The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483421	Streptococcus pyogenes strain NCTC10877 chromosome 1	1789295	36636	48949	1789295		Synechococcus_phage(28.57%)	8	NA	NA
WP_041174317.1|36636_40362_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	26.9	3.0e-39
WP_009880323.1|40522_41977_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	3.7e-54
WP_014407190.1|42004_43027_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	41.1	1.2e-62
WP_014407191.1|43194_43749_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	6.8e-25
WP_014407192.1|43932_45480_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.4	4.4e-45
WP_014407193.1|45537_46662_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
WP_041174318.1|46914_48180_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_041174354.1|48457_48949_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	3.2e-18
>prophage 2
NZ_LS483421	Streptococcus pyogenes strain NCTC10877 chromosome 1	1789295	609034	716676	1789295	tail,portal,tRNA,head,integrase,protease,holin,terminase,capsid	Streptococcus_phage(56.16%)	115	631347:631366	675562:675581
WP_014407692.1|609034_611836_+|tRNA	isoleucine--tRNA ligase	tRNA	H2EEZ0	Moumouvirus	26.9	5.5e-70
WP_002983878.1|612100_612403_-	DUF1827 family protein	NA	NA	NA	NA	NA
WP_002989103.1|612453_612909_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_002983882.1|613036_615319_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CYX3	Yersinia_phage	39.6	1.1e-124
WP_002983885.1|615616_615847_+	YkuJ family protein	NA	NA	NA	NA	NA
WP_014407691.1|615973_616660_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014407690.1|616659_617394_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	1.3e-34
WP_014407689.1|617542_618952_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	33.1	5.2e-61
WP_014407688.1|619129_620824_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	42.2	1.3e-127
WP_010922486.1|621031_621886_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	39.8	2.0e-39
WP_014407687.1|622038_623379_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	30.9	8.2e-40
WP_002983901.1|623356_623572_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_014407686.1|623571_624444_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_003056952.1|624436_625264_+	TlyA family rRNA (cytidine-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_014407685.1|625250_625721_+	arginine repressor	NA	NA	NA	NA	NA
WP_002983909.1|625742_627404_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_014407684.1|627575_628523_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002983913.1|628738_629590_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.7	5.4e-13
WP_002992620.1|629582_630425_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_010922482.1|630402_630990_+	YpmS family protein	NA	NA	NA	NA	NA
WP_002983920.1|631088_631364_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	73.0	2.6e-25
631347:631366	attL	AAAGACGCTGTTAAATAATT	NA	NA	NA	NA
WP_111697155.1|631453_632596_-|integrase	site-specific integrase	integrase	M1NRJ9	Streptococcus_phage	77.1	5.3e-173
WP_011106738.1|632718_633024_-	membrane protein	NA	NA	NA	NA	NA
WP_014411883.1|633033_633822_-	phage repressor protein	NA	A0A1S5SD15	Streptococcus_phage	63.0	2.0e-86
WP_011285583.1|634194_634353_+	hypothetical protein	NA	A0A097PAP2	Streptococcus_pyogenes_phage	100.0	4.8e-24
WP_011284882.1|634382_634982_-	hypothetical protein	NA	A0A097PAT4	Streptococcus_pyogenes_phage	100.0	3.1e-108
WP_014411882.1|635075_635315_+	helix-turn-helix transcriptional regulator	NA	A0A097PBE6	Streptococcus_pyogenes_phage	98.7	1.4e-35
WP_011285629.1|635526_636333_-	TIGR02391 family protein	NA	A0A1S5SBU1	Streptococcus_phage	82.1	7.9e-123
WP_002984292.1|636585_636795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011284879.1|636945_637185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011054585.1|637351_637537_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	72.1	3.3e-16
WP_014411880.1|637614_637926_+	hypothetical protein	NA	A0A1S5SA25	Streptococcus_phage	78.6	1.4e-43
WP_014411879.1|638077_638392_+	helix-turn-helix transcriptional regulator	NA	A0A1P8VVN6	Streptococcus_phage	94.2	1.3e-49
WP_011054820.1|638539_639022_+	siphovirus Gp157 family protein	NA	A0A1P8VVS5	Streptococcus_phage	99.4	4.6e-78
WP_002995975.1|639022_639703_+	AAA family ATPase	NA	A0A1P8VVS4	Streptococcus_phage	100.0	1.6e-129
WP_011528546.1|639804_641034_+	DEAD/DEAH box helicase	NA	A0A1P8VVM2	Streptococcus_phage	100.0	3.3e-237
WP_011054580.1|641049_641508_+	DUF669 domain-containing protein	NA	A0A1P8VVN0	Streptococcus_phage	99.3	5.0e-82
WP_014411877.1|641510_642323_+	bifunctional DNA primase/polymerase	NA	A0A1P8VVM6	Streptococcus_phage	97.4	1.3e-152
WP_014411876.1|642312_643788_+	DNA primase	NA	A0A1P8VVM0	Streptococcus_phage	86.7	2.9e-248
WP_008087509.1|644049_644463_+	hypothetical protein	NA	A0A2H4JHE6	uncultured_Caudovirales_phage	50.0	2.8e-15
WP_011054576.1|644459_644780_+	VRR-NUC domain-containing protein	NA	A0A1P8VVL5	Streptococcus_phage	94.3	7.1e-51
WP_014411872.1|645351_645636_+	DUF3310 domain-containing protein	NA	A0A1P8VVP5	Streptococcus_phage	96.8	2.2e-48
WP_002987593.1|645632_645902_+	hypothetical protein	NA	A0A1P8VVR6	Streptococcus_phage	100.0	3.1e-47
WP_111697156.1|645911_646265_+	hypothetical protein	NA	Q938M1	Temperate_phage	58.3	5.3e-31
WP_014411870.1|646261_646546_+	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	89.4	1.4e-37
WP_011018133.1|646547_647180_+	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	68.6	2.3e-85
WP_014411869.1|647182_647893_+	DUF1642 domain-containing protein	NA	Q938L9	Temperate_phage	46.2	3.0e-25
WP_014411868.1|647889_648261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014411867.1|648536_648977_+	ArpU family transcriptional regulator	NA	Q938L8	Temperate_phage	99.3	1.9e-78
WP_002985375.1|649561_649900_+	HNH endonuclease	NA	J7KH36	Streptococcus_phage	90.7	3.0e-55
WP_002985371.1|650070_650538_+|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	98.7	3.9e-82
WP_014411864.1|650552_652307_+|terminase	terminase large subunit	terminase	J7KKD1	Streptococcus_phage	96.2	0.0e+00
WP_002985365.1|652303_652474_+	hypothetical protein	NA	J7KK43	Streptococcus_phage	62.5	2.3e-08
WP_002985363.1|652466_652691_+	hypothetical protein	NA	Q938K9	Temperate_phage	61.4	3.6e-17
WP_014411863.1|652724_653945_+|portal	phage portal protein	portal	J7KDU3	Streptococcus_phage	81.7	2.0e-186
WP_023610933.1|653922_654588_+|protease	Clp protease ClpP	protease	M1Q115	Streptococcus_phage	77.7	4.6e-92
WP_014411862.1|654613_655816_+|capsid	phage major capsid protein	capsid	J7KJ82	Streptococcus_phage	64.4	6.0e-135
WP_023610896.1|655802_655949_+	hypothetical protein	NA	J7KH04	Streptococcus_phage	77.5	4.0e-09
WP_014411860.1|655951_656254_+|head,tail	phage head-tail connector protein	head,tail	J7KC36	Streptococcus_phage	87.0	6.1e-44
WP_002985351.1|656250_656598_+|head	phage head closure protein	head	J7KJ42	Streptococcus_phage	85.5	1.5e-49
WP_002985349.1|656594_656972_+	HK97 gp10 family phage protein	NA	J7KDM3	Streptococcus_phage	72.8	1.4e-45
WP_002985347.1|656968_657394_+	hypothetical protein	NA	J7KBZ9	Streptococcus_phage	85.1	5.0e-68
WP_014411858.1|657410_658019_+|tail	phage major tail protein	tail	J7KKC8	Streptococcus_phage	70.5	2.3e-74
WP_014411857.1|658071_658398_+	hypothetical protein	NA	J7KK85	Streptococcus_phage	73.1	6.0e-37
WP_014411856.1|658427_658595_+	hypothetical protein	NA	J7KBS0	Streptococcus_phage	87.3	2.9e-19
WP_014411855.1|658607_662531_+|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	48.7	1.9e-238
WP_014411854.1|662530_663238_+|tail	phage tail family protein	tail	Q938K2	Temperate_phage	71.1	1.7e-92
WP_014411852.1|665375_666398_+	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	91.7	1.2e-168
WP_014411851.1|666410_668297_+	gp58-like family protein	NA	Q938J9	Temperate_phage	86.5	1.3e-203
WP_014411850.1|668308_668737_+	DUF1617 family protein	NA	A3F661	Streptococcus_phage	86.5	1.7e-63
WP_023610893.1|668739_669378_+	hypothetical protein	NA	A3F662	Streptococcus_phage	53.7	1.2e-44
WP_002987582.1|669387_669663_+	hypothetical protein	NA	A7J2B2	Streptococcus_phage	100.0	2.6e-41
WP_003058873.1|669659_669887_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	100.0	2.0e-31
WP_014411848.1|670002_671211_+	glucosaminidase domain-containing protein	NA	Q938J4	Temperate_phage	86.8	8.6e-214
WP_011017840.1|671350_671875_+	DUF4065 domain-containing protein	NA	Q938J3	Temperate_phage	100.0	4.0e-99
WP_011054729.1|671862_672729_+	DUF334 domain-containing protein	NA	Q938J2	Temperate_phage	100.0	3.7e-134
WP_011054728.1|673033_673813_+	streptococcal pyrogenic exotoxin SpeK	NA	Q938J1	Temperate_phage	100.0	5.4e-145
WP_011054727.1|674288_674864_+	hypothetical protein	NA	Q938J0	Temperate_phage	100.0	1.7e-111
WP_011017964.1|675209_675392_+	hypothetical protein	NA	A3F673	Streptococcus_phage	76.7	1.4e-19
WP_014407683.1|675921_677784_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.7	1.6e-89
675562:675581	attR	AAAGACGCTGTTAAATAATT	NA	NA	NA	NA
WP_014407682.1|678083_679019_-	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	45.1	7.9e-66
WP_002983928.1|679257_679953_+	phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_014407681.1|680061_680583_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_002989140.1|680743_681286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014407680.1|681409_682189_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_002983939.1|682987_683584_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_002989146.1|683684_684731_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_010922441.1|684921_686313_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_014407678.1|686392_687088_+	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
WP_014407676.1|687335_688880_+	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	29.1	1.4e-35
WP_014407675.1|689186_690806_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.8	5.0e-60
WP_014407674.1|690933_692934_+	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	33.8	2.2e-65
WP_002989164.1|692957_693236_-	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	36.0	1.8e-05
WP_014407673.1|693225_694080_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_041174344.1|694119_694860_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_002983967.1|695059_695722_+	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_014407671.1|695702_697946_+	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	59.2	1.8e-55
WP_011888795.1|698016_699057_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_011054658.1|699153_699759_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	53.2	1.8e-58
WP_011054657.1|699925_700153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011054656.1|700137_700386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002983984.1|700382_700973_+	serine hydrolase	NA	NA	NA	NA	NA
WP_002983986.1|701086_702307_-	DUF3114 domain-containing protein	NA	NA	NA	NA	NA
WP_002995782.1|702313_703342_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_002995779.1|703543_704248_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_002995774.1|704366_705083_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_014407670.1|705379_706342_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_011054652.1|706354_708160_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_011054651.1|708535_709732_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_002989211.1|709797_710505_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	27.2	2.6e-08
WP_014407668.1|710567_711623_+	peptidylprolyl isomerase PrsA	NA	NA	NA	NA	NA
WP_014407667.1|712009_714628_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.9	6.7e-62
WP_011054648.1|714988_715204_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014407666.1|715200_715962_+	DUF3169 family protein	NA	NA	NA	NA	NA
WP_002984013.1|715980_716676_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_LS483421	Streptococcus pyogenes strain NCTC10877 chromosome 1	1789295	1138559	1149162	1789295		Streptococcus_phage(57.14%)	9	NA	NA
WP_002985123.1|1138559_1139702_-	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.0	4.1e-24
WP_014407485.1|1139936_1140377_+	membrane protein	NA	NA	NA	NA	NA
WP_002990257.1|1140406_1141675_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_002992646.1|1141762_1143115_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.8	1.0e-29
WP_002992643.1|1143335_1143677_-	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	41.1	5.9e-19
WP_002992640.1|1143737_1144904_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	5.8e-34
WP_002985140.1|1144997_1145684_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_002985142.1|1145680_1146844_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	3.4e-143
WP_014407484.1|1146951_1149162_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	68.9	8.5e-268
>prophage 4
NZ_LS483421	Streptococcus pyogenes strain NCTC10877 chromosome 1	1789295	1438748	1444784	1789295		Streptococcus_phage(100.0%)	9	NA	NA
WP_002990895.1|1438748_1439576_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.5	2.9e-128
WP_014407341.1|1439649_1440006_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.0	1.8e-39
WP_014407340.1|1440306_1440936_+	CutC domain-containing protein	NA	NA	NA	NA	NA
WP_002985833.1|1440982_1441375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014407339.1|1441401_1442265_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	74.0	5.5e-114
WP_002985838.1|1442269_1442593_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_014407337.1|1442997_1443237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002985844.1|1443255_1444131_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	46.6	2.1e-68
WP_041174327.1|1444148_1444784_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.4	2.7e-65
>prophage 5
NZ_LS483421	Streptococcus pyogenes strain NCTC10877 chromosome 1	1789295	1714294	1727359	1789295		Streptococcus_phage(72.73%)	19	NA	NA
WP_014411911.1|1714294_1715086_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SE31	Streptococcus_phage	48.5	7.5e-09
WP_003045754.1|1715153_1715411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002992501.1|1715465_1715873_+	hypothetical protein	NA	A0A1X9I5V7	Streptococcus_phage	69.4	1.3e-49
WP_014411912.1|1715886_1716504_+	Rha family transcriptional regulator	NA	A0A159B6D5	Gordonia_phage	38.8	6.3e-11
WP_014407939.1|1716737_1717070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080011075.1|1717069_1717261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206026.1|1717272_1717635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174505.1|1717631_1717961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014407941.1|1717963_1718236_+	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	61.2	1.6e-19
WP_014407942.1|1718236_1719094_+	primase C-terminal domain-containing protein	NA	A0A1X9I6L2	Streptococcus_phage	75.2	2.4e-125
WP_014407943.1|1719062_1720751_+	DNA primase	NA	A0A1X9I717	Streptococcus_phage	82.1	2.5e-259
WP_000694577.1|1721037_1721211_+	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	59.6	1.9e-10
WP_014407944.1|1721216_1721390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014407945.1|1721391_1721901_+	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	63.5	1.1e-29
WP_014407946.1|1721974_1722463_+	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	54.3	2.0e-44
WP_014407947.1|1722868_1723231_+	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_014407948.1|1723205_1723589_+	DUF1492 domain-containing protein	NA	Q938L8	Temperate_phage	40.2	6.4e-14
WP_014407949.1|1723753_1724407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014407950.1|1724803_1727359_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	23.4	2.3e-43
