The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483396	Micrococcus luteus NCTC 2665 chromosome 1	2495693	770392	806507	2495693	transposase,integrase	Corynebacterium_phage(50.0%)	40	767231:767248	812333:812350
767231:767248	attL	GCCATGGCCTCCCCCTCC	NA	NA	NA	NA
WP_010079481.1|770392_771646_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.2	3.1e-81
WP_010080066.1|771985_772438_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_010080065.1|772581_773181_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010080064.1|773161_773554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010080063.1|773674_774310_-	cobalt transporter	NA	NA	NA	NA	NA
WP_010080062.1|774309_775071_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_010080061.1|775067_775733_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_010079590.1|777058_778312_+|transposase	IS256-like element ISMlu1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.2	6.8e-81
WP_010080056.1|779098_779464_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_029248292.1|779546_780638_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_002855764.1|780661_781090_+	low molecular weight phosphatase family protein	NA	NA	NA	NA	NA
WP_010080054.1|781118_782456_+	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_010080053.1|782554_782914_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010080052.1|782910_783513_+	cadmium resistance transporter	NA	NA	NA	NA	NA
WP_010080051.1|783884_784754_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_010080050.1|785120_785510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012751103.1|785509_786790_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_080555890.1|786981_788055_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A220NQQ9	Corynebacterium_phage	32.5	3.1e-13
WP_010080047.1|788168_788924_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_010080046.1|788920_789430_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_010080044.1|789864_790146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010080043.1|790556_791627_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012751104.1|791651_792527_-	ArgP/LysG family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_010080041.1|792598_793213_+	amino acid transporter	NA	NA	NA	NA	NA
WP_012751105.1|793250_793763_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010080039.1|793838_794180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010080038.1|794375_795407_-	methionine synthase	NA	NA	NA	NA	NA
WP_012751106.1|795403_796450_-	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
WP_010080036.1|796446_797751_-	cystathionine gamma-synthase	NA	A0A0B5JD48	Pandoravirus	30.0	2.3e-18
WP_010080035.1|797752_799102_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_010080034.1|799398_800127_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_080555889.1|800265_801450_+	MFS transporter	NA	NA	NA	NA	NA
WP_010080032.1|801495_801909_+	VOC family protein	NA	NA	NA	NA	NA
WP_012751107.1|801956_802469_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010080030.1|802681_802894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010080029.1|802950_803274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010080028.1|803252_803549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010080027.1|803559_803973_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_010080025.1|804608_804923_+|transposase	transposase	transposase	Q9ETV7	Enterobacteria_phage	45.0	6.4e-12
WP_111763566.1|805304_806507_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	1.6e-31
812333:812350	attR	GCCATGGCCTCCCCCTCC	NA	NA	NA	NA
>prophage 2
NZ_LS483396	Micrococcus luteus NCTC 2665 chromosome 1	2495693	1082359	1125744	2495693	transposase,protease	Corynebacterium_phage(27.27%)	34	NA	NA
WP_010078638.1|1082359_1083613_+|transposase	IS256-like element ISMlu1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.2	6.8e-81
WP_010079746.1|1083645_1084437_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_168104827.1|1084667_1085531_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010079744.1|1085852_1087070_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012750668.1|1087066_1088167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012750669.1|1088318_1088918_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012750670.1|1089107_1090358_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_041779793.1|1090404_1093938_+	relaxase domain-containing protein	NA	V5UQN3	Mycobacterium_phage	24.3	8.5e-36
WP_012750672.1|1093995_1095126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144407139.1|1095172_1095814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012750674.1|1096008_1096533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010078638.1|1096549_1097803_-|transposase	IS256-like element ISMlu1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.2	6.8e-81
WP_144407140.1|1097882_1098236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010078638.1|1098369_1099623_+|transposase	IS256-like element ISMlu1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.2	6.8e-81
WP_111763571.1|1099683_1102443_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_082223418.1|1102494_1103661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111763551.1|1104349_1104604_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_111763566.1|1105326_1106529_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	1.6e-31
WP_012750681.1|1107675_1108983_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	71.1	2.2e-178
WP_012750682.1|1109917_1111783_+	molecular chaperone DnaK	NA	M4R062	Micromonas_pusilla_virus	47.4	4.6e-150
WP_010079740.1|1111801_1112341_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010079739.1|1112344_1113238_+	DnaJ domain-containing protein	NA	A0A167RAM8	Powai_lake_megavirus	51.3	8.8e-14
WP_010079738.1|1113234_1113546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010079737.1|1113536_1116164_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	38.1	2.8e-124
WP_010079736.1|1116160_1116613_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.3	1.2e-11
WP_012750683.1|1116609_1116870_+	UBP-type zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_010079734.1|1116866_1118579_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010079730.1|1120109_1120637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010079729.1|1120906_1121695_+	queuosine precursor transporter	NA	NA	NA	NA	NA
WP_010079728.1|1121772_1122000_+	amphi-Trp domain-containing protein	NA	NA	NA	NA	NA
WP_010079727.1|1122040_1122688_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010079726.1|1122839_1124075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010079725.1|1124260_1124791_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	44.9	1.2e-23
WP_002858193.1|1124967_1125744_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 3
NZ_LS483396	Micrococcus luteus NCTC 2665 chromosome 1	2495693	1384248	1422079	2495693	tRNA,transposase	Corynebacterium_phage(33.33%)	32	NA	NA
WP_012750723.1|1384248_1385574_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	33.4	4.7e-56
WP_012750724.1|1385753_1386281_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_010078638.1|1386558_1387812_+|transposase	IS256-like element ISMlu1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.2	6.8e-81
WP_012750725.1|1387844_1388348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160113777.1|1388347_1390186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010079362.1|1390124_1391387_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_041779771.1|1391399_1393025_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_012750726.1|1393225_1394188_-	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_012750727.1|1394268_1395063_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_041779772.1|1395189_1396197_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_012750729.1|1396258_1396831_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010079502.1|1396948_1397863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010079501.1|1397850_1398390_-	NUDIX hydrolase family protein	NA	NA	NA	NA	NA
WP_010079500.1|1398446_1399574_-	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_010079499.1|1399699_1400023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012750730.1|1400035_1402369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010079496.1|1402371_1402977_-	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_010079495.1|1402973_1404020_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_010079494.1|1404066_1405317_-	NTP transferase domain-containing protein	NA	A0A291LA53	Escherichia_phage	24.7	8.0e-05
WP_010079493.1|1405393_1406335_-	formamidopyrimidine-DNA glycosylase	NA	NA	NA	NA	NA
WP_010079492.1|1406349_1406862_-	VOC family protein	NA	NA	NA	NA	NA
WP_111763554.1|1406999_1412027_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_010079489.1|1412023_1412470_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_010079488.1|1412587_1413655_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010079487.1|1413886_1414393_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_010079486.1|1414476_1415112_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_010079485.1|1415586_1416375_+	winged helix-turn-helix transcriptional regulator	NA	W8CYM9	Bacillus_phage	41.6	4.9e-08
WP_010079484.1|1416445_1416970_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_010079483.1|1417367_1419212_+	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_010079482.1|1419468_1419708_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010079481.1|1419732_1420986_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.2	3.1e-81
WP_010079480.1|1421197_1422079_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	30.2	1.1e-27
>prophage 4
NZ_LS483396	Micrococcus luteus NCTC 2665 chromosome 1	2495693	1755190	1816786	2495693	transposase,tRNA,integrase,protease,holin	uncultured_virus(14.29%)	55	1758279:1758295	1769207:1769223
WP_010079186.1|1755190_1756534_+|transposase	IS256-like element ISMlu11 family transposase	transposase	A0A218MNI5	uncultured_virus	37.6	2.5e-36
WP_010079185.1|1756567_1758070_+	conjugal transfer protein TraC	NA	NA	NA	NA	NA
WP_010079184.1|1758069_1759974_+	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
1758279:1758295	attL	CGCGTTCGGGGCCACCG	NA	NA	NA	NA
WP_010079183.1|1759978_1760359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010079181.1|1760627_1761476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010079180.1|1761472_1761850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010079173.1|1765637_1766576_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A220NQQ9	Corynebacterium_phage	32.5	2.7e-13
WP_041779801.1|1766767_1768048_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_010079171.1|1768047_1768437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010079170.1|1768994_1769840_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
1769207:1769223	attR	CGGTGGCCCCGAACGCG	NA	NA	NA	NA
WP_010079169.1|1769927_1770584_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_010079168.1|1770664_1771594_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	48.4	5.3e-62
WP_010079167.1|1771590_1772661_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_010079166.1|1772741_1773575_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	45.8	3.1e-61
WP_010079165.1|1773707_1774631_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_012750785.1|1774772_1775279_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_010079162.1|1775403_1776624_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_041779776.1|1776804_1777689_-	peptidoglycan endopeptidase	NA	C1KFN7	Lactobacillus_virus	38.1	1.5e-13
WP_010079160.1|1778001_1779198_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_010079159.1|1779133_1779808_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_010079158.1|1780212_1781070_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_010079157.1|1781173_1782010_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_029248229.1|1782217_1782985_+	UMP kinase	NA	NA	NA	NA	NA
WP_010079155.1|1783038_1783596_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_010079154.1|1783621_1784458_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_010079153.1|1784507_1785107_+	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_010079152.1|1785262_1786417_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_010079151.1|1786413_1787481_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_012750788.1|1787477_1788917_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_010079148.1|1789025_1789544_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010079147.1|1789602_1790250_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010079146.1|1790363_1791980_+	acetyl-CoA carboxylase subunit beta	NA	A0A1B2ITV7	Pike_perch_iridovirus	62.5	2.4e-17
WP_010079145.1|1791987_1794117_+	acetyl/propionyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_012750789.1|1794132_1795320_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010079143.1|1795321_1795852_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_010079142.1|1795848_1796727_+	CoA ester lyase	NA	NA	NA	NA	NA
WP_010079141.1|1796928_1797303_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_010079140.1|1797299_1798922_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_043055197.1|1799061_1800297_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_010079138.1|1800293_1801661_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_065423801.1|1801766_1802951_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_010079136.1|1802925_1803858_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010079135.1|1803980_1805807_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_010079134.1|1805727_1806600_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_010079133.1|1806729_1807317_+	ribosome assembly cofactor RimP	NA	NA	NA	NA	NA
WP_002854993.1|1807318_1808305_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_010079132.1|1808347_1808689_+	YlxR family protein	NA	NA	NA	NA	NA
WP_012750791.1|1808881_1811674_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	29.5	1.8e-20
WP_010079129.1|1811754_1812201_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_080555869.1|1812214_1813180_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_010079127.1|1813176_1813545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010079126.1|1813556_1813988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010079125.1|1813987_1814965_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_010079124.1|1814961_1815804_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010079123.1|1815781_1816786_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 5
NZ_LS483396	Micrococcus luteus NCTC 2665 chromosome 1	2495693	2088815	2157353	2495693	tRNA,integrase,transposase,protease	Tupanvirus(16.67%)	56	2081814:2081834	2111356:2111376
2081814:2081834	attL	AGAAGGCCCTCGACGCCCTGC	NA	NA	NA	NA
WP_010078872.1|2088815_2090006_-|integrase	site-specific integrase	integrase	A0A1B3AYT2	Gordonia_phage	35.4	3.2e-43
WP_010078871.1|2090296_2090923_-	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	27.7	3.7e-11
WP_168104829.1|2091130_2092669_+	polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB	NA	NA	NA	NA	NA
WP_010078869.1|2092665_2094393_+	polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB	NA	NA	NA	NA	NA
WP_010078868.1|2094389_2095775_+	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_010078867.1|2095811_2097257_-	DUF2079 domain-containing protein	NA	NA	NA	NA	NA
WP_010078866.1|2097645_2098197_+	single-stranded DNA-binding protein	NA	A0A222ZFS3	Arthrobacter_phage	36.0	8.3e-15
WP_010078865.1|2098295_2099978_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	28.5	5.3e-44
WP_010078864.1|2100164_2101184_-	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_010078863.1|2101262_2101973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010078862.1|2102010_2103084_-	OsmC family protein	NA	NA	NA	NA	NA
WP_010078861.1|2103875_2104388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012750838.1|2104548_2107155_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	27.2	7.6e-42
WP_010078860.1|2107330_2107804_+	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_010078859.1|2107804_2108716_+	formamidopyrimidine-DNA glycosylase	NA	F8WPX6	Bacillus_phage	27.9	5.8e-05
WP_010078858.1|2108737_2109565_-	DUF1345 domain-containing protein	NA	NA	NA	NA	NA
WP_010078857.1|2109832_2110726_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010078856.1|2110925_2112290_+	trigger factor	NA	NA	NA	NA	NA
2111356:2111376	attR	AGAAGGCCCTCGACGCCCTGC	NA	NA	NA	NA
WP_010078855.1|2112554_2113172_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.9	1.2e-41
WP_002855988.1|2113213_2113879_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	46.9	6.5e-38
WP_012750840.1|2114053_2115352_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.5	1.4e-132
WP_010078853.1|2115414_2116032_+	DsbA family protein	NA	NA	NA	NA	NA
WP_010078852.1|2116117_2116453_-	membrane protein	NA	NA	NA	NA	NA
WP_010078851.1|2116815_2119500_-|tRNA	valine--tRNA ligase	tRNA	A0A2K9KZB8	Tupanvirus	37.4	3.4e-162
WP_010078850.1|2119639_2120434_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012750841.1|2120477_2121227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010078848.1|2121345_2123061_+	nitrite/sulfite reductase	NA	NA	NA	NA	NA
WP_010078847.1|2123057_2123783_+	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_010078846.1|2123815_2124751_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_010078845.1|2124750_2126091_+	sulfate adenylyltransferase	NA	A0A1V0SGC3	Hokovirus	25.8	6.3e-24
WP_010078844.1|2126122_2126848_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	2.6e-24
WP_010078843.1|2126837_2127761_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_010078842.1|2127757_2129026_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_012750842.1|2129022_2130453_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010078840.1|2130533_2131169_+	TIGR03085 family protein	NA	NA	NA	NA	NA
WP_010078839.1|2131447_2134864_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	32.9	5.3e-152
WP_012750843.1|2134863_2136417_+	dihydrofolate synthase	NA	NA	NA	NA	NA
WP_012750844.1|2136413_2136914_+	DUF4233 domain-containing protein	NA	NA	NA	NA	NA
WP_012750845.1|2136989_2137412_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	48.5	8.6e-28
WP_012750846.1|2137498_2138158_-	vitamin K epoxide reductase family protein	NA	NA	NA	NA	NA
WP_041779780.1|2138426_2141831_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_002853919.1|2142062_2142368_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_002853915.1|2142419_2142677_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_012750848.1|2142846_2144394_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_012750849.1|2144397_2145603_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.5	3.5e-58
WP_010078834.1|2145675_2147025_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.8	2.5e-89
WP_010078833.1|2147104_2147326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010078832.1|2147400_2148048_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_002853902.1|2148044_2148470_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_010078831.1|2148483_2149149_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_155116183.1|2149473_2150058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010078829.1|2150303_2151302_+	ATP-binding protein	NA	A0A2K9R7H3	Dishui_lake_phycodnavirus	29.6	1.8e-15
WP_010079362.1|2153689_2154952_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_162497514.1|2154890_2155274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010078826.1|2155847_2155994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012750851.1|2156099_2157353_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	43.2	8.9e-81
>prophage 6
NZ_LS483396	Micrococcus luteus NCTC 2665 chromosome 1	2495693	2174938	2185746	2495693	transposase	Corynebacterium_phage(25.0%)	9	NA	NA
WP_010078807.1|2174938_2176282_-|transposase	IS256-like element ISMlu11 family transposase	transposase	A0A218MNI5	uncultured_virus	38.1	1.4e-36
WP_012750854.1|2176415_2177684_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	74.2	2.3e-177
WP_012750855.1|2177798_2178251_-	DUF1931 family protein	NA	NA	NA	NA	NA
WP_012750854.1|2178364_2179633_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	74.2	2.3e-177
WP_010078804.1|2180137_2180383_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	54.3	1.8e-17
WP_010078803.1|2180394_2180862_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	31.7	4.4e-09
WP_012750856.1|2180858_2183036_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	52.8	2.0e-208
WP_010078801.1|2183294_2184266_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	74.9	2.3e-137
WP_012750857.1|2184705_2185746_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.0	2.4e-31
