The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483382	Streptococcus pyogenes strain NCTC13738 chromosome 1	1847336	36639	49025	1847336		Synechococcus_phage(28.57%)	8	NA	NA
WP_111721327.1|36639_40365_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	27.0	3.5e-40
WP_009880323.1|40598_42053_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	3.7e-54
WP_076634016.1|42080_43103_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	41.4	1.5e-62
WP_009880321.1|43270_43825_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	5.2e-25
WP_021733664.1|44008_45556_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.9	2.6e-45
WP_002986694.1|45613_46738_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
WP_076634015.1|46990_48256_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_023079042.1|48533_49025_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.1	1.4e-18
>prophage 2
NZ_LS483382	Streptococcus pyogenes strain NCTC13738 chromosome 1	1847336	337525	395138	1847336	protease,tRNA,bacteriocin	Streptococcus_phage(33.33%)	57	NA	NA
WP_002985850.1|337525_338116_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	55.7	2.6e-54
WP_002985847.1|338610_338886_+	YlbG family protein	NA	NA	NA	NA	NA
WP_014635306.1|339134_339770_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.4	2.0e-65
WP_011528291.1|339787_340663_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	47.9	1.8e-72
WP_002985838.1|341325_341649_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_021733048.1|341653_342517_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	74.7	3.8e-115
WP_002985833.1|342543_342936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009880724.1|342982_343612_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_076634276.1|343911_344268_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.0	1.8e-39
WP_076634277.1|344341_345169_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	78.9	1.7e-128
WP_002985826.1|345402_346584_+	L-lactate oxidase	NA	NA	NA	NA	NA
WP_076634278.1|346849_351790_+|protease	CXC chemokine-degrading serine protease SpyCEP	protease	NA	NA	NA	NA
WP_042765607.1|352561_353269_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_076634279.1|353508_355509_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.1	4.6e-87
WP_002995917.1|356002_357016_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	53.4	5.5e-97
WP_002985812.1|357019_357508_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	37.5	1.3e-11
WP_076634280.1|357474_359655_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	43.3	2.8e-170
WP_076634281.1|359855_360608_-	ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_076634282.1|361066_361546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076634283.1|362051_362492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021340584.1|362680_362932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076634284.1|363027_363660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002990844.1|364702_364939_+	DUF2829 domain-containing protein	NA	NA	NA	NA	NA
WP_011017438.1|364931_365630_+	3-oxoacyl-ACP reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.6	7.1e-11
WP_076634285.1|365704_366664_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002993065.1|366996_368334_+	MFS transporter	NA	NA	NA	NA	NA
WP_076634286.1|368506_369889_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L4K9	Tupanvirus	36.0	8.5e-32
WP_002985793.1|369919_370474_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_023078625.1|370473_370725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010921957.1|370743_371439_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_023078629.1|371589_371931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023078622.1|372031_372679_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_004218965.1|372824_373757_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002985780.1|373820_374546_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.6	1.4e-17
WP_011017448.1|374546_375401_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_030126994.1|375548_376355_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	36.6	1.5e-20
WP_076634287.1|376571_378977_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	51.7	3.8e-88
WP_002990803.1|379046_379400_-	DUF3397 domain-containing protein	NA	NA	NA	NA	NA
WP_002990800.1|379643_380069_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002985768.1|380174_380864_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002985765.1|381185_381914_+	UMP kinase	NA	NA	NA	NA	NA
WP_076634288.1|381942_382500_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_076634289.1|382608_383466_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011284570.1|383538_384048_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_021340760.1|384044_384260_+	YozE family protein	NA	NA	NA	NA	NA
WP_076634290.1|384415_385597_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XB61	Gordonia_phage	39.6	2.1e-15
WP_023078789.1|385912_387685_+	oleate hydratase	NA	NA	NA	NA	NA
WP_010921967.1|387843_388896_+	PhoH family protein	NA	W8D063	Erwinia_phage	50.0	1.2e-46
WP_076634291.1|388941_389517_+	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_002985748.1|389675_390173_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_002985746.1|390153_390561_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_014635331.1|390680_391577_+	GTPase Era	NA	NA	NA	NA	NA
WP_014635332.1|391596_392073_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_002994504.1|393030_393276_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002987564.1|393290_393473_+|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_076634339.1|394676_394925_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_076634292.1|394937_395138_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 3
NZ_LS483382	Streptococcus pyogenes strain NCTC13738 chromosome 1	1847336	526943	591602	1847336	integrase,holin,terminase,capsid,tail,portal,tRNA	Temperate_phage(47.37%)	78	522100:522117	601644:601661
522100:522117	attL	TTTAAAATAGGCATTTTA	NA	NA	NA	NA
WP_002985437.1|526943_528290_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.8	1.1e-55
WP_002985434.1|528702_529593_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.8	8.8e-06
WP_076634335.1|529589_530567_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	74.2	7.3e-139
WP_011054317.1|530563_531475_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	64.7	1.0e-105
WP_023078725.1|531607_533005_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_076634119.1|533156_534704_+	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_076634118.1|534850_535573_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_111721351.1|535591_536791_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002985307.1|536887_537148_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_011528442.1|537262_538204_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_002985303.1|538597_539047_+	flavodoxin	NA	NA	NA	NA	NA
WP_002994052.1|539221_539506_+	chorismate mutase	NA	NA	NA	NA	NA
WP_076634117.1|539498_540761_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	51.3	1.1e-94
WP_002985298.1|540875_541223_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_023612372.1|541586_542663_-|integrase	site-specific integrase	integrase	Q0R5B4	Streptococcus_phage	41.2	7.5e-68
WP_023612337.1|542781_543303_-	hypothetical protein	NA	Q938N8	Temperate_phage	97.7	7.5e-66
WP_030126053.1|543313_543691_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1P8VVK5	Streptococcus_phage	77.6	1.6e-54
WP_023611288.1|543674_544034_-	helix-turn-helix transcriptional regulator	NA	A0A1P8VVN3	Streptococcus_phage	95.0	1.7e-56
WP_023612341.1|544221_544440_+	helix-turn-helix transcriptional regulator	NA	A0A1P8VVR5	Streptococcus_phage	97.2	5.9e-33
WP_023612302.1|544539_544770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164492191.1|544753_544897_+	hypothetical protein	NA	A0A1P8VVR9	Streptococcus_phage	83.7	3.4e-13
WP_023612348.1|544906_545125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003056170.1|545126_545369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023612340.1|545355_546672_+	AAA family ATPase	NA	A0A097BY67	Enterococcus_phage	63.8	7.8e-152
WP_003056188.1|546686_547769_+	AAA family ATPase	NA	A0A0K2CZH1	Paenibacillus_phage	53.3	2.5e-103
WP_003056185.1|547963_548557_+	hypothetical protein	NA	A0A097BY29	Enterococcus_phage	43.5	1.7e-29
WP_080262841.1|548556_550140_+	DEAD/DEAH box helicase	NA	A0A097BY72	Enterococcus_phage	77.8	2.0e-234
WP_023612331.1|550152_550347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023612365.1|550369_552613_+	AAA family ATPase	NA	Q5YA88	Bacillus_phage	63.7	4.7e-282
WP_003059078.1|552904_553087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023612320.1|553079_553475_+	RusA family crossover junction endodeoxyribonuclease	NA	Q5YA86	Bacillus_phage	58.8	1.8e-40
WP_023612313.1|553471_553696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023612326.1|553698_553884_+	hypothetical protein	NA	A3F626	Streptococcus_phage	82.9	6.6e-09
WP_023612315.1|553880_554132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023612304.1|554115_554520_+	hypothetical protein	NA	A3F627	Streptococcus_phage	65.2	1.6e-39
WP_014411870.1|554516_554801_+	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	89.4	1.4e-37
WP_011018133.1|554802_555435_+	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	68.6	2.3e-85
WP_014411869.1|555437_556148_+	DUF1642 domain-containing protein	NA	Q938L9	Temperate_phage	46.2	3.0e-25
WP_014411868.1|556144_556516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021340586.1|556783_557221_+	DUF1492 domain-containing protein	NA	A0A097PBF1	Streptococcus_pyogenes_phage	99.3	1.4e-76
WP_011054748.1|557739_557997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002986854.1|558077_558596_+	ParB N-terminal domain-containing protein	NA	Q938L7	Temperate_phage	100.0	1.5e-90
WP_002986850.1|558574_559252_+	hypothetical protein	NA	Q938L6	Temperate_phage	100.0	8.7e-131
WP_002986845.1|559374_559644_+	hypothetical protein	NA	B5SP24	Lactococcus_phage	51.1	2.8e-16
WP_002986841.1|559704_560082_+	ASCH domain-containing protein	NA	Q938L5	Temperate_phage	100.0	1.7e-67
WP_023612332.1|560132_560606_+	hypothetical protein	NA	Q938L4	Temperate_phage	98.7	7.3e-76
WP_010922074.1|560688_561900_+|terminase	PBSX family phage terminase large subunit	terminase	Q938L3	Temperate_phage	99.7	3.7e-225
WP_002986832.1|561913_563416_+|portal	phage portal protein	portal	Q938L2	Temperate_phage	100.0	5.4e-282
WP_011054746.1|563420_564899_+|capsid	phage minor capsid protein	capsid	Q938L1	Temperate_phage	100.0	8.2e-275
WP_002986829.1|564870_565110_+	hypothetical protein	NA	Q938L0	Temperate_phage	100.0	2.8e-36
WP_011054745.1|565171_565438_+	hypothetical protein	NA	Q938K9	Temperate_phage	100.0	1.5e-38
WP_011106689.1|565563_566178_+	hypothetical protein	NA	Q938K8	Temperate_phage	100.0	1.3e-96
WP_010922080.1|566181_567000_+|capsid	N4-gp56 family major capsid protein	capsid	Q79S85	Temperate_phage	100.0	4.0e-146
WP_011054743.1|567053_567470_+	hypothetical protein	NA	Q938K7	Temperate_phage	100.0	1.1e-56
WP_010922082.1|567459_567792_+	hypothetical protein	NA	Q79S86	Temperate_phage	100.0	9.6e-59
WP_010922083.1|567791_568148_+	hypothetical protein	NA	Q79S88	Temperate_phage	100.0	4.5e-62
WP_010922084.1|568144_568543_+|capsid	phage capsid protein	capsid	Q79S87	Temperate_phage	100.0	3.5e-71
WP_011054741.1|568542_569028_+	hypothetical protein	NA	Q938K6	Temperate_phage	100.0	1.6e-86
WP_011054740.1|569066_569501_+	hypothetical protein	NA	Q938K5	Temperate_phage	100.0	2.6e-72
WP_011284973.1|569504_570086_+	hypothetical protein	NA	Q938K4	Temperate_phage	99.5	4.9e-106
WP_023612368.1|570075_573336_+	tape measure protein	NA	Q938K3	Temperate_phage	99.5	0.0e+00
WP_011054737.1|573332_574049_+|tail	phage tail family protein	tail	Q938K2	Temperate_phage	100.0	2.9e-137
WP_011284971.1|574045_576193_+|tail	phage tail protein	tail	Q938K1	Temperate_phage	95.9	0.0e+00
WP_011284843.1|576189_577404_+	hypothetical protein	NA	A3F657	Streptococcus_phage	49.5	5.0e-44
WP_011284842.1|577390_577720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047235372.1|577730_579620_+	gp58-like family protein	NA	Q938J9	Temperate_phage	75.6	1.4e-189
WP_002988448.1|579631_580060_+	DUF1617 family protein	NA	Q938J8	Temperate_phage	84.3	8.1e-58
WP_011054443.1|580062_580695_+	hypothetical protein	NA	Q938J7	Temperate_phage	49.5	2.0e-44
WP_011017397.1|580706_580979_+	hypothetical protein	NA	A7J2B2	Streptococcus_phage	91.0	5.5e-36
WP_011054444.1|580975_581203_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	98.7	7.6e-31
WP_011054445.1|581318_582527_+	glucosaminidase domain-containing protein	NA	Q938J4	Temperate_phage	87.5	2.9e-214
WP_050440680.1|582636_583623_-	DNA/RNA non-specific endonuclease	NA	A7J2B8	Streptococcus_phage	99.7	5.2e-169
WP_030127450.1|583855_584035_+	hypothetical protein	NA	A3F673	Streptococcus_phage	77.6	3.4e-18
WP_168389163.1|584868_585438_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_002994058.1|585438_587391_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.3	8.9e-144
WP_002990455.1|587747_589472_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_002990451.1|589603_590062_-	YueI family protein	NA	W6LLD2	Streptococcus_phage	39.1	1.8e-18
WP_002985288.1|590294_591602_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	96.6	1.2e-240
601644:601661	attR	TAAAATGCCTATTTTAAA	NA	NA	NA	NA
>prophage 4
NZ_LS483382	Streptococcus pyogenes strain NCTC13738 chromosome 1	1847336	666542	677145	1847336		Streptococcus_phage(57.14%)	9	NA	NA
WP_011054348.1|666542_668753_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	69.1	2.9e-268
WP_002985142.1|668860_670024_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	3.4e-143
WP_023610850.1|670020_670707_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	5.4e-88
WP_002990262.1|670800_671967_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	4.5e-34
WP_011054350.1|672027_672369_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	39.3	1.3e-18
WP_023610863.1|672589_673942_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.2	1.6e-30
WP_023610854.1|674029_675298_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_012560601.1|675327_675768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011184383.1|676002_677145_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.3	1.4e-24
>prophage 5
NZ_LS483382	Streptococcus pyogenes strain NCTC13738 chromosome 1	1847336	777601	818480	1847336	integrase,terminase,capsid,tail,portal,tRNA	Streptococcus_phage(60.78%)	61	782994:783042	819577:819625
WP_023610980.1|777601_778288_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_023611011.1|778277_779066_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_023610975.1|779105_780212_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_014407521.1|780269_781139_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	64.2	5.4e-101
WP_002990099.1|781138_781732_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	H9NC63	Sphingomonas_phage	28.2	3.7e-08
WP_023610978.1|781975_783016_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.9	1.5e-68
782994:783042	attL	AAACTCAAGAAGTGATTAAATAAAACATTAAAGAACCTTGTCATATCAA	NA	NA	NA	NA
WP_002990094.1|783098_784238_-|integrase	site-specific integrase	integrase	A1EAB7	Streptococcus_phage	56.3	3.4e-119
WP_076634078.1|784365_784632_-	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_076634077.1|784643_785024_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1S5SFH2	Streptococcus_phage	60.3	2.0e-39
WP_002994741.1|785027_785375_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SEQ8	Streptococcus_phage	72.6	1.2e-40
WP_020837683.1|785797_785893_-	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_002993390.1|786528_786720_+	hypothetical protein	NA	A7J270	Streptococcus_phage	92.1	4.0e-25
WP_111721359.1|786731_787448_+	phage antirepressor KilAC domain-containing protein	NA	C9WB91	Streptococcus_virus	76.3	1.1e-102
WP_011889039.1|787588_787771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111721361.1|787877_788189_+	excisionase	NA	A1EAC3	Streptococcus_phage	85.4	2.5e-48
WP_032461153.1|788190_788376_+	hypothetical protein	NA	Q938N3	Temperate_phage	90.2	1.8e-22
WP_076634492.1|788475_788745_+	transcriptional regulator	NA	A0A060QMU7	Streptococcus_phage	46.3	2.5e-12
WP_172451688.1|788845_789259_+	DnaD domain protein	NA	Q938N2	Temperate_phage	84.7	5.4e-59
WP_002985387.1|789239_789473_+	hypothetical protein	NA	Q938N1	Temperate_phage	94.8	6.1e-36
WP_111721363.1|789469_789610_+	hypothetical protein	NA	A0A1X9I6Y1	Streptococcus_phage	56.8	1.5e-05
WP_076634490.1|789618_789825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076634469.1|789880_790210_+	hypothetical protein	NA	J7KGX3	Streptococcus_phage	86.2	9.3e-46
WP_053308489.1|790212_791142_+	recombinase RecT	NA	M1NRN6	Streptococcus_phage	71.8	1.2e-90
WP_111721364.1|791138_791936_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	J7KGZ1	Streptococcus_phage	83.8	6.6e-130
WP_011285624.1|791945_792113_+	hypothetical protein	NA	A0A1S5SEF3	Streptococcus_phage	51.9	3.3e-07
WP_076634192.1|792289_792631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076634193.1|792627_793140_+	hypothetical protein	NA	Q708P9	Streptococcus_phage	73.2	1.1e-61
WP_076634194.1|793126_793321_+	hypothetical protein	NA	A3F626	Streptococcus_phage	89.2	9.7e-11
WP_076634195.1|793317_793587_+	hypothetical protein	NA	A7J287	Streptococcus_phage	80.9	2.9e-29
WP_033888177.1|793589_794075_+	class I SAM-dependent methyltransferase	NA	A0A097PAU8	Streptococcus_pyogenes_phage	83.8	3.5e-81
WP_076634196.1|794076_794709_+	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	65.7	5.9e-81
WP_002994112.1|795109_795550_+	DUF1492 domain-containing protein	NA	A0A0B5A564	Streptococcus_phage	50.4	3.5e-24
WP_002994108.1|795631_795976_+	HNH endonuclease	NA	M1Q0W7	Streptococcus_phage	69.4	6.5e-42
WP_002994106.1|796125_796482_+	hypothetical protein	NA	M1PRL3	Streptococcus_phage	57.8	2.4e-07
WP_076634197.1|796478_797747_+|portal	phage portal protein	portal	A0A1X9I693	Streptococcus_phage	75.8	5.9e-189
WP_002994100.1|799237_799462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032461150.1|799511_799691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986828.1|799683_799950_+	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	6.4e-37
WP_011888764.1|799951_800188_+	hypothetical protein	NA	M1IRA5	Streptococcus_phage	80.3	1.2e-31
WP_011285619.1|800269_801685_+|terminase	terminase	terminase	A0A0B5A091	Streptococcus_phage	74.2	2.9e-213
WP_053308482.1|801765_802230_+	DUF4355 domain-containing protein	NA	A0A141E167	Streptococcus_phage	57.8	6.3e-40
WP_053308481.1|802233_803127_+|capsid	phage major capsid protein	capsid	A0A126GGI3	Streptococcus_phage	77.4	6.3e-129
WP_053308480.1|803277_803700_+	hypothetical protein	NA	A0A0B5A2F6	Streptococcus_phage	68.6	1.3e-47
WP_011054681.1|803659_803998_+	hypothetical protein	NA	A0A0B5A086	Streptococcus_phage	75.0	8.1e-45
WP_053308479.1|803990_804227_+	hypothetical protein	NA	A0A0B5A7G2	Streptococcus_phage	71.4	1.9e-21
WP_000573598.1|804227_804563_+	hypothetical protein	NA	A0A1P8BMR5	Lactococcus_phage	64.9	9.8e-35
WP_076634199.1|804578_805169_+|tail	phage tail protein	tail	M1PKG8	Streptococcus_phage	63.0	2.4e-60
WP_002991567.1|805179_805443_+	hypothetical protein	NA	A0A0B5A2F3	Streptococcus_phage	54.7	2.9e-18
WP_002991564.1|805457_805829_+	DUF5361 domain-containing protein	NA	M1PL84	Streptococcus_phage	59.2	9.2e-34
WP_002991560.1|805828_806428_+	hypothetical protein	NA	Q38126	Lactococcus_phage	64.3	3.6e-56
WP_011017973.1|806528_807089_+	HNH endonuclease	NA	A0A1B1IM39	Lactococcus_phage	84.4	1.0e-84
WP_076634200.1|809101_809797_+	hypothetical protein	NA	A0A1B1P761	Bacillus_phage	29.6	7.6e-05
WP_053308476.1|809793_811752_+|tail	phage tail protein	tail	M1PKG3	Streptococcus_phage	49.2	5.3e-96
WP_053308475.1|811751_812861_+	hyaluronoglucosaminidase	NA	A7J2A8	Streptococcus_phage	66.1	3.5e-113
WP_076634201.1|812875_814657_+	hypothetical protein	NA	Q938J9	Temperate_phage	40.5	6.1e-67
WP_076634202.1|814665_815094_+	DUF1617 family protein	NA	Q938J8	Temperate_phage	81.4	1.1e-54
WP_076634203.1|815096_815729_+	hypothetical protein	NA	Q938J7	Temperate_phage	52.9	1.5e-47
WP_002990012.1|815739_816036_+	hypothetical protein	NA	Q938J6	Temperate_phage	98.0	3.7e-46
WP_002990010.1|816032_816218_+	hypothetical protein	NA	Q938J5	Temperate_phage	95.1	1.9e-24
WP_076634204.1|816328_817534_+	glucosaminidase domain-containing protein	NA	Q938J4	Temperate_phage	85.5	3.7e-209
WP_047373492.1|817802_818480_+	streptococcal pyrogenic exotoxin SpeI	NA	A0A075M4C7	Staphylococcus_phage	32.4	2.4e-27
819577:819625	attR	AAACTCAAGAAGTGATTAAATAAAACATTAAAGAACCTTGTCATATCAA	NA	NA	NA	NA
>prophage 6
NZ_LS483382	Streptococcus pyogenes strain NCTC13738 chromosome 1	1847336	1350067	1423253	1847336	integrase,terminase,capsid,tail,portal,tRNA,head	Streptococcus_phage(73.21%)	86	1379048:1379064	1419849:1419865
WP_076634148.1|1350067_1352107_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_111721397.1|1352485_1353403_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_002983542.1|1353774_1354308_-	isoprenylcysteine carboxyl methyltransferase family protein	NA	NA	NA	NA	NA
WP_002994275.1|1354439_1355279_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	4.9e-51
WP_076634147.1|1355400_1356549_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_002988856.1|1356666_1358298_-	Na/Pi cotransporter family protein	NA	A0A1B1ITU5	uncultured_Mediterranean_phage	38.8	2.7e-05
WP_076634146.1|1358499_1359222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002988852.1|1359350_1360193_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	61.9	1.3e-91
WP_010922569.1|1360485_1361043_+	TetR/AcrR family transcriptional regulator	NA	A0A1X9I6A2	Streptococcus_phage	60.3	3.2e-14
WP_076634145.1|1361078_1361903_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002994286.1|1361904_1362522_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_011106626.1|1362707_1363685_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_012560884.1|1363766_1364030_-	tagatose-6-phosphate kinase	NA	NA	NA	NA	NA
WP_023609931.1|1364183_1364699_-	galactose-6-phosphate isomerase subunit LacB	NA	NA	NA	NA	NA
WP_010922573.1|1364713_1365139_-	galactose-6-phosphate isomerase subunit LacA	NA	A0A222YX14	Synechococcus_phage	28.6	2.2e-07
WP_002994298.1|1365395_1366847_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002988834.1|1366872_1367178_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_010922576.1|1367170_1367644_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002983505.1|1367880_1368651_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.8	6.4e-21
WP_023078711.1|1368854_1369058_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_023078661.1|1369071_1371303_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.6	7.6e-115
WP_023078699.1|1371302_1371737_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_023078696.1|1371908_1372898_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023611916.1|1373028_1373379_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_076634143.1|1373584_1376446_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.4	1.2e-19
WP_002983488.1|1376465_1376768_-	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_002983486.1|1376760_1377057_-	YlxR family protein	NA	NA	NA	NA	NA
WP_002988817.1|1377072_1378230_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_002988815.1|1378404_1378941_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
1379048:1379064	attL	AAGGAGAGGAGGGGATT	NA	NA	NA	NA
WP_002988813.1|1379185_1379365_-	hypothetical protein	NA	A3F673	Streptococcus_phage	83.1	5.6e-21
WP_002988811.1|1379603_1380776_+	streptodornase Sda1	NA	A7J2B8	Streptococcus_phage	49.8	4.7e-76
WP_002988807.1|1380891_1382088_-	streptodornase Sda1	NA	Q938J4	Temperate_phage	82.2	6.1e-196
WP_021341107.1|1382198_1382384_-	hypothetical protein	NA	Q938J5	Temperate_phage	91.8	6.2e-23
WP_002988799.1|1382380_1382680_-	hypothetical protein	NA	Q938J6	Temperate_phage	82.3	3.5e-36
WP_002988797.1|1382690_1383311_-	hypothetical protein	NA	A3F662	Streptococcus_phage	88.8	8.3e-80
WP_002988795.1|1383313_1383475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021341125.1|1383483_1385391_-	gp58-like family protein	NA	Q938J9	Temperate_phage	61.7	3.8e-139
WP_021341117.1|1385401_1386037_-	hypothetical protein	NA	A0A097PBF7	Streptococcus_pyogenes_phage	67.6	2.2e-75
WP_002988439.1|1386036_1387092_-	hypothetical protein	NA	A3F657	Streptococcus_phage	73.2	1.2e-126
WP_002988790.1|1387088_1389071_-|tail	phage tail protein	tail	A7J2A7	Streptococcus_phage	92.5	0.0e+00
WP_002988788.1|1389080_1389923_-	hypothetical protein	NA	A7J2A6	Streptococcus_phage	99.6	8.5e-160
WP_002988786.1|1389934_1394317_-	tape measure protein	NA	A7J2A5	Streptococcus_phage	76.4	3.2e-226
WP_002983445.1|1394331_1394565_-	hypothetical protein	NA	A7J2A4	Streptococcus_phage	100.0	4.4e-34
WP_002983443.1|1394639_1395095_-	hypothetical protein	NA	A7J2A3	Streptococcus_phage	100.0	8.3e-77
WP_002988784.1|1395148_1395748_-|tail	phage major tail protein, TP901-1 family	tail	A7J2A2	Streptococcus_phage	98.9	4.1e-92
WP_002988782.1|1395759_1396119_-	hypothetical protein	NA	A7J2A1	Streptococcus_phage	97.5	6.8e-58
WP_002988781.1|1396122_1396467_-	HK97 gp10 family phage protein	NA	A7J2A0	Streptococcus_phage	99.1	6.1e-56
WP_000639437.1|1396463_1396742_-	hypothetical protein	NA	A7J299	Streptococcus_phage	98.9	4.2e-47
WP_002988776.1|1396752_1397109_-|head,tail	phage head-tail connector protein	head,tail	A7J298	Streptococcus_phage	97.5	2.8e-56
WP_002988771.1|1397120_1398008_-	hypothetical protein	NA	A7J297	Streptococcus_phage	99.7	3.6e-161
WP_002988768.1|1398020_1398590_-	DUF4355 domain-containing protein	NA	A7J296	Streptococcus_phage	97.9	2.6e-80
WP_002988765.1|1398745_1399012_-	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	88.6	1.7e-34
WP_002983423.1|1399014_1399203_-	hypothetical protein	NA	A7J294	Streptococcus_phage	98.4	1.4e-22
WP_015446273.1|1399233_1400679_-|capsid	minor capsid protein	capsid	A7J293	Streptococcus_phage	92.9	3.4e-257
WP_002988758.1|1400638_1402171_-|portal	phage portal protein	portal	A7J292	Streptococcus_phage	98.2	1.3e-286
WP_002988754.1|1402186_1403464_-|terminase	PBSX family phage terminase large subunit	terminase	A7J291	Streptococcus_phage	97.6	1.3e-241
WP_011106637.1|1403453_1403906_-|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	100.0	6.9e-76
WP_002988747.1|1403995_1404412_-	DUF722 domain-containing protein	NA	A7J289	Streptococcus_phage	100.0	6.6e-73
WP_002988743.1|1404408_1404600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002988740.1|1404589_1405441_-	site-specific DNA-methyltransferase	NA	A0A1W6JMZ7	Lactococcus_phage	71.9	1.5e-100
WP_002988738.1|1405449_1405716_-	hypothetical protein	NA	A7J287	Streptococcus_phage	65.2	5.4e-20
WP_002988735.1|1405712_1405880_-	hypothetical protein	NA	A7J285	Streptococcus_phage	94.5	1.9e-23
WP_002988733.1|1405880_1407203_-	DEAD/DEAH box helicase family protein	NA	A7J284	Streptococcus_phage	98.4	1.9e-254
WP_002988730.1|1407199_1407475_-	VRR-NUC domain-containing protein	NA	A7J283	Streptococcus_phage	100.0	9.1e-47
WP_011285674.1|1407861_1410246_-	DNA primase	NA	A7J282	Streptococcus_phage	94.4	4.1e-276
WP_002988723.1|1410250_1412173_-	DNA polymerase	NA	A7J280	Streptococcus_phage	96.7	0.0e+00
WP_002988718.1|1412215_1412773_-	DUF2815 family protein	NA	D2J040	Enterococcus_phage	57.9	2.5e-51
WP_002988715.1|1412783_1413182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002988711.1|1413185_1414340_-	DUF2800 domain-containing protein	NA	A7J278	Streptococcus_phage	91.9	4.5e-204
WP_002988708.1|1414339_1414639_-	hypothetical protein	NA	A7J277	Streptococcus_phage	100.0	1.8e-43
WP_002988705.1|1414726_1414930_-	hypothetical protein	NA	A7J276	Streptococcus_phage	95.5	2.3e-31
WP_002988700.1|1415076_1415463_-	hypothetical protein	NA	A7J274	Streptococcus_phage	88.2	3.1e-56
WP_002988697.1|1415459_1415663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002988693.1|1415655_1415826_-	hypothetical protein	NA	A7J273	Streptococcus_phage	89.3	6.9e-21
WP_002988687.1|1415822_1416098_-	hypothetical protein	NA	A7J272	Streptococcus_phage	95.6	5.9e-46
WP_002988684.1|1416159_1416375_-	hypothetical protein	NA	M1Q1B4	Streptococcus_phage	76.8	4.2e-23
WP_002988681.1|1416422_1416836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002988678.1|1416816_1416972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011285676.1|1417246_1417648_+	helix-turn-helix transcriptional regulator	NA	A7J269	Streptococcus_phage	72.9	1.1e-40
WP_002988673.1|1417661_1418045_+	hypothetical protein	NA	A7J268	Streptococcus_phage	99.2	5.3e-69
WP_002988670.1|1418055_1418607_+	hypothetical protein	NA	A7J267	Streptococcus_phage	92.3	3.4e-85
WP_002988667.1|1418723_1419803_+|integrase	site-specific integrase	integrase	A7J266	Streptococcus_phage	86.9	1.3e-176
WP_002983387.1|1420000_1420636_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
1419849:1419865	attR	AAGGAGAGGAGGGGATT	NA	NA	NA	NA
WP_002983385.1|1420635_1421427_-	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_076634067.1|1421490_1422525_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002983379.1|1422527_1423253_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.0	3.9e-20
>prophage 7
NZ_LS483382	Streptococcus pyogenes strain NCTC13738 chromosome 1	1847336	1766813	1788356	1847336	tRNA,integrase,holin	Streptococcus_phage(62.5%)	26	1770012:1770032	1782902:1782922
WP_076634444.1|1766813_1768034_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	23.6	4.6e-05
WP_023610727.1|1768044_1770027_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.1	2.3e-62
1770012:1770032	attL	CAATAATGTTTGTCATAATTT	NA	NA	NA	NA
WP_021299091.1|1770121_1771267_-|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	44.9	2.7e-84
WP_110410861.1|1771594_1771738_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_003049853.1|1773261_1773450_+	helix-turn-helix domain-containing protein	NA	A0A1X9I5U7	Streptococcus_phage	45.2	4.8e-07
WP_076634445.1|1773465_1774074_+	phage repressor protein	NA	A0A1W6JPC3	Staphylococcus_phage	48.0	2.7e-43
WP_021733977.1|1774094_1774502_+	hypothetical protein	NA	A0A1X9I5V7	Streptococcus_phage	68.7	3.8e-49
WP_076634446.1|1774514_1774847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037588219.1|1775102_1775444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003058793.1|1775430_1775652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003058790.1|1775654_1775846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003058810.1|1775857_1776187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100459.1|1776189_1776462_+	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	60.0	6.1e-19
WP_003058743.1|1776462_1777320_+	primase C-terminal domain-containing protein	NA	A0A1X9I6L2	Streptococcus_phage	74.8	3.4e-124
WP_076634447.1|1777288_1778977_+	DNA primase	NA	A0A1X9I717	Streptococcus_phage	82.1	5.5e-259
WP_003045773.1|1779263_1779437_+	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	59.6	6.6e-11
WP_003058787.1|1779442_1779616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003058776.1|1779617_1780127_+	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	60.4	3.0e-27
WP_003058746.1|1780201_1780690_+	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	54.9	3.1e-45
WP_003058730.1|1781092_1781455_+	DUF1492 domain-containing protein	NA	A0A2H4JFS1	uncultured_Caudovirales_phage	29.9	8.7e-05
WP_003058801.1|1781429_1781813_+	ArpU family transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	41.7	1.7e-14
WP_076634449.1|1782017_1782650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076634450.1|1783045_1785601_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	23.7	2.6e-42
1782902:1782922	attR	CAATAATGTTTGTCATAATTT	NA	NA	NA	NA
WP_011889237.1|1785587_1785794_-	YlbF family regulator	NA	NA	NA	NA	NA
WP_023610766.1|1785936_1786374_-	arginine repressor	NA	NA	NA	NA	NA
WP_023610730.1|1786664_1788356_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.4	6.4e-74
