The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483340	Streptococcus pyogenes strain NCTC12062 chromosome 1	1827653	36637	48951	1827653		Synechococcus_phage(28.57%)	8	NA	NA
WP_047235603.1|36637_40363_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	26.9	4.6e-40
WP_047235604.1|40523_41978_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.1	1.7e-54
WP_002987707.1|42005_43028_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	41.8	4.0e-63
WP_002987709.1|43195_43750_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.6	6.8e-25
WP_111698523.1|43933_45481_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	51.8	3.7e-44
WP_111698525.1|45539_46664_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	27.7	1.3e-06
WP_032467308.1|46916_48182_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002987716.1|48459_48951_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	3.2e-18
>prophage 2
NZ_LS483340	Streptococcus pyogenes strain NCTC12062 chromosome 1	1827653	632948	673732	1827653	terminase,holin,portal,integrase,capsid,tail	Streptococcus_phage(69.39%)	58	635557:635576	670273:670292
WP_047235758.1|632948_633800_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.7	5.4e-13
WP_011888746.1|633792_634635_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002989129.1|634612_635200_+	YpmS family protein	NA	NA	NA	NA	NA
WP_002983920.1|635298_635574_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	73.0	2.6e-25
635557:635576	attL	AAAGACGCTGTTAAATAATT	NA	NA	NA	NA
WP_003051793.1|635662_636805_-|integrase	site-specific integrase	integrase	M1NRJ9	Streptococcus_phage	77.4	2.4e-173
WP_010922481.1|636928_637447_-	restriction endonuclease	NA	E8ZDN5	Streptococcus_phage	45.9	9.2e-32
WP_010922480.1|637458_638214_-	helix-turn-helix transcriptional regulator	NA	A0A1S5S8S8	Streptococcus_phage	60.8	2.8e-77
WP_010922479.1|638415_638628_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I583	Streptococcus_phage	56.7	1.1e-10
WP_010922478.1|638897_639209_+	excisionase	NA	A0A1S5SA25	Streptococcus_phage	77.7	5.3e-43
WP_010922477.1|639210_639396_+	hypothetical protein	NA	Q938N3	Temperate_phage	83.6	1.3e-20
WP_011017564.1|639899_640286_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	51.9	8.1e-25
WP_010922205.1|640266_640500_+	hypothetical protein	NA	Q938N1	Temperate_phage	96.1	2.8e-36
WP_002988354.1|640496_640637_+	hypothetical protein	NA	A0A1X9I6Y1	Streptococcus_phage	54.5	3.4e-05
WP_002988357.1|640645_640852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011054700.1|641240_642167_+	recombinase RecT	NA	M1NRN6	Streptococcus_phage	71.8	1.2e-90
WP_000594115.1|642163_642364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011054699.1|642356_643154_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	J7KGZ1	Streptococcus_phage	83.8	1.3e-130
WP_011054698.1|643518_643914_+	hypothetical protein	NA	A8ATL9	Listeria_phage	52.3	1.4e-19
WP_011054697.1|643910_645257_+	PcfJ domain-containing protein	NA	A8ATM0	Listeria_phage	49.4	1.0e-122
WP_011184741.1|645267_645600_+	hypothetical protein	NA	M1NS23	Streptococcus_phage	67.0	8.8e-36
WP_011054695.1|645596_646109_+	hypothetical protein	NA	M1PFM2	Streptococcus_phage	85.9	1.7e-78
WP_011054694.1|646144_646462_+	DUF1372 family protein	NA	A1EAD7	Streptococcus_phage	71.4	9.0e-30
WP_011054693.1|646458_646614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011054692.1|646610_646862_+	hypothetical protein	NA	M1PF60	Streptococcus_phage	59.0	1.6e-18
WP_011054691.1|646937_647357_+	DUF1492 domain-containing protein	NA	A0A1X9I5B5	Streptococcus_phage	79.1	1.9e-56
WP_011054690.1|647464_647809_+	HNH endonuclease	NA	M1Q0W7	Streptococcus_phage	69.4	3.2e-41
WP_002994106.1|647956_648313_+	hypothetical protein	NA	M1PRL3	Streptococcus_phage	57.8	2.4e-07
WP_010922468.1|648309_649578_+|portal	phage portal protein	portal	M1PFL4	Streptococcus_phage	75.6	2.2e-188
WP_010922467.1|649570_651064_+	hypothetical protein	NA	M1Q184	Streptococcus_phage	55.0	2.0e-87
WP_002994100.1|651069_651294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011054687.1|651370_651523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986828.1|651515_651782_+	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	6.4e-37
WP_011106704.1|651783_651999_+	hypothetical protein	NA	M1IRA5	Streptococcus_phage	72.4	4.1e-26
WP_011054685.1|652080_653496_+|terminase	terminase	terminase	A0A0B5A091	Streptococcus_phage	74.0	1.5e-212
WP_010922462.1|653576_654038_+	DUF4355 domain-containing protein	NA	M1Q1L0	Streptococcus_phage	53.2	4.5e-38
WP_011054683.1|654062_654974_+|capsid	phage major capsid protein	capsid	M1PFL0	Streptococcus_phage	67.0	2.9e-113
WP_010922460.1|654973_655174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011054682.1|655183_655606_+	hypothetical protein	NA	A0A0B5A2F6	Streptococcus_phage	67.2	8.2e-47
WP_011054681.1|655565_655904_+	hypothetical protein	NA	A0A0B5A086	Streptococcus_phage	75.0	8.1e-45
WP_000032787.1|655896_656133_+	hypothetical protein	NA	A0A1P8BMT2	Lactococcus_phage	66.7	2.5e-21
WP_000573598.1|656133_656469_+	hypothetical protein	NA	A0A1P8BMR5	Lactococcus_phage	64.9	9.8e-35
WP_011054679.1|656484_657075_+	hypothetical protein	NA	M1PKG8	Streptococcus_phage	62.5	1.1e-60
WP_010922455.1|657085_657349_+	hypothetical protein	NA	A0A0B5A2F3	Streptococcus_phage	55.8	1.0e-18
WP_011054678.1|657363_657735_+	DUF5361 domain-containing protein	NA	M1PL84	Streptococcus_phage	62.4	1.7e-35
WP_030126402.1|657734_660098_+	hypothetical protein	NA	M1NRG5	Streptococcus_phage	50.2	2.1e-131
WP_002992579.1|660094_660790_+	hypothetical protein	NA	A0A1B1P761	Bacillus_phage	32.2	4.7e-07
WP_011054676.1|660771_662745_+|tail	phage tail protein	tail	M1PKG3	Streptococcus_phage	49.6	2.0e-98
WP_011054675.1|662744_663854_+	hyaluronoglucosaminidase	NA	A7J2A8	Streptococcus_phage	65.9	1.2e-113
WP_011184733.1|663868_665650_+	hypothetical protein	NA	Q938J9	Temperate_phage	41.7	3.4e-73
WP_011184732.1|665658_666087_+	DUF1617 family protein	NA	A3F661	Streptococcus_phage	92.9	2.8e-66
WP_011184731.1|666089_666701_+	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	88.7	4.1e-79
WP_011184730.1|666710_667166_+|holin	phage holin family protein	holin	A0A0M4R3G6	Streptococcus_phage	81.5	2.3e-63
WP_030126404.1|667283_668036_+	SH3 domain-containing protein	NA	A3F665	Streptococcus_phage	96.4	3.9e-140
WP_002985327.1|668104_668812_-	streptococcal pyrogenic exotoxin SpeC	NA	A0A097PAT7	Streptococcus_pyogenes_phage	27.1	3.9e-09
WP_011184727.1|668922_669681_-	DNase Mf2	NA	NA	NA	NA	NA
WP_011184726.1|669920_670103_+	hypothetical protein	NA	A3F673	Streptococcus_phage	81.7	2.0e-21
WP_047235759.1|670634_672497_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.1	2.4e-90
670273:670292	attR	AAAGACGCTGTTAAATAATT	NA	NA	NA	NA
WP_047235760.1|672796_673732_-	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	44.8	1.3e-65
>prophage 3
NZ_LS483340	Streptococcus pyogenes strain NCTC12062 chromosome 1	1827653	993099	1073520	1827653	terminase,head,integrase,capsid,transposase,tail	Streptococcus_phage(65.38%)	80	1028525:1028546	1070746:1070767
WP_000564846.1|993099_994233_-|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
WP_002984851.1|995289_995922_-	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_002984852.1|995921_996686_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_011527617.1|996685_997438_-	acyl-[acyl-carrier-protein] thioesterase	NA	NA	NA	NA	NA
WP_002989962.1|997447_998578_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_023611160.1|998640_999282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011184463.1|999405_1000761_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_047235836.1|1000814_1001771_-	YbbR-like domain-containing protein	NA	NA	NA	NA	NA
WP_002989969.1|1001767_1002619_-	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_023611114.1|1002725_1004069_+	Mur ligase family protein	NA	NA	NA	NA	NA
WP_020905130.1|1004068_1004860_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_047235837.1|1004968_1005958_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	23.9	4.1e-12
WP_047235838.1|1006190_1008608_+	polysaccharide lyase 8 family protein	NA	NA	NA	NA	NA
WP_002989978.1|1009280_1011044_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.5	1.2e-33
WP_047235839.1|1011374_1012784_-	dihydrolipoamide acetyltransferase	NA	NA	NA	NA	NA
WP_002989981.1|1012968_1013967_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_002989983.1|1014025_1014994_-	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_047235840.1|1015278_1017186_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.8	1.3e-54
WP_111698599.1|1017231_1017558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047235841.1|1017587_1018373_-	esterase family protein	NA	NA	NA	NA	NA
WP_002984872.1|1018505_1020167_-	ribonuclease J	NA	NA	NA	NA	NA
WP_002989991.1|1020370_1021129_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.3	5.9e-11
WP_011017706.1|1021125_1021995_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_047235842.1|1022171_1022390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011184452.1|1022340_1023339_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047235843.1|1023692_1025345_+	PavA family fibronectin-binding protein Fbp54	NA	A0A1J0F9J4	Only_Syngen_Nebraska_virus	41.0	1.7e-07
WP_002984878.1|1025403_1026651_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_002984879.1|1026640_1027822_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002984880.1|1027879_1028356_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
1028525:1028546	attL	AAAGAACCTTGTCATATCAACG	NA	NA	NA	NA
WP_010922229.1|1028959_1029670_-	streptococcal pyrogenic exotoxin SpeH	NA	NA	NA	NA	NA
WP_047373492.1|1029695_1030373_-	streptococcal pyrogenic exotoxin SpeI	NA	A0A075M4C7	Staphylococcus_phage	32.4	2.4e-27
WP_011284838.1|1030646_1031981_-	lysin	NA	Q5MY96	Streptococcus_phage	93.0	1.3e-247
WP_002990010.1|1032092_1032278_-	hypothetical protein	NA	Q938J5	Temperate_phage	95.1	1.9e-24
WP_002990012.1|1032274_1032571_-	hypothetical protein	NA	Q938J6	Temperate_phage	98.0	3.7e-46
WP_111679824.1|1032580_1033192_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	95.1	1.7e-85
WP_047235845.1|1033194_1033623_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	82.9	4.0e-57
WP_047235846.1|1033631_1035515_-	gp58-like family protein	NA	Q938J9	Temperate_phage	75.9	4.5e-185
WP_011888927.1|1035529_1036645_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	74.9	1.6e-142
WP_011888928.1|1036641_1038621_-|tail	phage tail protein	tail	A7J2A7	Streptococcus_phage	92.8	0.0e+00
WP_011054865.1|1038630_1039473_-	hypothetical protein	NA	A7J2A6	Streptococcus_phage	97.9	8.8e-157
WP_047235850.1|1039484_1043867_-	tape measure protein	NA	A7J2A5	Streptococcus_phage	75.9	3.0e-224
WP_011054867.1|1043881_1044115_-	hypothetical protein	NA	A7J2A4	Streptococcus_phage	97.4	6.4e-33
WP_023079225.1|1044189_1044645_-	phage protein	NA	A7J2A3	Streptococcus_phage	98.7	1.2e-75
WP_011054869.1|1044698_1045298_-|tail	phage major tail protein, TP901-1 family	tail	A7J2A2	Streptococcus_phage	97.1	1.7e-90
WP_011054870.1|1045309_1045669_-	hypothetical protein	NA	A7J2A1	Streptococcus_phage	98.3	1.2e-57
WP_011106640.1|1045672_1046017_-	HK97 gp10 family phage protein	NA	A7J2A0	Streptococcus_phage	98.2	5.1e-55
WP_011054872.1|1046013_1046292_-	hypothetical protein	NA	A7J299	Streptococcus_phage	100.0	1.9e-47
WP_011054873.1|1046302_1046659_-|head,tail	phage head-tail connector protein	head,tail	A7J298	Streptococcus_phage	100.0	4.6e-59
WP_002983429.1|1046670_1047558_-	hypothetical protein	NA	A7J297	Streptococcus_phage	100.0	2.1e-161
WP_011054874.1|1047570_1048140_-	DUF4355 domain-containing protein	NA	A7J296	Streptococcus_phage	99.5	7.4e-83
WP_011054875.1|1048307_1048574_-	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	1.1e-36
WP_011054876.1|1048578_1048767_-	hypothetical protein	NA	A7J294	Streptococcus_phage	100.0	7.4e-24
WP_011054877.1|1048794_1050243_-|capsid	minor capsid protein	capsid	A7J293	Streptococcus_phage	99.6	1.3e-277
WP_111698603.1|1051751_1053029_-|terminase	PBSX family phage terminase large subunit	terminase	A7J291	Streptococcus_phage	98.1	4.2e-243
WP_011106637.1|1053018_1053471_-|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	100.0	6.9e-76
WP_002988747.1|1053560_1053977_-	DUF722 domain-containing protein	NA	A7J289	Streptococcus_phage	100.0	6.6e-73
WP_002988743.1|1053973_1054165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023613218.1|1054315_1054582_-	hypothetical protein	NA	A7J287	Streptococcus_phage	62.9	3.5e-19
WP_002988735.1|1054578_1054746_-	hypothetical protein	NA	A7J285	Streptococcus_phage	94.5	1.9e-23
WP_011054884.1|1054746_1056069_-	DEAD/DEAH box helicase family protein	NA	A7J284	Streptococcus_phage	97.3	7.3e-251
WP_023613183.1|1056065_1056341_-	VRR-NUC domain-containing protein	NA	A7J283	Streptococcus_phage	97.8	1.3e-45
WP_111688401.1|1056708_1059093_-	DNA primase	NA	A7J282	Streptococcus_phage	98.0	2.6e-286
WP_047235853.1|1059097_1061020_-	DNA polymerase	NA	A7J280	Streptococcus_phage	98.6	0.0e+00
WP_086934854.1|1061062_1061626_-	DUF2815 family protein	NA	D2J040	Enterococcus_phage	58.5	3.3e-51
WP_011888943.1|1061634_1062792_-	DUF2800 domain-containing protein	NA	A7J278	Streptococcus_phage	98.2	1.0e-216
WP_047235854.1|1062791_1063091_-	hypothetical protein	NA	A7J277	Streptococcus_phage	96.0	8.2e-41
WP_023613207.1|1063179_1063383_-	hypothetical protein	NA	A7J276	Streptococcus_phage	91.0	1.3e-29
WP_000049475.1|1063908_1064112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011888947.1|1064104_1064275_-	hypothetical protein	NA	A7J273	Streptococcus_phage	89.3	1.2e-20
WP_023613185.1|1064276_1064588_-	hypothetical protein	NA	A1EAC3	Streptococcus_phage	85.3	1.4e-48
WP_011888681.1|1065004_1065724_-	phage antirepressor KilAC domain-containing protein	NA	M1Q1T4	Streptococcus_phage	70.3	7.4e-88
WP_014635614.1|1065751_1065964_-	DNA-binding protein	NA	J7KBP9	Streptococcus_phage	95.7	9.2e-31
WP_011888679.1|1066161_1066503_+	helix-turn-helix transcriptional regulator	NA	J7KJZ4	Streptococcus_phage	85.8	1.2e-48
WP_047235855.1|1066486_1066870_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1P8VVK5	Streptococcus_phage	75.2	5.9e-52
WP_023613205.1|1066871_1068536_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_023613222.1|1068574_1069432_+	DNA adenine methylase	NA	A0A2H4UUI2	Bodo_saltans_virus	29.7	8.1e-17
WP_011888953.1|1069551_1070691_+|integrase	site-specific integrase	integrase	A1EAB7	Streptococcus_phage	56.3	1.2e-119
WP_002984881.1|1070773_1071814_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.9	1.1e-68
1070746:1070767	attR	CGTTGATATGACAAGGTTCTTT	NA	NA	NA	NA
WP_002990099.1|1072057_1072651_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	H9NC63	Sphingomonas_phage	28.2	3.7e-08
WP_014407521.1|1072650_1073520_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	64.2	5.4e-101
>prophage 4
NZ_LS483340	Streptococcus pyogenes strain NCTC12062 chromosome 1	1827653	1175539	1186144	1827653		Streptococcus_phage(57.14%)	9	NA	NA
WP_047235874.1|1175539_1176682_-	cysteine desulfurase	NA	H7BUW1	unidentified_phage	31.7	5.9e-15
WP_011017641.1|1176916_1177357_+	membrane protein	NA	NA	NA	NA	NA
WP_002992648.1|1177386_1178664_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_111690785.1|1178743_1180096_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.4	3.5e-30
WP_002990260.1|1180317_1180659_-	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	41.1	2.6e-19
WP_002990262.1|1180719_1181886_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	4.5e-34
WP_002985140.1|1181979_1182666_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_002985142.1|1182662_1183826_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	3.4e-143
WP_042361490.1|1183933_1186144_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	68.8	3.2e-267
>prophage 5
NZ_LS483340	Streptococcus pyogenes strain NCTC12062 chromosome 1	1827653	1471497	1477531	1827653		Streptococcus_phage(100.0%)	9	NA	NA
WP_047235952.1|1471497_1472325_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.5	2.9e-128
WP_002990897.1|1472398_1472755_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.0	1.1e-39
WP_002990900.1|1473053_1473683_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_002985833.1|1473729_1474122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047235953.1|1474148_1475012_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	74.3	1.9e-114
WP_002985838.1|1475016_1475340_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_011017422.1|1475744_1475984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047235954.1|1476002_1476878_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	41.7	6.9e-56
WP_047235955.1|1476895_1477531_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.4	5.9e-65
>prophage 6
NZ_LS483340	Streptococcus pyogenes strain NCTC12062 chromosome 1	1827653	1745705	1768531	1827653	integrase,tRNA	Streptococcus_phage(47.06%)	28	1748904:1748924	1763077:1763097
WP_047236048.1|1745705_1746926_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	23.7	7.8e-05
WP_047236089.1|1746936_1748919_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.1	3.0e-62
1748904:1748924	attL	CAATAATGTTTGTCATAATTT	NA	NA	NA	NA
WP_111690858.1|1749013_1750159_-|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	45.6	6.5e-86
WP_047236050.1|1750416_1751271_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	52.5	1.0e-56
WP_168681587.1|1751531_1751693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003058809.1|1752083_1752851_-	helix-turn-helix domain-containing protein	NA	Q76TK4	Streptococcus_pyogenes_phage	83.1	3.6e-72
WP_002992503.1|1753004_1753211_+	helix-turn-helix transcriptional regulator	NA	X2KUC2	Streptococcus_phage	47.0	2.4e-07
WP_080343567.1|1753244_1754012_+	hypothetical protein	NA	A0A0A7S0G2	Clostridium_phage	53.7	5.0e-26
WP_047236051.1|1754021_1754639_+	antirepressor	NA	A0A2H4JB17	uncultured_Caudovirales_phage	43.5	1.7e-40
WP_000648623.1|1754665_1754908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002992497.1|1755164_1755497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080032246.1|1755496_1755688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047236052.1|1755699_1756062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047236053.1|1756058_1756367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047236054.1|1756369_1756642_+	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	60.0	4.7e-19
WP_047236055.1|1756642_1757509_+	primase C-terminal domain-containing protein	NA	A0A1X9I6L2	Streptococcus_phage	73.1	1.4e-120
WP_001069294.1|1759207_1759462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011285281.1|1759458_1759632_+	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	59.6	8.6e-11
WP_047236056.1|1759637_1759811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047236057.1|1759812_1760322_+	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	62.5	4.2e-29
WP_047236058.1|1760395_1760884_+	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	54.9	3.1e-45
WP_002992136.1|1761286_1761649_+	DUF1492 domain-containing protein	NA	A0A2H4JFS1	uncultured_Caudovirales_phage	29.9	8.7e-05
WP_047236059.1|1761623_1762007_+	ArpU family transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	40.9	2.9e-14
WP_047236060.1|1762171_1762825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047236061.1|1763220_1765776_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.9	1.0e-43
1763077:1763097	attR	CAATAATGTTTGTCATAATTT	NA	NA	NA	NA
WP_011055092.1|1765762_1765969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002982171.1|1766111_1766549_-	arginine repressor	NA	NA	NA	NA	NA
WP_047236062.1|1766839_1768531_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.6	4.2e-73
