The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483420	Streptococcus pyogenes strain NCTC13739 chromosome 1	1785880	36645	48958	1785880		Synechococcus_phage(28.57%)	8	NA	NA
WP_025195412.1|36645_40371_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	27.4	7.1e-41
WP_010921773.1|40531_41986_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	2.8e-54
WP_111684458.1|42013_43036_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	42.0	8.1e-64
WP_002986700.1|43203_43758_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	2.4e-25
WP_076639719.1|43941_45489_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.4	4.4e-45
WP_076639718.1|45546_46671_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
WP_111684460.1|46923_48189_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_111684462.1|48466_48958_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	3.2e-18
>prophage 2
NZ_LS483420	Streptococcus pyogenes strain NCTC13739 chromosome 1	1785880	606314	661051	1785880	tail,integrase,holin,protease,portal,capsid	Streptococcus_phage(60.38%)	69	624625:624644	658827:658846
WP_002983882.1|606314_608597_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CYX3	Yersinia_phage	39.6	1.1e-124
WP_002983885.1|608894_609125_+	YkuJ family protein	NA	NA	NA	NA	NA
WP_011054708.1|609251_609938_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_009880900.1|609937_610672_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	2.8e-34
WP_002993337.1|610820_612230_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.8	5.7e-60
WP_111684745.1|612407_614102_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	42.4	1.6e-128
WP_010922486.1|614309_615164_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	39.8	2.0e-39
WP_111681832.1|615316_616657_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	31.2	2.2e-40
WP_002983901.1|616634_616850_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_011284950.1|616849_617722_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_111684747.1|617714_618542_+	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_014407685.1|618528_618999_+	arginine repressor	NA	NA	NA	NA	NA
WP_002983909.1|619020_620682_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_053308492.1|620853_621801_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002983913.1|622016_622868_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.7	5.4e-13
WP_002992620.1|622860_623703_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002989129.1|623680_624268_+	YpmS family protein	NA	NA	NA	NA	NA
WP_002983920.1|624366_624642_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	73.0	2.6e-25
624625:624644	attL	AAAGACGCTGTTAAATAATT	NA	NA	NA	NA
WP_003051793.1|624730_625873_-|integrase	site-specific integrase	integrase	M1NRJ9	Streptococcus_phage	77.4	2.4e-173
WP_010922481.1|625996_626515_-	restriction endonuclease	NA	E8ZDN5	Streptococcus_phage	45.9	9.2e-32
WP_010922480.1|626526_627282_-	helix-turn-helix transcriptional regulator	NA	A0A1S5S8S8	Streptococcus_phage	60.8	2.8e-77
WP_010922479.1|627484_627697_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I583	Streptococcus_phage	56.7	1.1e-10
WP_010922478.1|627966_628278_+	excisionase	NA	A0A1S5SA25	Streptococcus_phage	77.7	5.3e-43
WP_010922477.1|628279_628465_+	hypothetical protein	NA	Q938N3	Temperate_phage	83.6	1.3e-20
WP_011017564.1|628968_629355_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	51.9	8.1e-25
WP_002988350.1|629335_629569_+	hypothetical protein	NA	Q938N1	Temperate_phage	94.8	1.8e-35
WP_011017992.1|629565_629706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011017565.1|629714_629921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063629030.1|629976_630306_+	hypothetical protein	NA	J7KGX3	Streptococcus_phage	85.3	6.4e-47
WP_002990071.1|630308_631100_+	phage recombination protein Bet	NA	A0A1S5SFP4	Streptococcus_phage	82.0	1.4e-119
WP_011888756.1|631109_632138_+	DUF1351 domain-containing protein	NA	E8ZD61	Streptococcus_phage	65.9	9.5e-121
WP_011888757.1|632334_632676_+	hypothetical protein	NA	M1NS23	Streptococcus_phage	38.7	3.1e-12
WP_111684749.1|632672_633185_+	hypothetical protein	NA	Q708P9	Streptococcus_phage	77.4	9.6e-66
WP_111684751.1|633361_633631_+	hypothetical protein	NA	A7J287	Streptococcus_phage	76.4	2.1e-27
WP_080465051.1|633633_634383_+	site-specific DNA-methyltransferase	NA	Q9MCL7	Streptococcus_virus	89.5	1.3e-130
WP_111684753.1|634891_635311_+	DUF1492 domain-containing protein	NA	A0A1X9I5B5	Streptococcus_phage	79.9	3.9e-57
WP_063629033.1|635417_635762_+	HNH endonuclease	NA	M1Q0W7	Streptococcus_phage	68.5	4.2e-41
WP_032461152.1|635910_636267_+	hypothetical protein	NA	A0A0B5A7G9	Streptococcus_phage	47.8	1.6e-14
WP_032461151.1|636263_637532_+|portal	phage portal protein	portal	A0A1X9I693	Streptococcus_phage	76.0	2.0e-189
WP_111684755.1|637524_639018_+	hypothetical protein	NA	M1Q184	Streptococcus_phage	55.6	1.1e-88
WP_002994100.1|639023_639248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032461150.1|639297_639477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002986828.1|639469_639736_+	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	6.4e-37
WP_011888764.1|639737_639974_+	hypothetical protein	NA	M1IRA5	Streptococcus_phage	80.3	1.2e-31
WP_063631462.1|640055_641471_+	hypothetical protein	NA	A0A0B5A091	Streptococcus_phage	74.6	9.1e-215
WP_032461147.1|641541_642003_+	DUF4355 domain-containing protein	NA	M1Q1L0	Streptococcus_phage	52.6	2.2e-37
WP_063631463.1|642027_642939_+|capsid	phage major capsid protein	capsid	M1PFL0	Streptococcus_phage	67.0	4.9e-113
WP_010922460.1|642938_643139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021733479.1|643148_643571_+	phage protein Gp19/Gp15/Gp42	NA	A0A0B5A2F6	Streptococcus_phage	67.2	8.2e-47
WP_011054681.1|643530_643869_+	hypothetical protein	NA	A0A0B5A086	Streptococcus_phage	75.0	8.1e-45
WP_111676592.1|643861_644098_+	hypothetical protein	NA	A0A1P8BMT2	Lactococcus_phage	66.7	1.1e-21
WP_000573598.1|644098_644434_+	hypothetical protein	NA	A0A1P8BMR5	Lactococcus_phage	64.9	9.8e-35
WP_111684757.1|644445_645030_+|tail	phage tail protein	tail	M1NS84	Streptococcus_phage	60.7	1.0e-55
WP_032461128.1|645039_645303_+	hypothetical protein	NA	A0A0B5A2F3	Streptococcus_phage	54.7	6.5e-18
WP_032461127.1|645317_645689_+	DUF5361 domain-containing protein	NA	M1PL84	Streptococcus_phage	60.0	7.0e-34
WP_111676586.1|645688_648052_+	hypothetical protein	NA	M1NRG5	Streptococcus_phage	50.6	1.3e-133
WP_111676584.1|648048_648744_+	hypothetical protein	NA	A0A1B1P761	Bacillus_phage	31.3	6.2e-07
WP_172454111.1|648725_650696_+|tail	phage tail protein	tail	Q938K1	Temperate_phage	41.0	1.4e-112
WP_111684761.1|650692_651718_+	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	93.8	1.6e-173
WP_063631467.1|651730_653671_+	gp58-like family protein	NA	Q938J9	Temperate_phage	71.4	1.3e-168
WP_111684763.1|653682_654111_+	DUF1617 family protein	NA	Q938J8	Temperate_phage	90.0	4.4e-64
WP_011017396.1|654113_654746_+	hypothetical protein	NA	Q938J7	Temperate_phage	50.0	8.9e-45
WP_011017397.1|654757_655030_+	hypothetical protein	NA	A7J2B2	Streptococcus_phage	91.0	5.5e-36
WP_003058873.1|655026_655254_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	100.0	2.0e-31
WP_014635574.1|655372_656590_+	glucosaminidase domain-containing protein	NA	A0A1P8VVM5	Streptococcus_phage	60.1	1.1e-163
WP_111684765.1|656658_657366_-	streptococcal pyrogenic exotoxin SpeC	NA	A0A097PAT7	Streptococcus_pyogenes_phage	27.1	2.3e-09
WP_111684767.1|657476_658235_-	DNase Mf2	NA	NA	NA	NA	NA
WP_014635572.1|658474_658657_+	hypothetical protein	NA	A3F673	Streptococcus_phage	80.0	1.7e-20
WP_111684768.1|659188_661051_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.1	6.0e-89
658827:658846	attR	AAAGACGCTGTTAAATAATT	NA	NA	NA	NA
>prophage 3
NZ_LS483420	Streptococcus pyogenes strain NCTC13739 chromosome 1	1785880	1140975	1151577	1785880		Streptococcus_phage(57.14%)	9	NA	NA
WP_011184383.1|1140975_1142118_-	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.3	1.4e-24
WP_012560601.1|1142352_1142793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111684985.1|1142822_1144091_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_111684987.1|1144178_1145531_-	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.4	3.1e-31
WP_002985134.1|1145750_1146092_-	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	40.2	5.9e-19
WP_002990262.1|1146152_1147319_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	4.5e-34
WP_002985140.1|1147412_1148099_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_002985142.1|1148095_1149259_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	3.4e-143
WP_111684989.1|1149366_1151577_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	69.1	1.7e-268
>prophage 4
NZ_LS483420	Streptococcus pyogenes strain NCTC13739 chromosome 1	1785880	1436890	1442765	1785880		Streptococcus_phage(100.0%)	8	NA	NA
WP_021340916.1|1436890_1437718_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.9	1.7e-128
WP_111685147.1|1437791_1438148_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.0	2.4e-39
WP_011017427.1|1438447_1439077_+	CutC family protein	NA	NA	NA	NA	NA
WP_002985833.1|1439123_1439516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111685149.1|1439542_1440406_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	74.7	1.9e-114
WP_002985838.1|1440410_1440734_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_010921931.1|1441236_1442112_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	43.8	7.7e-63
WP_111685152.1|1442129_1442765_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	62.4	7.8e-65
