The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483386	Streptococcus pyogenes strain NCTC13742 chromosome 1	1934623	36638	48950	1934623		Synechococcus_phage(28.57%)	8	NA	NA
WP_023612102.1|36638_40364_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	26.8	2.1e-40
WP_023612105.1|40524_41979_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.3	6.3e-54
WP_023612098.1|42006_43029_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	41.5	4.0e-63
WP_002986700.1|43196_43751_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	2.4e-25
WP_023612109.1|43934_45482_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.4	4.4e-45
WP_010921776.1|45538_46663_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
WP_023612108.1|46915_48181_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_023612097.1|48458_48950_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.1	3.8e-19
>prophage 2
NZ_LS483386	Streptococcus pyogenes strain NCTC13742 chromosome 1	1934623	346398	352433	1934623		Streptococcus_phage(100.0%)	8	NA	NA
WP_002990917.1|346398_347034_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.4	2.7e-65
WP_002985844.1|347051_347927_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	46.6	2.1e-68
WP_002985838.1|348589_348913_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_021733048.1|348917_349781_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	74.7	3.8e-115
WP_002985833.1|349807_350200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009880724.1|350246_350876_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_011284536.1|351175_351532_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.8	6.3e-40
WP_023078944.1|351605_352433_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.5	3.8e-128
>prophage 3
NZ_LS483386	Streptococcus pyogenes strain NCTC13742 chromosome 1	1934623	537419	602083	1934623	holin,tail,capsid,integrase,portal,tRNA,terminase	Temperate_phage(49.09%)	76	534102:534119	616378:616395
534102:534119	attL	ATATCAAAAAGCTTCCCT	NA	NA	NA	NA
WP_002985437.1|537419_538766_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.8	1.1e-55
WP_023612366.1|539180_540071_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.8	8.8e-06
WP_023612323.1|540067_541045_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	74.8	6.6e-140
WP_023612370.1|541041_541953_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	64.6	3.8e-105
WP_023612367.1|542084_543482_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_023612329.1|543633_545181_+	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_023612369.1|545327_546050_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023612346.1|546068_547268_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002985307.1|547364_547625_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002985305.1|547739_548681_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_002985303.1|549074_549524_+	flavodoxin	NA	NA	NA	NA	NA
WP_002994052.1|549698_549983_+	chorismate mutase	NA	NA	NA	NA	NA
WP_050336105.1|549975_551238_+	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	51.3	6.4e-95
WP_002985298.1|551352_551700_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_023612372.1|552062_553139_-|integrase	site-specific integrase	integrase	Q0R5B4	Streptococcus_phage	41.2	7.5e-68
WP_023612337.1|553257_553779_-	hypothetical protein	NA	Q938N8	Temperate_phage	97.7	7.5e-66
WP_023612306.1|553789_554167_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1P8VVK5	Streptococcus_phage	76.8	8.1e-54
WP_023611288.1|554150_554510_-	helix-turn-helix transcriptional regulator	NA	A0A1P8VVN3	Streptococcus_phage	95.0	1.7e-56
WP_023612341.1|554697_554916_+	helix-turn-helix transcriptional regulator	NA	A0A1P8VVR5	Streptococcus_phage	97.2	5.9e-33
WP_023612302.1|555015_555246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023612348.1|555382_555601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003056170.1|555602_555845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023612340.1|555831_557148_+	AAA family ATPase	NA	A0A097BY67	Enterococcus_phage	63.8	7.8e-152
WP_003056188.1|557162_558245_+	AAA family ATPase	NA	A0A0K2CZH1	Paenibacillus_phage	53.3	2.5e-103
WP_003056185.1|558439_559033_+	hypothetical protein	NA	A0A097BY29	Enterococcus_phage	43.5	1.7e-29
WP_080262841.1|559032_560616_+	DEAD/DEAH box helicase	NA	A0A097BY72	Enterococcus_phage	77.8	2.0e-234
WP_023612331.1|560628_560823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003059078.1|563379_563562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023612320.1|563554_563950_+	RusA family crossover junction endodeoxyribonuclease	NA	Q5YA86	Bacillus_phage	58.8	1.8e-40
WP_023612313.1|563946_564171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023612326.1|564173_564359_+	hypothetical protein	NA	A3F626	Streptococcus_phage	82.9	6.6e-09
WP_023612315.1|564355_564607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023612304.1|564590_564995_+	hypothetical protein	NA	A3F627	Streptococcus_phage	65.2	1.6e-39
WP_014411870.1|564991_565276_+	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	89.4	1.4e-37
WP_011018133.1|565277_565910_+	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	68.6	2.3e-85
WP_014411869.1|565912_566623_+	DUF1642 domain-containing protein	NA	Q938L9	Temperate_phage	46.2	3.0e-25
WP_014411868.1|566619_566991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021340586.1|567258_567696_+	DUF1492 domain-containing protein	NA	A0A097PBF1	Streptococcus_pyogenes_phage	99.3	1.4e-76
WP_011054748.1|568214_568472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002986854.1|568552_569071_+	ParB N-terminal domain-containing protein	NA	Q938L7	Temperate_phage	100.0	1.5e-90
WP_111711133.1|569049_569727_+	hypothetical protein	NA	Q938L6	Temperate_phage	99.6	4.3e-130
WP_002986845.1|569849_570119_+	hypothetical protein	NA	B5SP24	Lactococcus_phage	51.1	2.8e-16
WP_002986841.1|570179_570557_+	ASCH domain-containing protein	NA	Q938L5	Temperate_phage	100.0	1.7e-67
WP_023612332.1|570607_571081_+	hypothetical protein	NA	Q938L4	Temperate_phage	98.7	7.3e-76
WP_010922074.1|571163_572375_+|terminase	PBSX family phage terminase large subunit	terminase	Q938L3	Temperate_phage	99.7	3.7e-225
WP_002986832.1|572388_573891_+|portal	phage portal protein	portal	Q938L2	Temperate_phage	100.0	5.4e-282
WP_011054746.1|573895_575374_+|capsid	phage minor capsid protein	capsid	Q938L1	Temperate_phage	100.0	8.2e-275
WP_002986829.1|575345_575585_+	hypothetical protein	NA	Q938L0	Temperate_phage	100.0	2.8e-36
WP_011054745.1|575646_575913_+	hypothetical protein	NA	Q938K9	Temperate_phage	100.0	1.5e-38
WP_011106689.1|576038_576653_+	hypothetical protein	NA	Q938K8	Temperate_phage	100.0	1.3e-96
WP_010922080.1|576656_577475_+|capsid	N4-gp56 family major capsid protein	capsid	Q79S85	Temperate_phage	100.0	4.0e-146
WP_011054743.1|577528_577945_+	hypothetical protein	NA	Q938K7	Temperate_phage	100.0	1.1e-56
WP_010922082.1|577934_578267_+	hypothetical protein	NA	Q79S86	Temperate_phage	100.0	9.6e-59
WP_010922083.1|578266_578623_+	hypothetical protein	NA	Q79S88	Temperate_phage	100.0	4.5e-62
WP_010922084.1|578619_579018_+|capsid	phage capsid protein	capsid	Q79S87	Temperate_phage	100.0	3.5e-71
WP_011054741.1|579017_579503_+	hypothetical protein	NA	Q938K6	Temperate_phage	100.0	1.6e-86
WP_011054740.1|579541_579976_+	hypothetical protein	NA	Q938K5	Temperate_phage	100.0	2.6e-72
WP_011284973.1|579979_580561_+	hypothetical protein	NA	Q938K4	Temperate_phage	99.5	4.9e-106
WP_023612368.1|580550_583811_+	tape measure protein	NA	Q938K3	Temperate_phage	99.5	0.0e+00
WP_011054737.1|583807_584524_+|tail	phage tail family protein	tail	Q938K2	Temperate_phage	100.0	2.9e-137
WP_111706021.1|584520_586668_+|tail	phage tail protein	tail	Q938K1	Temperate_phage	95.4	0.0e+00
WP_011284843.1|586664_587879_+	hypothetical protein	NA	A3F657	Streptococcus_phage	49.5	5.0e-44
WP_011284842.1|587865_588195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023612347.1|588205_590095_+	gp58-like family protein	NA	Q938J9	Temperate_phage	74.3	1.8e-189
WP_002988448.1|590106_590535_+	DUF1617 family protein	NA	Q938J8	Temperate_phage	84.3	8.1e-58
WP_011054443.1|590537_591170_+	hypothetical protein	NA	Q938J7	Temperate_phage	49.5	2.0e-44
WP_011017397.1|591181_591454_+	hypothetical protein	NA	A7J2B2	Streptococcus_phage	91.0	5.5e-36
WP_011054444.1|591450_591678_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	98.7	7.6e-31
WP_011054445.1|591793_593002_+	glucosaminidase domain-containing protein	NA	Q938J4	Temperate_phage	87.5	2.9e-214
WP_050440680.1|593111_594098_-	DNA/RNA non-specific endonuclease	NA	A7J2B8	Streptococcus_phage	99.7	5.2e-169
WP_030127450.1|594330_594510_+	hypothetical protein	NA	A3F673	Streptococcus_phage	77.6	3.4e-18
WP_002985295.1|595355_595925_+	hydrolase	NA	NA	NA	NA	NA
WP_038431254.1|595925_597878_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.3	1.2e-143
WP_023612353.1|598234_599959_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_020905037.1|600090_600549_-	YueI family protein	NA	W6LLD2	Streptococcus_phage	39.1	3.9e-18
WP_002985288.1|600775_602083_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	96.6	1.2e-240
616378:616395	attR	ATATCAAAAAGCTTCCCT	NA	NA	NA	NA
>prophage 4
NZ_LS483386	Streptococcus pyogenes strain NCTC13742 chromosome 1	1934623	677679	688283	1934623		Streptococcus_phage(57.14%)	9	NA	NA
WP_044559748.1|677679_679890_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	68.9	6.5e-268
WP_023612435.1|679997_681161_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	3.4e-143
WP_002985140.1|681157_681844_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_002990262.1|681937_683104_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	4.5e-34
WP_002990260.1|683164_683506_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	41.1	2.6e-19
WP_023612440.1|683727_685080_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.7	5.9e-30
WP_002990257.1|685167_686436_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_012560601.1|686465_686906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011184383.1|687140_688283_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.3	1.4e-24
>prophage 5
NZ_LS483386	Streptococcus pyogenes strain NCTC13742 chromosome 1	1934623	987986	1066953	1934623	terminase,tail,capsid,head,integrase,portal,tRNA,protease	Streptococcus_phage(58.73%)	94	1021338:1021397	1063492:1063587
WP_023612481.1|987986_988871_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_023612473.1|988986_990327_-	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
WP_023612470.1|990423_991380_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_002993908.1|991390_991987_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_023612475.1|992078_994715_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_023612464.1|994729_995431_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	1.3e-36
WP_023612443.1|995548_996091_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002984480.1|996233_996875_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023612454.1|997037_997526_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_023612456.1|997536_997737_-	CsbD family protein	NA	J7KJ36	Streptococcus_phage	51.5	1.8e-07
WP_002984475.1|997777_998317_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002984473.1|998329_998518_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002984470.1|998528_999140_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002984469.1|999176_999425_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_023612212.1|999787_1002106_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	40.9	2.3e-130
WP_023612223.1|1002634_1003957_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_023612209.1|1004076_1005312_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_023612220.1|1005681_1006455_-	CAMP factor pore-forming toxin Cfa	NA	NA	NA	NA	NA
WP_002989634.1|1006823_1007660_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023612213.1|1007675_1008305_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	1.7e-27
WP_002992417.1|1008314_1008956_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002989626.1|1009062_1009398_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_023612218.1|1009593_1011408_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	38.6	6.8e-98
WP_023612216.1|1011583_1012141_-	signal peptidase I	NA	NA	NA	NA	NA
WP_111711138.1|1012358_1013861_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_002984444.1|1013923_1014937_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_023612222.1|1015016_1018127_-	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	29.9	8.3e-120
WP_002989617.1|1018311_1018683_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002984437.1|1018682_1019381_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.3	6.6e-09
WP_002984433.1|1019390_1020176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023612208.1|1020302_1020917_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	51.8	4.0e-50
1021338:1021397	attL	ACTCCCACCAGCTCCATCAATGCTTACCGTAAGTAATCATAACTTACTAAAACCTTGTTA	NA	NA	NA	NA
WP_002993136.1|1021507_1021696_-	hypothetical protein	NA	A3F673	Streptococcus_phage	76.3	2.1e-18
WP_011184727.1|1021935_1022694_+	DNase Mf2	NA	NA	NA	NA	NA
WP_002985327.1|1022804_1023512_+	streptococcal pyrogenic exotoxin SpeC	NA	A0A097PAT7	Streptococcus_pyogenes_phage	27.1	3.9e-09
WP_011284838.1|1023587_1024922_-	lysin	NA	Q5MY96	Streptococcus_phage	93.0	1.3e-247
WP_011284839.1|1025033_1025219_-	hypothetical protein	NA	Q938J5	Temperate_phage	96.7	6.6e-25
WP_002990012.1|1025215_1025512_-	hypothetical protein	NA	Q938J6	Temperate_phage	98.0	3.7e-46
WP_011284840.1|1025522_1026140_-	hypothetical protein	NA	A3F662	Streptococcus_phage	94.6	9.8e-89
WP_002988795.1|1026142_1026304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111711139.1|1026317_1028213_-	gp58-like family protein	NA	Q938J9	Temperate_phage	52.5	5.9e-76
WP_011284842.1|1028223_1028553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011284843.1|1028539_1029754_-	hypothetical protein	NA	A3F657	Streptococcus_phage	49.5	5.0e-44
WP_111711140.1|1029750_1031898_-|tail	phage tail protein	tail	Q938K1	Temperate_phage	94.7	0.0e+00
WP_024623478.1|1031894_1032602_-	hypothetical protein	NA	Q938K2	Temperate_phage	70.6	1.7e-92
WP_032461633.1|1032601_1036525_-|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	49.1	2.6e-243
WP_021299462.1|1036537_1036687_-	hypothetical protein	NA	J7KBS0	Streptococcus_phage	85.7	1.7e-15
WP_021733367.1|1036734_1037061_-	hypothetical protein	NA	J7KK85	Streptococcus_phage	75.0	6.4e-39
WP_021341058.1|1037113_1037725_-|tail	phage major tail protein	tail	J7KKC8	Streptococcus_phage	73.0	1.8e-74
WP_021341057.1|1037741_1038167_-	hypothetical protein	NA	J7KBZ9	Streptococcus_phage	85.8	2.9e-68
WP_021340627.1|1038163_1038541_-	HK97 gp10 family phage protein	NA	J7KDM3	Streptococcus_phage	73.6	1.8e-45
WP_029714354.1|1038537_1038885_-|head	phage head closure protein	head	J7KJ42	Streptococcus_phage	84.5	2.1e-48
WP_021341088.1|1038881_1039184_-|head,tail	phage head-tail connector protein	head,tail	J7KC36	Streptococcus_phage	87.8	2.6e-42
WP_021341090.1|1039328_1040513_-|capsid	phage major capsid protein	capsid	J7KJ82	Streptococcus_phage	76.1	1.2e-162
WP_021341143.1|1040536_1041202_-|protease	Clp protease ClpP	protease	M1Q115	Streptococcus_phage	78.6	5.4e-93
WP_032461634.1|1041179_1042400_-|portal	phage portal protein	portal	J7KDU3	Streptococcus_phage	81.7	3.4e-186
WP_002985363.1|1042433_1042658_-	hypothetical protein	NA	Q938K9	Temperate_phage	61.4	3.6e-17
WP_002985365.1|1042650_1042821_-	hypothetical protein	NA	J7KK43	Streptococcus_phage	62.5	2.3e-08
WP_032461635.1|1042817_1044572_-|terminase	terminase large subunit	terminase	J7KKD1	Streptococcus_phage	96.2	0.0e+00
WP_002985371.1|1044586_1045054_-|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	98.7	3.9e-82
WP_021340284.1|1045221_1045563_-	HNH endonuclease	NA	J7KH36	Streptococcus_phage	90.7	2.5e-54
WP_011284866.1|1046025_1046460_-	ArpU family transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	97.9	6.2e-74
WP_010922070.1|1046740_1047376_-	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	69.4	2.0e-89
WP_032460570.1|1047377_1047662_-	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	88.3	2.8e-38
WP_032460569.1|1047658_1048072_-	hypothetical protein	NA	Q938M1	Temperate_phage	65.2	6.4e-36
WP_002987593.1|1048081_1048351_-	hypothetical protein	NA	A0A1P8VVR6	Streptococcus_phage	100.0	3.1e-47
WP_011017568.1|1048347_1048632_-	DUF3310 domain-containing protein	NA	A0A1P8VVP5	Streptococcus_phage	100.0	7.0e-50
WP_011284873.1|1048873_1049230_-	hypothetical protein	NA	A0A097PAU4	Streptococcus_pyogenes_phage	100.0	2.9e-61
WP_023079767.1|1049213_1049564_-	VRR-NUC domain-containing protein	NA	A0A1P8VVL5	Streptococcus_phage	88.5	9.9e-46
WP_014635521.1|1049517_1050387_-	bifunctional DNA primase/polymerase	NA	A0A1P8BME8	Lactococcus_phage	65.6	5.8e-103
WP_011284875.1|1050655_1052209_-	hypothetical protein	NA	A0A1P8BM51	Lactococcus_phage	70.6	5.7e-210
WP_002984328.1|1052226_1052709_-	DUF669 domain-containing protein	NA	A0A1P8BM40	Lactococcus_phage	70.7	9.7e-60
WP_075340263.1|1052713_1054117_-	DEAD/DEAH box helicase	NA	A0A1P8BMH7	Lactococcus_phage	72.3	2.3e-194
WP_002984321.1|1054152_1054836_-	AAA family ATPase	NA	J7KC09	Streptococcus_phage	99.1	9.4e-125
WP_011284877.1|1054832_1055117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002984315.1|1055113_1055308_-	hypothetical protein	NA	J7KK69	Streptococcus_phage	54.2	3.9e-12
WP_011284878.1|1055307_1055637_-	hypothetical protein	NA	J7KBZ0	Streptococcus_phage	41.8	7.9e-13
WP_011017881.1|1055717_1055855_-	hypothetical protein	NA	A0A097PAR2	Streptococcus_pyogenes_phage	100.0	3.4e-18
WP_011017882.1|1055851_1056148_-	hypothetical protein	NA	A0A097PAT8	Streptococcus_pyogenes_phage	98.0	3.1e-48
WP_011054585.1|1056226_1056412_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	72.1	3.3e-16
WP_011284879.1|1056578_1056818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002984292.1|1056967_1057177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011017884.1|1057435_1057945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002984281.1|1058052_1058280_-	hypothetical protein	NA	A0A141E1R7	Streptococcus_phage	57.3	2.9e-14
WP_011054589.1|1058353_1058740_+	hypothetical protein	NA	A0A097PAT1	Streptococcus_pyogenes_phage	100.0	1.2e-65
WP_011284881.1|1058728_1058938_-	hypothetical protein	NA	A0A097PAQ9	Streptococcus_pyogenes_phage	100.0	1.7e-32
WP_011284882.1|1058991_1059591_+	hypothetical protein	NA	A0A097PAT4	Streptococcus_pyogenes_phage	100.0	3.1e-108
WP_011284883.1|1059620_1059779_-	hypothetical protein	NA	J7KH24	Streptococcus_phage	90.4	8.4e-21
WP_021341080.1|1059837_1060053_+	hypothetical protein	NA	J7KBX0	Streptococcus_phage	95.7	2.5e-28
WP_021340643.1|1060038_1060188_-	hypothetical protein	NA	J7KH12	Streptococcus_phage	91.8	4.3e-19
WP_111711142.1|1060545_1061289_+	helix-turn-helix domain-containing protein	NA	A0A1S5S8T5	Streptococcus_phage	62.5	7.4e-75
WP_023079768.1|1061301_1062111_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	J7KDP1	Streptococcus_phage	35.8	2.9e-24
WP_023079773.1|1062360_1063449_+|integrase	site-specific integrase	integrase	Q38159	Streptococcus_phage	98.6	3.0e-202
WP_002989605.1|1063811_1064432_+	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
1063492:1063587	attR	ACTCCCACCAGCTCCATCAATGCTTACCGTAAGTAATCATAACTTACTAAAACCTTGTTACATCAAGGTTTTTTCTTTTTGTCTTGTTCATGAGTT	NA	NA	NA	NA
WP_023612202.1|1064688_1066953_-	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	43.7	1.2e-11
>prophage 6
NZ_LS483386	Streptococcus pyogenes strain NCTC13742 chromosome 1	1934623	1845933	1866158	1934623	holin,integrase	Streptococcus_phage(56.25%)	27	1849132:1849152	1863459:1863479
WP_002992187.1|1845933_1847154_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	23.6	3.5e-05
WP_023612567.1|1847164_1849147_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.1	3.0e-62
1849132:1849152	attL	CAATAATGTTTGTCATAATTT	NA	NA	NA	NA
WP_003058754.1|1849241_1850393_-|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	44.9	3.6e-84
WP_011185066.1|1850641_1850785_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_003058809.1|1851646_1852414_-	helix-turn-helix domain-containing protein	NA	Q76TK4	Streptococcus_pyogenes_phage	83.1	3.6e-72
WP_002992503.1|1852567_1852774_+	helix-turn-helix transcriptional regulator	NA	X2KUC2	Streptococcus_phage	47.0	2.4e-07
WP_002992502.1|1852807_1853008_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SE31	Streptococcus_phage	56.7	3.4e-11
WP_002992501.1|1853028_1853436_+	hypothetical protein	NA	A0A1X9I5V7	Streptococcus_phage	69.4	1.3e-49
WP_011185071.1|1853847_1854375_+	Rha family transcriptional regulator	NA	R9QNB1	Lactococcus_phage	40.2	9.7e-21
WP_000132665.1|1854622_1854796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074663.1|1855013_1855187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000916926.1|1855327_1855780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011285276.1|1855881_1856214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021340709.1|1856213_1856405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003058810.1|1856416_1856746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010922766.1|1856748_1857021_+	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	60.0	3.6e-19
WP_011285278.1|1857021_1857888_+	primase C-terminal domain-containing protein	NA	A0A1X9I6L2	Streptococcus_phage	73.8	6.1e-121
WP_011285279.1|1857899_1859294_+	phage protein	NA	A0A1W6JQD6	Staphylococcus_phage	38.1	1.3e-48
WP_011285280.1|1859587_1859842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011285281.1|1859838_1860012_+	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	59.6	8.6e-11
WP_011285282.1|1860017_1860191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030126555.1|1860192_1860702_+	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	63.5	1.9e-29
WP_002992480.1|1860775_1861264_+	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	54.9	1.4e-45
WP_011285284.1|1861667_1862030_+	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_011285285.1|1862004_1862388_+	ArpU family transcriptional regulator	NA	Q938L8	Temperate_phage	41.7	3.7e-14
WP_011285286.1|1862552_1863206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023612569.1|1863602_1866158_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.7	1.2e-42
1863459:1863479	attR	CAATAATGTTTGTCATAATTT	NA	NA	NA	NA
