265_386841_+	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_032467023.1|386999_387497_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_002985746.1|387477_387885_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_002985743.1|388004_388901_+	GTPase Era	NA	NA	NA	NA	NA
WP_002993018.1|388921_389398_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_014635333.1|390559_391006_-	ATP-binding cassette domain-containing protein	NA	F2Y302	Organic_Lake_phycodnavirus	36.0	4.1e-12
WP_011528336.1|391228_391939_-|bacteriocin	bacteriocin ABC transporter	bacteriocin	NA	NA	NA	NA
WP_002994577.1|392043_392280_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_002994580.1|392577_392802_+|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002994581.1|392779_392956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157261042.1|393312_393561_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_028797129.1|394171_394399_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002994587.1|394447_394765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020833317.1|394830_395112_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_111685678.1|395144_395600_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.0	3.8e-13
WP_002987929.1|395754_395970_+|transposase	transposase	transposase	U5P429	Shigella_phage	45.5	7.0e-10
WP_002992578.1|397912_398662_+	response regulator transcription factor	NA	A0A1V0E029	Clostridioides_phage	28.0	2.1e-21
WP_014635339.1|398662_399997_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_011017462.1|400144_400270_-|bacteriocin	ComC/BlpC family leader-containing pheromone/bacteriocin	bacteriocin	NA	NA	NA	NA
WP_020833322.1|401722_403876_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	28.3	5.7e-43
WP_002994504.1|405201_405447_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002987564.1|405461_405644_+|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_012560514.1|406838_407066_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003060803.1|407078_407279_+|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_011054252.1|407817_408099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032467019.1|408292_408694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111685679.1|408944_410015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111685680.1|410107_410506_+	histidine kinase	NA	NA	NA	NA	NA
WP_111685681.1|410775_411045_-	quorum-sensing system protein StcA	NA	NA	NA	NA	NA
WP_128650799.1|411958_412027_-	peptide pheromone SHP2	NA	NA	NA	NA	NA
WP_002990747.1|412115_412982_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002990742.1|413153_413981_+	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	27.5	5.1e-16
WP_002994141.1|413977_414571_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_111685682.1|414760_416263_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	41.3	1.5e-74
WP_111685683.1|416384_417578_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_002990729.1|417574_417721_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002985700.1|417766_418003_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_111685684.1|418096_420430_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.6	1.5e-89
WP_002994152.1|420432_420900_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	57.0	5.7e-41
WP_010921981.1|420905_421625_+	glutaminyl-peptide cyclotransferase	NA	NA	NA	NA	NA
WP_002994169.1|421741_422389_-	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_002985692.1|422438_423365_-	DUF979 domain-containing protein	NA	NA	NA	NA	NA
WP_011017476.1|423364_424048_-	DUF969 domain-containing protein	NA	NA	NA	NA	NA
WP_032464862.1|424258_425185_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	47.5	3.4e-77
WP_020904973.1|425329_425707_-	VOC family protein	NA	NA	NA	NA	NA
WP_002985684.1|425717_426383_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002985682.1|426431_427517_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_111685685.1|427690_428692_+	catabolite control protein A	NA	C6ZCU4	Enterobacteria_phage	28.5	3.6e-24
WP_002985678.1|428822_429821_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_111685686.1|429822_431157_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_111685687.1|431578_433522_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	38.7	4.7e-121
>prophage 4
NZ_LS483352	Streptococcus pyogenes strain NCTC12052 chromosome 1	1857727	534507	608686	1857727	integrase,terminase,tail,tRNA,holin,capsid,portal	Temperate_phage(43.86%)	82	541212:541229	612722:612739
WP_032467059.1|534507_535632_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_101248318.1|535700_536798_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_002985455.1|536817_537510_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	35.6	1.0e-30
WP_023610225.1|537502_538432_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_076707733.1|538741_539440_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	62.9	1.0e-78
WP_023610227.1|539607_540372_+	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_109828714.1|540479_542981_+	bifunctional DnaQ family exonuclease/ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	48.2	1.2e-204
541212:541229	attL	ATATCAAAAAGCTTCCCT	NA	NA	NA	NA
WP_002985439.1|543316_544510_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002985437.1|544530_545877_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.8	1.1e-55
WP_002985434.1|546290_547181_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.8	8.8e-06
WP_111685698.1|547177_548155_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	74.5	5.6e-139
WP_011054317.1|548151_549063_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	64.7	1.0e-105
WP_111685699.1|549195_550593_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_020833384.1|550733_552281_+	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_111685700.1|552427_553150_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_111685701.1|553169_554369_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002985307.1|554465_554726_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002990475.1|554840_555782_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_002985303.1|556175_556625_+	flavodoxin	NA	NA	NA	NA	NA
WP_010922101.1|556808_557093_+	chorismate mutase	NA	NA	NA	NA	NA
WP_109828710.1|557085_558348_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	51.0	2.9e-95
WP_002985298.1|558462_558810_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_111685702.1|559173_560250_-|integrase	site-specific integrase	integrase	Q0R5B4	Streptococcus_phage	41.2	2.0e-68
WP_023612337.1|560368_560890_-	hypothetical protein	NA	Q938N8	Temperate_phage	97.7	7.5e-66
WP_030126053.1|560900_561278_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1P8VVK5	Streptococcus_phage	77.6	1.6e-54
WP_023611288.1|561261_561621_-	helix-turn-helix transcriptional regulator	NA	A0A1P8VVN3	Streptococcus_phage	95.0	1.7e-56
WP_023612341.1|561808_562027_+	helix-turn-helix transcriptional regulator	NA	A0A1P8VVR5	Streptococcus_phage	97.2	5.9e-33
WP_023612302.1|562126_562357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164492191.1|562340_562484_+	hypothetical protein	NA	A0A1P8VVR9	Streptococcus_phage	83.7	3.4e-13
WP_023612348.1|562493_562712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003056170.1|562713_562956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023612340.1|562942_564259_+	AAA family ATPase	NA	A0A097BY67	Enterococcus_phage	63.8	7.8e-152
WP_003056188.1|564273_565356_+	AAA family ATPase	NA	A0A0K2CZH1	Paenibacillus_phage	53.3	2.5e-103
WP_003056185.1|565550_566144_+	hypothetical protein	NA	A0A097BY29	Enterococcus_phage	43.5	1.7e-29
WP_080262841.1|566143_567727_+	DEAD/DEAH box helicase	NA	A0A097BY72	Enterococcus_phage	77.8	2.0e-234
WP_023612331.1|567739_567934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023612365.1|567956_570200_+	AAA family ATPase	NA	Q5YA88	Bacillus_phage	63.7	4.7e-282
WP_003059078.1|570491_570674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111685703.1|570666_571062_+	RusA family crossover junction endodeoxyribonuclease	NA	Q5YA86	Bacillus_phage	59.5	4.8e-41
WP_010922069.1|571058_571280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111685704.1|571282_571555_+	hypothetical protein	NA	A7J287	Streptococcus_phage	58.9	1.2e-17
WP_011017571.1|571558_572041_+	class I SAM-dependent methyltransferase	NA	A0A097PAU8	Streptococcus_pyogenes_phage	98.8	9.6e-92
WP_021299463.1|572030_572795_+	site-specific DNA-methyltransferase	NA	A0A1S5SE41	Streptococcus_phage	92.3	4.2e-134
WP_111685705.1|572885_573179_+	hypothetical protein	NA	A0A097PAR1	Streptococcus_pyogenes_phage	96.9	1.5e-47
WP_003052405.1|573634_574072_+	DUF1492 domain-containing protein	NA	A0A097PBF1	Streptococcus_pyogenes_phage	100.0	3.6e-77
WP_019418850.1|574405_575572_+	ParB N-terminal domain-containing protein	NA	Q708N6	Streptococcus_phage	53.9	7.9e-124
WP_010922073.1|575914_576391_+	hypothetical protein	NA	Q938L4	Temperate_phage	68.4	4.9e-48
WP_010922074.1|576473_577685_+|terminase	PBSX family phage terminase large subunit	terminase	Q938L3	Temperate_phage	99.7	3.7e-225
WP_010922075.1|577698_579201_+|portal	phage portal protein	portal	Q938L2	Temperate_phage	99.6	5.9e-281
WP_010922076.1|579205_580699_+|capsid	phage minor capsid protein	capsid	Q938L1	Temperate_phage	80.8	2.1e-214
WP_010922077.1|580698_580926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010922078.1|581012_581279_+	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	8.3e-37
WP_010922079.1|581404_582019_+	hypothetical protein	NA	Q938K8	Temperate_phage	95.0	3.1e-95
WP_010922080.1|582022_582841_+|capsid	N4-gp56 family major capsid protein	capsid	Q79S85	Temperate_phage	100.0	4.0e-146
WP_111685706.1|582894_583311_+	hypothetical protein	NA	Q938K7	Temperate_phage	98.2	2.8e-55
WP_111685707.1|583300_583633_+|capsid	minor capsid protein	capsid	Q79S86	Temperate_phage	98.2	1.1e-57
WP_010922083.1|583632_583989_+	hypothetical protein	NA	Q79S88	Temperate_phage	100.0	4.5e-62
WP_010922084.1|583985_584384_+|capsid	phage capsid protein	capsid	Q79S87	Temperate_phage	100.0	3.5e-71
WP_011054741.1|584383_584869_+	hypothetical protein	NA	Q938K6	Temperate_phage	100.0	1.6e-86
WP_010922086.1|584907_585342_+	hypothetical protein	NA	Q938K5	Temperate_phage	99.3	2.9e-71
WP_010922087.1|585345_585927_+	hypothetical protein	NA	Q938K4	Temperate_phage	98.4	1.6e-104
WP_030126579.1|585916_589177_+	tape measure protein	NA	Q938K3	Temperate_phage	98.6	0.0e+00
WP_111685708.1|589173_589890_+|tail	phage tail family protein	tail	Q938K2	Temperate_phage	98.7	5.5e-136
WP_021775334.1|589886_592031_+|tail	phage tail protein	tail	Q938K1	Temperate_phage	95.7	0.0e+00
WP_111685709.1|592027_593032_+	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	62.7	5.3e-108
WP_111685710.1|593046_594933_+	gp58-like family protein	NA	Q938J9	Temperate_phage	86.5	4.6e-222
WP_002987513.1|594944_595376_+	DUF1617 family protein	NA	Q938J8	Temperate_phage	100.0	1.1e-73
WP_032461328.1|595378_595996_+	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	88.8	1.7e-77
WP_002987582.1|596005_596281_+	hypothetical protein	NA	A7J2B2	Streptococcus_phage	100.0	2.6e-41
WP_000609113.1|596277_596505_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	98.7	5.8e-31
WP_111685711.1|596620_597823_+	glucosaminidase domain-containing protein	NA	Q938J4	Temperate_phage	97.5	1.8e-235
WP_032465096.1|598189_598732_+	SocA family protein	NA	Q938J3	Temperate_phage	51.1	2.2e-44
WP_032465095.1|598735_599572_+	hypothetical protein	NA	Q938J2	Temperate_phage	52.3	4.3e-63
WP_003055891.1|599639_599996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003055874.1|599997_600471_-	hypothetical protein	NA	A3F671	Streptococcus_phage	94.3	8.0e-83
WP_003055856.1|600509_600749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_030127450.1|600951_601131_+	hypothetical protein	NA	A3F673	Streptococcus_phage	77.6	3.4e-18
WP_002994056.1|601952_602522_+	hydrolase	NA	NA	NA	NA	NA
WP_002994058.1|602522_604475_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.3	8.9e-144
WP_002990455.1|604831_606556_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_002990451.1|606687_607146_-	YueI family protein	NA	W6LLD2	Streptococcus_phage	39.1	1.8e-18
WP_002985288.1|607378_608686_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	96.6	1.2e-240
612722:612739	attR	ATATCAAAAAGCTTCCCT	NA	NA	NA	NA
>prophage 5
NZ_LS483352	Streptococcus pyogenes strain NCTC12052 chromosome 1	1857727	673697	684301	1857727		Streptococcus_phage(57.14%)	9	NA	NA
WP_050580611.1|673697_675908_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	69.2	2.9e-268
WP_023609837.1|676015_677179_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	64.9	7.6e-143
WP_002985140.1|677175_677862_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_002990262.1|677955_679122_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	4.5e-34
WP_002992643.1|679182_679524_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	41.1	5.9e-19
WP_002992646.1|679744_681097_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.8	1.0e-29
WP_002992648.1|681176_682454_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_014407485.1|682483_682924_-	membrane protein	NA	NA	NA	NA	NA
WP_002985123.1|683158_684301_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.0	4.1e-24
>prophage 6
NZ_LS483352	Streptococcus pyogenes strain NCTC12052 chromosome 1	1857727	985508	1064285	1857727	integrase,protease,head,terminase,tail,tRNA,holin,capsid,portal	Streptococcus_phage(60.71%)	88	1018875:1018934	1060824:1060919
WP_032465038.1|985508_986393_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_023610008.1|986508_987849_-	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
WP_023609998.1|987954_988911_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_002993908.1|988921_989518_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_023610003.1|989609_992246_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_002989664.1|992260_992962_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	4.9e-36
WP_002984482.1|993079_993622_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002984480.1|993764_994406_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002994467.1|994568_995057_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002984476.1|995067_995268_-	CsbD family protein	NA	J7KJ36	Streptococcus_phage	50.0	1.8e-07
WP_002984475.1|995308_995848_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002984473.1|995860_996049_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_011106783.1|996059_996671_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002984469.1|996707_996956_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002989648.1|997318_999637_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.2	3.5e-131
WP_038432363.1|1000166_1001489_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_014635492.1|1001608_1002844_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_009880829.1|1003213_1003987_-	CAMP factor pore-forming toxin Cfa	NA	NA	NA	NA	NA
WP_014635494.1|1004356_1005193_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002992415.1|1005208_1005838_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	9.8e-28
WP_002992417.1|1005847_1006489_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_111685758.1|1006595_1006931_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_002984451.1|1007126_1008941_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	38.9	5.2e-98
WP_002984449.1|1009116_1009674_-	signal peptidase I	NA	NA	NA	NA	NA
WP_002984447.1|1009891_1011394_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_002984444.1|1011456_1012470_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_002984441.1|1012549_1015660_-	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	29.8	1.4e-119
WP_002989617.1|1015844_1016216_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002992425.1|1016215_1016914_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.3	6.6e-09
WP_002984433.1|1016923_1017709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002989607.1|1017839_1018454_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	52.3	6.2e-51
1018875:1018934	attL	ACTCCCACCAGCTCCATCAATGCTTACCGTAAGTAATCATAACTTACTAAAACCTTGTTA	NA	NA	NA	NA
WP_011054546.1|1019044_1019233_-	hypothetical protein	NA	A3F673	Streptococcus_phage	84.7	1.2e-21
WP_020833516.1|1019347_1020136_-	streptococcal pyrogenic exotoxin SpeL	NA	Q938J1	Temperate_phage	41.4	1.2e-46
WP_014635497.1|1020417_1021131_-	streptococcal pyrogenic exotoxin SpeM	NA	Q938J1	Temperate_phage	59.5	9.0e-78
WP_111685759.1|1021514_1022108_-	GNAT family N-acetyltransferase	NA	A0A0A8WFI2	Clostridium_phage	38.2	2.4e-23
WP_111685760.1|1022107_1022311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002994484.1|1023174_1023867_-	AP2 domain-containing protein	NA	A0A2H4J2S8	uncultured_Caudovirales_phage	34.2	1.5e-32
WP_111685761.1|1024099_1024657_-	glycoside hydrolase family 73 protein	NA	A7J2B5	Streptococcus_phage	85.9	1.0e-92
WP_003058873.1|1024772_1025000_-|holin	phage holin	holin	A7J2B3	Streptococcus_phage	100.0	2.0e-31
WP_002987582.1|1024996_1025272_-	hypothetical protein	NA	A7J2B2	Streptococcus_phage	100.0	2.6e-41
WP_111685762.1|1025281_1025899_-	hypothetical protein	NA	A3F662	Streptococcus_phage	90.2	5.7e-81
WP_023079239.1|1025901_1026330_-	DUF1617 family protein	NA	A3F661	Streptococcus_phage	92.9	3.0e-68
WP_111685763.1|1029271_1031416_-|tail	phage tail protein	tail	Q938K1	Temperate_phage	94.0	0.0e+00
WP_014411854.1|1031412_1032120_-|tail	phage tail family protein	tail	Q938K2	Temperate_phage	71.1	1.7e-92
WP_111685764.1|1032119_1036043_-|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	50.0	1.1e-249
WP_014411856.1|1036055_1036223_-	hypothetical protein	NA	J7KBS0	Streptococcus_phage	87.3	2.9e-19
WP_014411857.1|1036252_1036579_-	hypothetical protein	NA	J7KK85	Streptococcus_phage	73.1	6.0e-37
WP_014411858.1|1036631_1037240_-|tail	phage major tail protein	tail	J7KKC8	Streptococcus_phage	70.5	2.3e-74
WP_002985347.1|1037256_1037682_-	hypothetical protein	NA	J7KBZ9	Streptococcus_phage	85.1	5.0e-68
WP_002985349.1|1037678_1038056_-	HK97 gp10 family phage protein	NA	J7KDM3	Streptococcus_phage	72.8	1.4e-45
WP_063632712.1|1038052_1038400_-|head	phage head closure protein	head	J7KJ42	Streptococcus_phage	84.5	4.2e-49
WP_063631325.1|1038396_1038699_-|head,tail	phage head-tail connector protein	head,tail	J7KC36	Streptococcus_phage	88.0	4.7e-44
WP_023610889.1|1038834_1040037_-|capsid	phage major capsid protein	capsid	J7KJ82	Streptococcus_phage	64.7	2.7e-135
WP_063631324.1|1040062_1040728_-|protease	Clp protease ClpP	protease	M1Q115	Streptococcus_phage	77.2	2.3e-91
WP_063631323.1|1040705_1041926_-|portal	phage portal protein	portal	J7KDU3	Streptococcus_phage	81.9	9.0e-187
WP_002985363.1|1041959_1042184_-	hypothetical protein	NA	Q938K9	Temperate_phage	61.4	3.6e-17
WP_002985365.1|1042176_1042347_-	hypothetical protein	NA	J7KK43	Streptococcus_phage	62.5	2.3e-08
WP_063632717.1|1042343_1044098_-|terminase	terminase large subunit	terminase	J7KKD1	Streptococcus_phage	95.9	0.0e+00
WP_085577347.1|1044101_1044332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002985371.1|1044334_1044802_-|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	98.7	3.9e-82
WP_063632710.1|1044972_1045311_-	HNH endonuclease	NA	J7KH36	Streptococcus_phage	97.2	2.4e-57
WP_011017866.1|1045560_1046001_-	ArpU family transcriptional regulator	NA	Q938L8	Temperate_phage	100.0	5.0e-79
WP_111685765.1|1046273_1046909_-	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	67.0	3.0e-85
WP_111685766.1|1047407_1047635_-	hypothetical protein	NA	A3F630	Streptococcus_phage	76.0	4.3e-26
WP_111685768.1|1048044_1048395_-	VRR-NUC domain-containing protein	NA	A0A1P8VVL5	Streptococcus_phage	87.5	2.2e-45
WP_014635521.1|1048348_1049218_-	bifunctional DNA primase/polymerase	NA	A0A1P8BME8	Lactococcus_phage	65.6	5.8e-103
WP_011017876.1|1049486_1051040_-	hypothetical protein	NA	A0A1P8BM51	Lactococcus_phage	70.6	1.5e-210
WP_085577342.1|1051057_1051540_-	DUF669 domain-containing protein	NA	A0A1P8BM40	Lactococcus_phage	70.7	1.7e-59
WP_085577341.1|1051544_1052948_-	DEAD/DEAH box helicase	NA	A0A1P8BMH7	Lactococcus_phage	72.1	2.3e-194
WP_014635524.1|1052983_1053667_-	AAA family ATPase	NA	J7KC09	Streptococcus_phage	98.2	4.6e-124
WP_011284877.1|1053663_1053948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002984315.1|1053944_1054139_-	hypothetical protein	NA	J7KK69	Streptococcus_phage	54.2	3.9e-12
WP_011284878.1|1054138_1054468_-	hypothetical protein	NA	J7KBZ0	Streptococcus_phage	41.8	7.9e-13
WP_011017881.1|1054548_1054686_-	hypothetical protein	NA	A0A097PAR2	Streptococcus_pyogenes_phage	100.0	3.4e-18
WP_011017882.1|1054682_1054979_-	hypothetical protein	NA	A0A097PAT8	Streptococcus_pyogenes_phage	98.0	3.1e-48
WP_011054585.1|1055057_1055243_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	72.1	3.3e-16
WP_011284879.1|1055409_1055649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002984292.1|1055798_1056008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021340169.1|1056223_1056463_-	helix-turn-helix transcriptional regulator	NA	A0A097PBE6	Streptococcus_pyogenes_phage	97.5	3.1e-35
WP_111685769.1|1056512_1057019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021340823.1|1057015_1057162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085577339.1|1057218_1058004_+	hypothetical protein	NA	A0A1S5S7L0	Streptococcus_phage	57.4	4.8e-48
WP_080465047.1|1058137_1058296_-	hypothetical protein	NA	J7KH24	Streptococcus_phage	92.3	3.4e-22
WP_021340822.1|1058469_1059258_+	peptidase S24	NA	A0A1S5SD15	Streptococcus_phage	62.6	2.9e-85
WP_011106738.1|1059267_1059573_+	membrane protein	NA	NA	NA	NA	NA
WP_023079773.1|1059692_1060781_+|integrase	site-specific integrase	integrase	Q38159	Streptococcus_phage	98.6	3.0e-202
WP_002989605.1|1061143_1061764_+	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
1060824:1060919	attR	ACTCCCACCAGCTCCATCAATGCTTACCGTAAGTAATCATAACTTACTAAAACCTTGTTACATCAAGGTTTTTTCTTTTTGTCTTGTTCATGAGTT	NA	NA	NA	NA
WP_002992581.1|1062020_1064285_-	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	43.7	1.2e-11
>prophage 7
NZ_LS483352	Streptococcus pyogenes strain NCTC12052 chromosome 1	1857727	1093670	1153043	1857727	transposase,tRNA,protease	Enterococcus_phage(25.0%)	50	NA	NA
WP_172450120.1|1093670_1095012_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	48.7	2.0e-62
WP_002992869.1|1095312_1096185_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_111685772.1|1096408_1097719_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_011284472.1|1097796_1098090_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_111685773.1|1098038_1098692_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	38.5	7.3e-26
WP_014635546.1|1098731_1098845_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011017915.1|1098861_1099593_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_011017916.1|1099706_1100072_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_014407647.1|1100191_1101412_-	MFS transporter	NA	NA	NA	NA	NA
WP_002995506.1|1101785_1103270_+	DUF1846 domain-containing protein	NA	NA	NA	NA	NA
WP_002984115.1|1103374_1103776_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_111685774.1|1104790_1106182_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	98.7	2.4e-260
WP_111685775.1|1106230_1107682_-	LCP family protein	NA	NA	NA	NA	NA
WP_002989310.1|1107889_1108381_-	shikimate kinase	NA	NA	NA	NA	NA
WP_002984103.1|1108373_1109657_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_014407653.1|1109767_1110733_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_011054629.1|1110734_1111595_-	methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002989302.1|1111610_1112894_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_002984095.1|1112902_1113445_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011054631.1|1114608_1115868_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_111685776.1|1116041_1117238_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	65.9	5.3e-139
WP_014635553.1|1117773_1120131_-	pneumococcal-type histidine triad protein	NA	NA	NA	NA	NA
WP_002984078.1|1120334_1121276_+	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor	NA	NA	NA	NA	NA
WP_012560785.1|1121250_1121454_-	DUF3272 domain-containing protein	NA	NA	NA	NA	NA
WP_021733069.1|1121549_1123220_-	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.6	5.1e-47
WP_009881127.1|1123219_1123717_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002992609.1|1123861_1124671_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002989257.1|1124723_1124987_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_002984060.1|1125066_1125693_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.7	2.2e-35
WP_002989254.1|1125790_1126876_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	1.6e-33
WP_020837316.1|1126985_1128260_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_011284931.1|1128354_1129782_-	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_023609954.1|1129966_1131700_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_002984031.1|1131704_1131968_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_002989242.1|1132360_1132579_+	redoxin NrdH	NA	A0A249XUR7	Enterococcus_phage	49.3	1.1e-13
WP_038432376.1|1132598_1134758_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	63.4	6.1e-263
WP_002987365.1|1135090_1136050_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	70.5	3.7e-127
WP_142402474.1|1136039_1137338_+	chloride channel protein	NA	NA	NA	NA	NA
WP_002995750.1|1138681_1139377_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002995753.1|1139395_1140157_-	DUF3169 family protein	NA	NA	NA	NA	NA
WP_002989220.1|1140153_1140369_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002995756.1|1140729_1143348_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.1	1.1e-61
WP_020837342.1|1143734_1144790_-	peptidylprolyl isomerase PrsA	NA	NA	NA	NA	NA
WP_002989211.1|1144852_1145560_-	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	27.2	2.6e-08
WP_111685777.1|1145625_1146822_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_002995768.1|1147197_1149003_-	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_111685778.1|1149015_1149978_-	competence protein CoiA	NA	NA	NA	NA	NA
WP_002995774.1|1150273_1150990_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_002995779.1|1151108_1151813_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_002995782.1|1152014_1153043_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
>prophage 8
NZ_LS483352	Streptococcus pyogenes strain NCTC12052 chromosome 1	1857727	1177556	1217567	1857727	integrase,terminase,tail,holin,capsid,portal	Streptococcus_phage(68.0%)	59	1179761:1179780	1214940:1214959
WP_002994378.1|1177556_1179419_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.8	2.4e-90
1179761:1179780	attL	AATTATTTAACAGCGTCTTT	NA	NA	NA	NA
WP_014635572.1|1179949_1180132_-	hypothetical protein	NA	A3F673	Streptococcus_phage	80.0	1.7e-20
WP_014635573.1|1180371_1181130_+	DNase Mf2	NA	NA	NA	NA	NA
WP_002985327.1|1181240_1181948_+	streptococcal pyrogenic exotoxin SpeC	NA	A0A097PAT7	Streptococcus_pyogenes_phage	27.1	3.9e-09
WP_014635574.1|1182016_1183234_-	glucosaminidase domain-containing protein	NA	A0A1P8VVM5	Streptococcus_phage	60.1	1.1e-163
WP_003058873.1|1183352_1183580_-|holin	phage holin	holin	A7J2B3	Streptococcus_phage	100.0	2.0e-31
WP_011017397.1|1183576_1183849_-	hypothetical protein	NA	A7J2B2	Streptococcus_phage	91.0	5.5e-36
WP_111685784.1|1183860_1184493_-	hypothetical protein	NA	Q938J7	Temperate_phage	50.5	1.2e-44
WP_011528780.1|1184495_1184924_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	87.9	3.7e-63
WP_011528781.1|1184932_1186714_-	hypothetical protein	NA	Q938J9	Temperate_phage	40.2	1.5e-65
WP_111685785.1|1186728_1187742_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	91.1	2.7e-168
WP_168388764.1|1187741_1189715_-|tail	phage tail protein	tail	M1PKG3	Streptococcus_phage	49.6	2.0e-98
WP_002992579.1|1189696_1190392_-	hypothetical protein	NA	A0A1B1P761	Bacillus_phage	32.2	4.7e-07
WP_111685787.1|1190388_1192752_-	hypothetical protein	NA	M1NRG5	Streptococcus_phage	50.1	2.5e-132
WP_011054678.1|1192751_1193123_-	DUF5361 domain-containing protein	NA	M1PL84	Streptococcus_phage	62.4	1.7e-35
WP_010922455.1|1193137_1193401_-	hypothetical protein	NA	A0A0B5A2F3	Streptococcus_phage	55.8	1.0e-18
WP_011054679.1|1193411_1194002_-	hypothetical protein	NA	M1PKG8	Streptococcus_phage	62.5	1.1e-60
WP_000573598.1|1194017_1194353_-	hypothetical protein	NA	A0A1P8BMR5	Lactococcus_phage	64.9	9.8e-35
WP_000032787.1|1194353_1194590_-	hypothetical protein	NA	A0A1P8BMT2	Lactococcus_phage	66.7	2.5e-21
WP_011054681.1|1194582_1194921_-	hypothetical protein	NA	A0A0B5A086	Streptococcus_phage	75.0	8.1e-45
WP_011054682.1|1194880_1195303_-	hypothetical protein	NA	A0A0B5A2F6	Streptococcus_phage	67.2	8.2e-47
WP_010922460.1|1195312_1195513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011054683.1|1195512_1196424_-|capsid	phage major capsid protein	capsid	M1PFL0	Streptococcus_phage	67.0	2.9e-113
WP_010922462.1|1196448_1196910_-	DUF4355 domain-containing protein	NA	M1Q1L0	Streptococcus_phage	53.2	4.5e-38
WP_011054685.1|1196990_1198406_-|terminase	terminase	terminase	A0A0B5A091	Streptococcus_phage	74.0	1.5e-212
WP_011106704.1|1198487_1198703_-	hypothetical protein	NA	M1IRA5	Streptococcus_phage	72.4	4.1e-26
WP_002986828.1|1198704_1198971_-	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	6.4e-37
WP_011054687.1|1198963_1199116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002994100.1|1199192_1199417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010922467.1|1199422_1200916_-	hypothetical protein	NA	M1Q184	Streptococcus_phage	55.0	2.0e-87
WP_010922468.1|1200908_1202177_-|portal	phage portal protein	portal	M1PFL4	Streptococcus_phage	75.6	2.2e-188
WP_002994106.1|1202173_1202530_-	hypothetical protein	NA	M1PRL3	Streptococcus_phage	57.8	2.4e-07
WP_011054690.1|1202677_1203022_-	HNH endonuclease	NA	M1Q0W7	Streptococcus_phage	69.4	3.2e-41
WP_011528791.1|1203129_1203549_-	DUF1492 domain-containing protein	NA	A0A1X9I5B5	Streptococcus_phage	79.9	6.7e-57
WP_011054692.1|1203624_1203876_-	hypothetical protein	NA	M1PF60	Streptococcus_phage	59.0	1.6e-18
WP_011054693.1|1203872_1204028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011054694.1|1204024_1204342_-	DUF1372 family protein	NA	A1EAD7	Streptococcus_phage	71.4	9.0e-30
WP_011054695.1|1204377_1204890_-	hypothetical protein	NA	M1PFM2	Streptococcus_phage	85.9	1.7e-78
WP_011184741.1|1204886_1205219_-	hypothetical protein	NA	M1NS23	Streptococcus_phage	67.0	8.8e-36
WP_011054697.1|1205229_1206576_-	PcfJ domain-containing protein	NA	A8ATM0	Listeria_phage	49.4	1.0e-122
WP_011054698.1|1206572_1206968_-	hypothetical protein	NA	A8ATL9	Listeria_phage	52.3	1.4e-19
WP_111685788.1|1207332_1208130_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	J7KGZ1	Streptococcus_phage	84.5	4.1e-132
WP_000594115.1|1208122_1208323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011054700.1|1208319_1209246_-	recombinase RecT	NA	M1NRN6	Streptococcus_phage	71.8	1.2e-90
WP_011528796.1|1209248_1209578_-	hypothetical protein	NA	J7KGX3	Streptococcus_phage	84.4	7.1e-46
WP_002988357.1|1209633_1209840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002988354.1|1209848_1209989_-	hypothetical protein	NA	A0A1X9I6Y1	Streptococcus_phage	54.5	3.4e-05
WP_010922205.1|1209985_1210219_-	hypothetical protein	NA	Q938N1	Temperate_phage	96.1	2.8e-36
WP_011017564.1|1210199_1210586_-	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	51.9	8.1e-25
WP_010922477.1|1211119_1211305_-	hypothetical protein	NA	Q938N3	Temperate_phage	83.6	1.3e-20
WP_010922478.1|1211306_1211618_-	excisionase	NA	A0A1S5SA25	Streptococcus_phage	77.7	5.3e-43
WP_010922479.1|1211887_1212100_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I583	Streptococcus_phage	56.7	1.1e-10
WP_010922480.1|1212301_1213057_+	helix-turn-helix transcriptional regulator	NA	A0A1S5S8S8	Streptococcus_phage	60.8	2.8e-77
WP_010922481.1|1213068_1213587_+	restriction endonuclease	NA	E8ZDN5	Streptococcus_phage	45.9	9.2e-32
WP_003051793.1|1213710_1214853_+|integrase	site-specific integrase	integrase	M1NRJ9	Streptococcus_phage	77.4	2.4e-173
WP_002983920.1|1214941_1215217_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	73.0	2.6e-25
1214940:1214959	attR	AATTATTTAACAGCGTCTTT	NA	NA	NA	NA
WP_002989129.1|1215315_1215903_-	YpmS family protein	NA	NA	NA	NA	NA
WP_002992620.1|1215880_1216723_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002983913.1|1216715_1217567_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.7	5.4e-13
>prophage 9
NZ_LS483352	Streptococcus pyogenes strain NCTC12052 chromosome 1	1857727	1686145	1798885	1857727	integrase,protease,head,terminase,tail,tRNA,holin,capsid,portal,bacteriocin	Streptococcus_phage(63.93%)	113	1716475:1716500	1748157:1748182
WP_053308647.1|1686145_1686451_-|protease	Spi family protease inhibitor	protease	NA	NA	NA	NA
WP_021733538.1|1686452_1687649_-	cysteine proteinase exotoxin SpeB	NA	NA	NA	NA	NA
WP_002982418.1|1687920_1688091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002982409.1|1688589_1689432_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_010922721.1|1689672_1690488_-	streptodornase B	NA	A7J2B8	Streptococcus_phage	33.3	6.7e-29
WP_011527790.1|1690851_1691361_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.5	4.2e-37
WP_011285237.1|1691442_1692531_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_002991266.1|1692587_1693256_-	fructose-6-phosphate aldolase	NA	NA	NA	NA	NA
WP_111685846.1|1693268_1695686_-	glycyl radical protein	NA	Q66LZ4	Escherichia_phage	52.8	3.6e-09
WP_023610203.1|1695896_1697201_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002992103.1|1697210_1697519_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002992105.1|1697546_1697867_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_111685847.1|1698155_1699136_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002991277.1|1699151_1699898_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002992110.1|1700023_1700797_+	glycyl-radical enzyme activating protein	NA	A0A0U2DAM7	Escherichia_phage	36.2	3.8e-05
WP_002982348.1|1701033_1701210_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002982344.1|1701223_1701376_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_011106917.1|1701424_1703761_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_002982339.1|1703799_1704180_-	RidA family protein	NA	NA	NA	NA	NA
WP_002991284.1|1704755_1705757_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	26.6	3.7e-05
WP_011055066.1|1705845_1707486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002991288.1|1707732_1709232_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_002982320.1|1710460_1712092_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	55.1	1.8e-153
WP_002991292.1|1712127_1712418_-	co-chaperone GroES	NA	NA	NA	NA	NA
WP_111685848.1|1712595_1715040_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	39.2	5.4e-122
WP_002982312.1|1715039_1715501_-	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002991299.1|1715696_1715900_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	80.0	6.1e-24
1716475:1716500	attL	ATTTGCCCACCATTTGCCCACCAACT	NA	NA	NA	NA
WP_063629765.1|1716498_1717569_-|integrase	site-specific integrase	integrase	A0A1P8VVR7	Streptococcus_phage	48.3	9.6e-92
WP_111685849.1|1717696_1717999_-	hypothetical protein	NA	A0A1S5SAH9	Streptococcus_phage	53.6	1.5e-21
WP_063629763.1|1717991_1718378_-	hypothetical protein	NA	Q938N7	Temperate_phage	61.6	2.4e-37
WP_063629762.1|1718381_1718732_-	helix-turn-helix transcriptional regulator	NA	A0A1S5S8C4	Streptococcus_phage	70.6	8.1e-40
WP_111685850.1|1719128_1719338_+	helix-turn-helix transcriptional regulator	NA	A0A1P8VVQ4	Streptococcus_phage	88.2	3.0e-26
WP_063629760.1|1719337_1719700_+	hypothetical protein	NA	A0A1P8VVU1	Streptococcus_phage	68.8	6.6e-37
WP_063629759.1|1719721_1720006_+	hypothetical protein	NA	B3GVX8	Streptococcus_phage	81.9	3.5e-41
WP_063629758.1|1720032_1720251_+	hypothetical protein	NA	A0A1P8VVV1	Streptococcus_phage	83.3	3.9e-24
WP_111685851.1|1720259_1721606_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	83.7	9.3e-209
WP_111685852.1|1721592_1722339_+	conserved phage C-terminal domain-containing protein	NA	A0A1P8VVR3	Streptococcus_phage	96.0	3.5e-133
WP_111685853.1|1722339_1723161_+	ATP-binding protein	NA	A0A1P8VVV9	Streptococcus_phage	95.2	1.1e-148
WP_063629755.1|1723160_1723388_+	hypothetical protein	NA	C5J991	Streptococcus_phage	46.6	1.3e-11
WP_168388561.1|1723401_1723572_+	hypothetical protein	NA	Q938M0	Temperate_phage	96.8	2.5e-10
WP_109982045.1|1723568_1723838_+	hypothetical protein	NA	A7J287	Streptococcus_phage	77.5	1.4e-28
WP_111685854.1|1723840_1724590_+	site-specific DNA-methyltransferase	NA	Q9MCL7	Streptococcus_virus	89.5	7.3e-131
WP_111685855.1|1725395_1725614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032460876.1|1725610_1726003_+	single-stranded DNA-binding protein	NA	A0A1P8VVS8	Streptococcus_phage	71.7	4.1e-48
WP_029713970.1|1726016_1726295_+	hypothetical protein	NA	A3F632	Streptococcus_phage	96.7	9.6e-44
WP_063629751.1|1726389_1726617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063629750.1|1726588_1727053_+	hypothetical protein	NA	A0A1P8VVT5	Streptococcus_phage	92.2	5.8e-78
WP_063629749.1|1727162_1727705_+|integrase	site-specific integrase	integrase	A0A1S5SCL7	Streptococcus_phage	98.9	8.3e-100
WP_063629748.1|1727874_1728057_+	hypothetical protein	NA	A0A1S5SAV8	Streptococcus_phage	51.7	6.5e-09
WP_111685856.1|1728322_1728640_+	HNH endonuclease	NA	A0A1S5SD32	Streptococcus_phage	90.5	6.4e-52
WP_000601034.1|1728757_1729243_+	hypothetical protein	NA	A0A1S5SCZ6	Streptococcus_phage	98.1	3.2e-79
WP_111685857.1|1729235_1730948_+|terminase	terminase large subunit	terminase	A0A1S5SCW2	Streptococcus_phage	97.0	0.0e+00
WP_111685858.1|1730956_1732099_+|portal	phage portal protein	portal	A0A1P8VVT4	Streptococcus_phage	98.2	5.3e-213
WP_063629746.1|1732149_1732692_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1P8VVX2	Streptococcus_phage	96.7	6.8e-94
WP_063629745.1|1732702_1733965_+|capsid	phage major capsid protein	capsid	A0A1P8VVT0	Streptococcus_phage	85.6	5.8e-197
WP_032460894.1|1733984_1734323_+	hypothetical protein	NA	A0A1P8VVS7	Streptococcus_phage	80.6	1.2e-45
WP_032460893.1|1734319_1734625_+|head,tail	head-tail adaptor protein	head,tail	A0A1P8VVX4	Streptococcus_phage	84.2	5.4e-40
WP_032460892.1|1734624_1734972_+	hypothetical protein	NA	A0A1P8VVS6	Streptococcus_phage	92.2	3.6e-56
WP_063629744.1|1734958_1735303_+	hypothetical protein	NA	A0A1P8VVU6	Streptococcus_phage	92.1	8.8e-55
WP_063629743.1|1735317_1735989_+|tail	phage tail protein	tail	A0A1P8VVR1	Streptococcus_phage	89.9	7.6e-111
WP_063629742.1|1735992_1736466_+	hypothetical protein	NA	A0A0A0YX24	Streptococcus_phage	90.4	9.2e-79
WP_111685860.1|1736655_1739391_+|tail	phage tail tape measure protein	tail	A0A1P8VVW8	Streptococcus_phage	90.5	4.7e-244
WP_063629740.1|1739387_1740110_+	hypothetical protein	NA	A0A1P8VVR4	Streptococcus_phage	90.0	1.7e-124
WP_111685880.1|1740134_1742054_+|tail	phage tail protein	tail	A0A1P8VVT1	Streptococcus_phage	64.6	5.2e-181
WP_063629043.1|1742050_1743166_+	hyaluronoglucosaminidase	NA	A7J2A8	Streptococcus_phage	71.7	1.7e-123
WP_111685861.1|1743180_1744962_+	hypothetical protein	NA	Q938J9	Temperate_phage	42.8	2.0e-73
WP_111685862.1|1744970_1745399_+	DUF1617 family protein	NA	Q938J8	Temperate_phage	89.3	3.7e-63
WP_111685863.1|1745401_1746040_+	hypothetical protein	NA	A3F662	Streptococcus_phage	53.2	1.2e-44
WP_111685864.1|1746049_1746322_+	hypothetical protein	NA	A7J2B2	Streptococcus_phage	89.9	1.6e-35
WP_003058873.1|1746318_1746546_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	100.0	2.0e-31
WP_111685865.1|1746661_1747879_+	glucosaminidase domain-containing protein	NA	A0A1P8VVM5	Streptococcus_phage	60.1	3.7e-164
WP_002982304.1|1748756_1749317_+	peroxiredoxin	NA	NA	NA	NA	NA
1748157:1748182	attR	ATTTGCCCACCATTTGCCCACCAACT	NA	NA	NA	NA
WP_002982300.1|1749337_1750870_+	alkyl hydroperoxide reductase subunit F	NA	A0A2I2L5E1	Orpheovirus	37.5	1.4e-43
WP_002982296.1|1750927_1752193_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_020905558.1|1752484_1754515_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_011055073.1|1754602_1755502_+	glutamate formimidoyltransferase	NA	NA	NA	NA	NA
WP_111685866.1|1755512_1756139_+	cyclodeaminase/cyclohydrolase family protein	NA	NA	NA	NA	NA
WP_093974938.1|1756156_1757830_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_093974939.1|1757851_1758448_+	HutD family protein	NA	NA	NA	NA	NA
WP_093974941.1|1758667_1760011_+	APC family permease	NA	NA	NA	NA	NA
WP_111685867.1|1760022_1761564_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	43.9	3.1e-99
WP_002982269.1|1761749_1762736_+	arginase family protein	NA	NA	NA	NA	NA
WP_093974943.1|1762766_1765841_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_002982262.1|1766144_1766912_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_010922743.1|1767045_1768086_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_002992817.1|1768251_1770147_-	M13 family metallopeptidase	NA	A0A1V0SHG2	Klosneuvirus	28.7	5.2e-72
WP_023610271.1|1770354_1771983_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_111685868.1|1772050_1774075_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_111676868.1|1774285_1774999_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_076637095.1|1775278_1775545_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038432671.1|1775802_1776660_+	VOC family protein	NA	NA	NA	NA	NA
WP_002982222.1|1776701_1777433_+	peroxide stress protein YaaA	NA	A0A1X9I5I0	Streptococcus_phage	37.0	1.6e-34
WP_002982219.1|1777606_1778221_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	56.7	1.5e-52
WP_002991345.1|1778220_1778730_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_111685869.1|1778738_1779674_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002982210.1|1779702_1779849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002992831.1|1780030_1782229_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	64.9	2.6e-277
WP_030126183.1|1782325_1783885_-	membrane protein	NA	NA	NA	NA	NA
WP_002982199.1|1784297_1784603_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_002982196.1|1784614_1785034_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002982194.1|1785030_1785300_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_002982188.1|1785414_1785813_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_002992179.1|1786103_1787240_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	63.0	1.4e-120
WP_002992182.1|1787328_1788600_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_002992183.1|1788668_1789229_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_038432673.1|1789238_1789835_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_002992187.1|1789836_1791057_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	23.6	3.5e-05
WP_002992189.1|1791067_1793050_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.1	2.3e-62
WP_002993100.1|1793178_1795734_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	23.3	5.2e-43
WP_002982173.1|1795720_1795927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002993102.1|1796069_1796507_-	arginine repressor	NA	NA	NA	NA	NA
WP_002993104.1|1796797_1798489_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.4	1.9e-73
WP_002993106.1|1798576_1798885_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
