The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483426	Kingella kingae strain NCTC10529 chromosome 1	2006553	96075	104203	2006553		Gordonia_phage(16.67%)	7	NA	NA
WP_003787248.1|96075_96960_-	site-specific tyrosine recombinase XerD	NA	A0A1C9EHQ9	Gordonia_phage	29.3	6.9e-19
WP_003787246.1|97135_98143_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_003787245.1|98363_99245_+	patatin-like phospholipase family protein	NA	A0A2H4UUE4	Bodo_saltans_virus	28.5	1.8e-11
WP_003787243.1|99307_100273_+	PhoH family protein	NA	H6X2N1	Pseudomonas_phage	47.6	1.4e-46
WP_003787239.1|100693_101023_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	50.0	7.2e-22
WP_003787236.1|101179_102652_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	27.7	4.2e-21
WP_032827759.1|102832_104203_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.8	1.0e-53
>prophage 2
NZ_LS483426	Kingella kingae strain NCTC10529 chromosome 1	2006553	267753	335072	2006553	transposase,tRNA	uncultured_virus(21.43%)	56	NA	NA
WP_003788404.1|267753_269163_-|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	33.0	1.0e-48
WP_111694399.1|269523_270228_+|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	48.0	2.6e-29
WP_003788407.1|270642_271935_-	TolC family protein	NA	NA	NA	NA	NA
WP_003788410.1|272056_274927_-	RTX family hemolysin	NA	NA	NA	NA	NA
WP_026036190.1|275024_275528_-	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_071461623.1|275627_276332_+|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	47.2	2.9e-28
WP_032827831.1|276384_278775_-	DNA helicase RecQ	NA	A0A2K9L3P7	Tupanvirus	35.8	3.6e-78
WP_003788417.1|279163_280354_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_019390218.1|280377_281070_-	ATPase involved in DNA repair	NA	NA	NA	NA	NA
WP_032827832.1|281296_283087_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	48.6	3.0e-162
WP_003788423.1|283207_284023_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_003791822.1|284243_284459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003788428.1|284605_284788_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003788430.1|284769_285018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003788431.1|285100_286042_-	D-2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	32.6	5.8e-32
WP_019390222.1|286155_286482_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_003788434.1|286567_287671_-	DNA polymerase III subunit beta	NA	R9TRR6	Rhizobium_phage	37.2	3.2e-50
WP_032827861.1|287690_289271_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_003788439.1|289477_290326_+	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_002214728.1|290475_290610_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_003788442.1|290613_290955_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003788445.1|291023_291233_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.1	2.4e-15
WP_003788446.1|291254_292925_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_003791841.1|293101_293314_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_003788451.1|293458_294097_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003788453.1|294182_295706_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_003788457.1|295904_296906_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	32.1	9.2e-28
WP_003788461.1|297295_298249_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	24.6	2.6e-08
WP_032827833.1|298286_298994_-	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_003788465.1|299084_299885_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_003788469.1|300040_300943_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_111694460.1|301094_301685_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003791860.1|302128_303121_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_003788473.1|303179_304037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111694400.1|305241_305880_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_003788484.1|309258_311019_-	site-specific DNA-methyltransferase	NA	A0A0K1LNZ9	Escherichia_phage	51.5	1.4e-108
WP_032827863.1|310909_311377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003791883.1|311486_311858_+|transposase	IS1 transposase	transposase	A0A218MNG1	uncultured_virus	48.6	8.1e-14
WP_111694401.1|311832_312537_+	phosphoesterase	NA	A0A2H5BGP7	Vibrio_virus	36.7	5.6e-24
WP_003788491.1|312754_312991_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002642891.1|313008_313164_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003788496.1|313216_313942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032132948.1|314033_314141_-	methionine/alanine import family NSS transporter small subunit	NA	NA	NA	NA	NA
WP_003788499.1|314133_315648_-	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_003788503.1|316046_317420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032827834.1|317578_317926_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	30.4	1.8e-07
WP_003788506.1|317927_318551_+	YdcF family protein	NA	NA	NA	NA	NA
WP_032827868.1|318905_320243_-	deoxyguanosinetriphosphate triphosphohydrolase	NA	NA	NA	NA	NA
WP_003788511.1|320293_320992_-	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003788513.1|321213_323268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003788516.1|323473_324736_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003788518.1|324907_326734_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_003788520.1|326877_328509_-	membrane protein	NA	NA	NA	NA	NA
WP_032827835.1|330088_331840_+	transferrin-binding protein-like solute binding protein	NA	NA	NA	NA	NA
WP_003788523.1|331935_334683_+	lactoferrin/transferrin family TonB-dependent receptor	NA	NA	NA	NA	NA
WP_003788525.1|334790_335072_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 3
NZ_LS483426	Kingella kingae strain NCTC10529 chromosome 1	2006553	405873	479745	2006553	integrase,transposase,tRNA	uncultured_virus(27.78%)	70	438260:438289	477982:478011
WP_032133005.1|405873_406560_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_003788155.1|406639_407197_-	porin family protein	NA	NA	NA	NA	NA
WP_003788153.1|407307_408687_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_003788149.1|409035_410040_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_032827816.1|410423_411350_+	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_003788145.1|411435_412887_-	decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase	NA	A0A0P0C6S9	Ostreococcus_lucimarinus_virus	28.7	1.7e-43
WP_003792064.1|413078_413339_+	DUF3079 domain-containing protein	NA	NA	NA	NA	NA
WP_003788138.1|413455_414202_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_003788136.1|414213_415152_+	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_003788135.1|415344_416391_+	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_003788132.1|416430_417048_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	38.6	5.6e-20
WP_145961511.1|417145_417496_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_071461654.1|417749_418013_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_003788129.1|418105_418288_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032133009.1|418391_418658_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003788125.1|418706_418991_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_169309638.1|419192_421196_-	recombinase	NA	NA	NA	NA	NA
WP_071461630.1|421359_422064_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	48.0	4.5e-29
WP_003788117.1|422366_424568_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_003788112.1|424819_426676_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.0	1.9e-23
WP_003788111.1|426756_429540_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	26.3	3.5e-77
WP_003792088.1|429799_430210_+	MliC family protein	NA	NA	NA	NA	NA
WP_003788106.1|430286_431243_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003788102.1|431410_432346_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.7e-28
WP_019390347.1|432472_433081_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	42.9	5.2e-26
WP_003792093.1|433067_433259_-	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_032827814.1|433478_435434_+	bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_003788097.1|435703_436066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081353478.1|437092_437257_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_089152897.1|437243_437357_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_143452384.1|437374_437545_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_111694399.1|437509_438214_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	48.0	2.6e-29
438260:438289	attL	TTTTACAGCACACTTTTCAGGACACCACCA	NA	NA	NA	NA
WP_089152876.1|438311_438674_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003788091.1|439076_440402_-	MFS transporter	NA	NA	NA	NA	NA
WP_003788088.1|440532_441900_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_032827821.1|442038_444765_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.2	2.7e-90
WP_003788085.1|444889_445678_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_003788083.1|445818_446025_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032827813.1|446017_446563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003788079.1|446710_449089_+	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_080656387.1|449177_449852_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003788074.1|450552_450747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003788073.1|450847_453625_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	29.7	1.7e-60
WP_032827812.1|453724_454525_-	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_003788069.1|454635_456102_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.7	4.8e-94
WP_003788067.1|456259_456685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003788064.1|456828_458109_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	25.2	4.2e-09
WP_003788062.1|458184_458901_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_003788060.1|458913_459417_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_170120131.1|461144_461786_+|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	48.0	2.4e-29
WP_081353481.1|461836_462100_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_060536923.1|462117_462339_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_003788051.1|462714_464841_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	27.9	5.1e-44
WP_003788049.1|464921_466349_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003792114.1|466638_467127_+	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_111694407.1|467056_467845_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_071461635.1|468105_469680_+	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	29.6	2.9e-12
WP_003788044.1|469739_470891_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_155114354.1|470911_471076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003788039.1|471072_471378_-	LysE family transporter	NA	NA	NA	NA	NA
WP_003788034.1|471649_472828_-	5-demethoxyubiquinol-8 5-hydroxylase UbiM	NA	NA	NA	NA	NA
WP_051273819.1|472961_473216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032827818.1|473398_474772_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L277	Tupanvirus	36.8	4.6e-30
WP_003792120.1|474828_475512_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003792121.1|475589_476126_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_003788020.1|476378_477032_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	30.2	5.4e-21
WP_003788018.1|477028_477940_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_111694408.1|478011_478716_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	48.0	2.6e-29
477982:478011	attR	TGGTGGTGTCCTGAAAAGTGTGCTGTAAAA	NA	NA	NA	NA
WP_060537242.1|478914_479151_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_111694409.1|479178_479745_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_LS483426	Kingella kingae strain NCTC10529 chromosome 1	2006553	657228	672456	2006553	plate,capsid,tail	Burkholderia_phage(28.57%)	23	NA	NA
WP_003788691.1|657228_658791_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	37.6	6.2e-31
WP_003788688.1|658934_659243_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.5	3.1e-11
WP_003788685.1|659220_659541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143452381.1|659781_660237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003786206.1|660226_660670_-	phage virion morphogenesis protein	NA	A0A0U5KRJ7	unidentified_phage	42.5	1.2e-19
WP_003786204.1|660671_661574_-|capsid	minor capsid protein	capsid	A0A0M4UTA3	Ralstonia_phage	44.7	1.9e-56
WP_003786202.1|661578_661788_-	DUF935 family protein	NA	NA	NA	NA	NA
WP_032827647.1|661839_662355_+|tail	phage major tail tube protein	tail	A0A2K9V428	Faecalibacterium_phage	26.5	2.1e-07
WP_003786198.1|662492_662783_+|tail	phage tail assembly protein	tail	Q6QIA8	Burkholderia_phage	41.6	2.8e-06
WP_038320346.1|662817_662949_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_032827925.1|662951_663140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032827923.1|663189_663411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003788929.1|663633_664311_+|tail	phage tail tape measure protein	tail	A0A1W6JT50	Escherichia_phage	56.2	5.0e-62
WP_111694415.1|664346_665852_+|tail	phage tail tape measure protein	tail	K4ICR4	Acidithiobacillus_phage	26.1	3.4e-18
WP_003785083.1|665851_666751_+|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	40.3	3.0e-22
WP_003785084.1|666747_666966_+	membrane protein	NA	NA	NA	NA	NA
WP_032827571.1|666965_668075_+	hypothetical protein	NA	Q6QIA2	Burkholderia_phage	44.6	7.2e-66
WP_071461641.1|668037_668649_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	34.9	3.8e-16
WP_038314558.1|668757_669132_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_081353480.1|669128_669596_+|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	42.3	7.3e-20
WP_111694416.1|669534_669897_+	hypothetical protein	NA	Q6QI98	Burkholderia_phage	53.8	5.5e-23
WP_032133698.1|671364_671574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003789006.1|672018_672456_+	DNA adenine methylase	NA	A0A2H4JHL6	uncultured_Caudovirales_phage	52.7	8.9e-36
>prophage 5
NZ_LS483426	Kingella kingae strain NCTC10529 chromosome 1	2006553	831508	888901	2006553	protease,transposase	uncultured_virus(27.27%)	51	NA	NA
WP_111694419.1|831508_832213_+|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	48.0	2.6e-29
WP_003785370.1|832933_833965_+	DUF91 domain-containing protein	NA	NA	NA	NA	NA
WP_003785371.1|833992_837205_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_032827586.1|837368_837842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003789367.1|838003_838480_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_003785374.1|838560_840795_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	50.3	1.1e-185
WP_003785378.1|840919_841435_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_003785381.1|841446_841755_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003785383.1|841864_842077_-	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	58.5	4.3e-12
WP_003785384.1|842177_842567_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003785386.1|842626_843802_-	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003785387.1|844026_844779_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_003785389.1|844908_846492_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	29.7	6.3e-39
WP_003789388.1|846771_848265_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_026036370.1|848325_848625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003785394.1|848852_849665_-	glutamate racemase	NA	NA	NA	NA	NA
WP_003785398.1|849873_850833_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_032827660.1|850907_851531_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_003785402.1|851976_852369_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_003785403.1|852384_853368_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003785404.1|853370_853841_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_003785405.1|853845_854949_+	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_003785406.1|855018_855510_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003785407.1|855522_855969_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.2	2.9e-26
WP_003785410.1|856595_857057_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_032827661.1|857231_858884_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	34.7	1.4e-78
WP_003785416.1|858999_859692_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003785418.1|859834_861277_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_003785420.1|861291_861858_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	35.4	7.2e-22
WP_003785422.1|861863_862751_+	prephenate dehydrogenase/arogenate dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003785424.1|862831_863926_-	restriction endonuclease subunit S	NA	A0A2H4J2Z3	uncultured_Caudovirales_phage	46.1	1.3e-32
WP_003785433.1|866208_866499_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_003785435.1|866557_867913_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_003789424.1|868074_868800_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	2.2e-23
WP_003785439.1|868974_869490_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_003785440.1|869473_870046_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_003785441.1|870042_870582_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003789428.1|870692_870875_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_003785443.1|870871_871630_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003785444.1|871713_873012_-	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	33.5	2.8e-61
WP_050792387.1|873420_873582_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	NA	NA	NA	NA
WP_003785451.1|875425_876259_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_003785452.1|876282_876951_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003789459.1|876947_877616_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
WP_003785460.1|879201_880065_+	DegV family protein	NA	NA	NA	NA	NA
WP_003785462.1|880174_881938_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	20.4	5.4e-07
WP_003789867.1|881987_882251_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_111694420.1|882268_882598_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_071461657.1|883368_883638_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032827588.1|884491_888562_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_003785466.1|888700_888901_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_LS483426	Kingella kingae strain NCTC10529 chromosome 1	2006553	926881	1037223	2006553	plate,tRNA,transposase,tail,holin,integrase,protease	Burkholderia_phage(11.11%)	113	919583:919606	1027791:1027814
919583:919606	attL	AAAGCAGCCTGCACTTTTTATTCA	NA	NA	NA	NA
WP_003785522.1|926881_927955_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_003785524.1|927977_928181_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	78.8	2.6e-22
WP_032827598.1|928365_928668_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	38.9	1.2e-10
WP_003785528.1|928664_930938_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.2	1.6e-157
WP_003785531.1|931064_931970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003785532.1|931979_935636_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.6	2.3e-07
WP_111694424.1|935789_935978_+	nitrogen regulatory IIA protein	NA	NA	NA	NA	NA
WP_003785534.1|935987_936536_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.0	7.0e-30
WP_032827599.1|936679_937552_+	YicC family protein	NA	NA	NA	NA	NA
WP_003789556.1|937991_939068_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003789557.1|939132_939714_-	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_003785541.1|939710_940043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003785546.1|940039_941170_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_032827663.1|941215_941515_-	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_003789565.1|941717_942851_+	ribonucleotide-diphosphate reductase subunit beta	NA	W6AT53	Erwinia_phage	72.7	1.2e-161
WP_032827600.1|942999_944382_+	Na+/H+ antiporter family protein	NA	NA	NA	NA	NA
WP_003785553.1|944384_944603_+	SlyX family protein	NA	NA	NA	NA	NA
WP_003785555.1|944627_945077_+	DedA family protein	NA	NA	NA	NA	NA
WP_003785557.1|945199_946639_+	glucose-6-phosphate dehydrogenase	NA	M4SP85	Cyanophage	34.0	3.3e-71
WP_155114346.1|946723_947011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003785563.1|947033_947732_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_003785566.1|947712_948717_+	glucokinase	NA	NA	NA	NA	NA
WP_003785569.1|948695_948878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003785571.1|948874_949927_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.5	1.0e-82
WP_003789582.1|950293_950656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003785577.1|950785_951613_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_003785579.1|951674_952379_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_003785581.1|952417_953278_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_003785583.1|953342_954137_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_003785588.1|954288_955104_+	DsbC family protein	NA	NA	NA	NA	NA
WP_003785591.1|955303_955555_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_003785593.1|955636_956545_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	31.2	2.1e-15
WP_003785594.1|956541_956985_+	membrane protein	NA	NA	NA	NA	NA
WP_003785596.1|957115_957967_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_003785598.1|958022_959696_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_003785600.1|959780_960311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032827601.1|960382_961381_-	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	A0A1V0SAI8	Catovirus	36.4	1.9e-41
WP_003785602.1|961462_962332_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.0	1.5e-31
WP_003785603.1|962550_963054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003785604.1|963068_963734_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_003785606.1|963802_964288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032827665.1|964445_965117_+	DUF1449 family protein	NA	NA	NA	NA	NA
WP_003785613.1|965234_966953_+	flotillin family protein	NA	NA	NA	NA	NA
WP_003785614.1|967153_968623_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_111694465.1|968904_969036_+	cobalamin biosynthesis protein CobD	NA	NA	NA	NA	NA
WP_003785617.1|969054_969207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032827602.1|969441_970530_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_003785622.1|970827_971325_+	dihydrofolate reductase	NA	A0A0A8JB64	Ralstonia_phage	44.3	1.9e-26
WP_003785623.1|971324_971756_+	EamA family transporter	NA	NA	NA	NA	NA
WP_003785625.1|971816_973580_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.8	5.3e-63
WP_003785629.1|973692_974865_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_003785631.1|975217_976075_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LS39	Mannheimia_phage	39.2	6.0e-36
WP_003785632.1|976138_976492_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_003785633.1|976472_977003_+	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	56.9	4.2e-48
WP_003785634.1|976999_977317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003785635.1|977522_977741_+	TraR/DksA C4-type zinc finger protein	NA	A0A0M3LS11	Mannheimia_phage	57.1	7.8e-09
WP_003785636.1|977727_978159_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	41.4	2.6e-19
WP_003785637.1|978162_978897_+	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_003785638.1|979087_979372_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_003785639.1|979368_979638_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_003785640.1|979796_980405_+|plate	phage baseplate assembly protein V	plate	E5E3R1	Burkholderia_phage	38.6	8.3e-32
WP_003785641.1|980401_980737_+	GPW/gp25 family protein	NA	E5E3R0	Burkholderia_phage	50.7	3.9e-15
WP_003785643.1|980733_981630_+|plate	baseplate J/gp47 family protein	plate	A0A077K9X9	Ralstonia_phage	42.5	1.9e-45
WP_003785645.1|981626_982208_+|tail	phage tail protein I	tail	R9TR33	Vibrio_phage	32.8	3.6e-16
WP_032133698.1|983638_983848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003789006.1|984292_984730_+	DNA adenine methylase	NA	A0A2H4JHL6	uncultured_Caudovirales_phage	52.7	8.9e-36
WP_003785651.1|985201_986404_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	F1BUU3	Erwinia_phage	48.1	2.7e-95
WP_032827605.1|987113_987461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003785655.1|987478_987658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050792389.1|987650_988151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143452386.1|988087_990217_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	35.6	2.0e-96
WP_003785659.1|990765_991935_+	phage late control protein	NA	A4PE54	Ralstonia_virus	45.6	3.3e-77
WP_003785662.1|991967_992390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003785664.1|992391_992748_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032827609.1|992737_993217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003785668.1|994750_996055_+	replication endonuclease	NA	R4JJS4	Burkholderia_phage	47.9	4.7e-32
WP_003785669.1|996044_996344_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_003785670.1|996365_996686_+	hypothetical protein	NA	C8CLF4	Xylella_phage	45.8	3.8e-12
WP_003785671.1|996696_997656_+	alpha-2,3-sialyltransferase	NA	NA	NA	NA	NA
WP_003785673.1|997652_998633_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_003785676.1|998715_999204_+	NYN domain-containing protein	NA	A0A0R6PGY5	Moraxella_phage	38.8	2.0e-20
WP_111694402.1|999807_1000563_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	48.0	5.1e-23
WP_111694466.1|1000782_1001472_-	iron-regulated protein FrpC	NA	A0A2H4JEI4	uncultured_Caudovirales_phage	39.5	1.0e-22
WP_003785681.1|1002034_1002514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003785686.1|1003219_1003675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111694426.1|1004199_1004955_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	48.0	1.1e-22
WP_003785687.1|1005258_1006158_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_003785688.1|1006160_1006715_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_003785689.1|1006947_1008027_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	A0A167RER2	Powai_lake_megavirus	26.5	1.8e-08
WP_003785690.1|1008032_1008662_+	Smr/MutS family protein	NA	NA	NA	NA	NA
WP_003785691.1|1008661_1009420_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003785694.1|1009453_1010086_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_003785696.1|1010191_1011199_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_003785698.1|1011210_1012401_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.3	1.5e-37
WP_111694427.1|1012505_1012883_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_003785700.1|1013014_1015132_+	AsmA family protein	NA	NA	NA	NA	NA
WP_003785701.1|1015134_1015749_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	31.0	5.1e-21
WP_003785702.1|1015812_1016349_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_003785703.1|1016420_1017611_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_003785704.1|1017825_1019169_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_003785705.1|1019182_1019941_-	FtsQ-type POTRA domain-containing protein	NA	NA	NA	NA	NA
WP_003785706.1|1019953_1020877_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_003785707.1|1020957_1022364_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_003785708.1|1022427_1022892_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_003785709.1|1022891_1024286_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_003785710.1|1024665_1026378_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	23.7	7.6e-06
WP_032827611.1|1026440_1027706_-	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_003785713.1|1027845_1029027_-	iron uptake system protein EfeO	NA	NA	NA	NA	NA
1027791:1027814	attR	AAAGCAGCCTGCACTTTTTATTCA	NA	NA	NA	NA
WP_003785715.1|1029048_1029897_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_032827612.1|1030072_1031209_+	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_003785725.1|1031605_1032634_+	transferrin-binding protein-like solute binding protein	NA	NA	NA	NA	NA
WP_003785727.1|1032676_1035079_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_032827613.1|1035168_1037223_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	28.6	2.1e-55
>prophage 7
NZ_LS483426	Kingella kingae strain NCTC10529 chromosome 1	2006553	1128194	1135298	2006553	tRNA	uncultured_virus(33.33%)	7	NA	NA
WP_003789835.1|1128194_1129589_-|tRNA	glutamate--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	29.6	9.2e-10
WP_003785886.1|1129676_1130792_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.6	4.8e-86
WP_003785887.1|1131126_1131414_+	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	48.4	1.1e-15
WP_003785888.1|1131589_1133230_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	59.1	1.3e-169
WP_003785889.1|1133389_1133623_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_003785891.1|1133619_1134279_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	50.7	2.6e-55
WP_003785895.1|1134380_1135298_-	J domain-containing protein	NA	A0A2K9L588	Tupanvirus	43.5	5.1e-09
>prophage 8
NZ_LS483426	Kingella kingae strain NCTC10529 chromosome 1	2006553	1283217	1344209	2006553	plate,capsid,tRNA,tail,protease	Burkholderia_phage(16.0%)	70	NA	NA
WP_003786110.1|1283217_1284168_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	77.4	1.1e-112
WP_003786111.1|1284232_1285276_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_003786112.1|1285272_1285965_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_032827641.1|1286217_1287069_+	presqualene diphosphate synthase HpnD	NA	NA	NA	NA	NA
WP_003786116.1|1287065_1288346_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003786118.1|1288375_1289101_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003786119.1|1289166_1290015_-	glycosyltransferase	NA	R9S8I6	Prochlorococcus_phage	28.6	1.2e-07
WP_003786120.1|1290067_1291702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003786122.1|1291719_1292811_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_003786124.1|1292923_1293754_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032827681.1|1293791_1294319_-	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_032827642.1|1294460_1295789_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_003786130.1|1295791_1296139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003786132.1|1296188_1297685_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	42.5	2.5e-77
WP_003786133.1|1297767_1299018_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.7	3.5e-93
WP_003786136.1|1299289_1299778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042226781.1|1299789_1300062_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	54.8	1.0e-13
WP_003786138.1|1300140_1300920_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_003786139.1|1300958_1302080_-	NnrS family protein	NA	NA	NA	NA	NA
WP_003786140.1|1302072_1302765_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.7	1.6e-18
WP_003786142.1|1302765_1303563_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003786145.1|1303640_1304615_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032827643.1|1304651_1306568_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_111694438.1|1306825_1307077_-	helicase	NA	NA	NA	NA	NA
WP_050792393.1|1307055_1307310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003786157.1|1308004_1310461_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	35.4	5.3e-69
WP_003786159.1|1310498_1311263_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_003786160.1|1311259_1311766_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_003786162.1|1311767_1311971_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_003786163.1|1312022_1312343_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_003786164.1|1312424_1312745_-	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_003786166.1|1313178_1313709_-	CreA family protein	NA	NA	NA	NA	NA
WP_003786167.1|1313719_1314475_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_003786168.1|1314557_1315742_-	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_003786169.1|1315923_1316406_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003786170.1|1316511_1317852_+	GTPase and DUF3482 domain-containing protein	NA	A0A0R6PKQ1	Moraxella_phage	45.5	2.0e-86
WP_003786171.1|1318014_1318860_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_111694468.1|1319006_1320434_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_003786173.1|1320671_1320845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003786174.1|1320957_1321548_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003786175.1|1321544_1321715_+	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_003786176.1|1321894_1323808_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.6	6.5e-123
WP_003786177.1|1324039_1324204_+	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_032827646.1|1325848_1327462_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_111694439.1|1327541_1328225_-	KpsF/GutQ family sugar-phosphate isomerase	NA	E3T535	Cafeteria_roenbergensis_virus	26.6	8.8e-06
WP_003789006.1|1328440_1328878_-	DNA adenine methylase	NA	A0A2H4JHL6	uncultured_Caudovirales_phage	52.7	8.9e-36
WP_003786184.1|1329561_1330020_-	hypothetical protein	NA	A0A0R6PGL8	Moraxella_phage	49.7	1.2e-30
WP_081353484.1|1330047_1330722_-	DUF4376 domain-containing protein	NA	A0A0R6PGZ9	Moraxella_phage	63.2	5.0e-38
WP_111694416.1|1332189_1332552_-	hypothetical protein	NA	Q6QI98	Burkholderia_phage	53.8	5.5e-23
WP_081353480.1|1332490_1332958_-|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	42.3	7.3e-20
WP_071461646.1|1332954_1333329_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_111694441.1|1333470_1334049_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	35.5	1.9e-17
WP_003786190.1|1334035_1335139_-	hypothetical protein	NA	Q6QIA2	Burkholderia_phage	42.4	4.3e-63
WP_003786192.1|1335126_1335345_-	membrane protein	NA	NA	NA	NA	NA
WP_003786194.1|1335345_1336233_-|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	38.0	5.6e-21
WP_111694442.1|1336232_1337741_-|tail	phage tail tape measure protein	tail	K4ICR4	Acidithiobacillus_phage	26.3	5.8e-18
WP_003788929.1|1337776_1338454_-|tail	phage tail tape measure protein	tail	A0A1W6JT50	Escherichia_phage	56.2	5.0e-62
WP_032827923.1|1338676_1338898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032827925.1|1338947_1339136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038320346.1|1339138_1339270_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_003786198.1|1339304_1339595_-|tail	phage tail assembly protein	tail	Q6QIA8	Burkholderia_phage	41.6	2.8e-06
WP_032827647.1|1339732_1340248_-|tail	phage major tail tube protein	tail	A0A2K9V428	Faecalibacterium_phage	26.5	2.1e-07
WP_003786202.1|1340299_1340509_+	DUF935 family protein	NA	NA	NA	NA	NA
WP_003786204.1|1340513_1341416_+|capsid	minor capsid protein	capsid	A0A0M4UTA3	Ralstonia_phage	44.7	1.9e-56
WP_003786206.1|1341417_1341861_+	phage virion morphogenesis protein	NA	A0A0U5KRJ7	unidentified_phage	42.5	1.2e-19
WP_143452378.1|1341980_1342184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003787072.1|1342187_1342397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003787070.1|1342419_1343349_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032827729.1|1343486_1343822_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_003787066.1|1343843_1344209_+	rhodanese-like domain-containing protein	NA	E5EQQ4	Micromonas_sp._RCC1109_virus	38.0	3.0e-05
>prophage 9
NZ_LS483426	Kingella kingae strain NCTC10529 chromosome 1	2006553	1576333	1624718	2006553	integrase,transposase,tRNA	uncultured_Mediterranean_phage(15.38%)	58	1581217:1581239	1625516:1625538
WP_003786584.1|1576333_1577131_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_003786582.1|1577130_1577916_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_032827698.1|1578055_1579354_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	54.9	4.9e-98
WP_003786578.1|1579350_1579680_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_003786576.1|1579690_1580230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003786574.1|1580251_1580515_+	hypothetical protein	NA	NA	NA	NA	NA
1581217:1581239	attL	AAAAAGCAGCCTGCACTTTTGCT	NA	NA	NA	NA
WP_003786569.1|1581252_1583172_-	TonB-dependent copper receptor	NA	NA	NA	NA	NA
WP_003790195.1|1583347_1583626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003786564.1|1583606_1585037_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	33.3	1.1e-50
WP_003786562.1|1585046_1586069_+	DUF459 domain-containing protein	NA	NA	NA	NA	NA
WP_003786561.1|1586081_1587236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003786558.1|1587310_1588465_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_003786555.1|1588571_1588904_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	44.7	2.4e-17
WP_003786553.1|1589317_1590331_+|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	42.7	2.9e-66
WP_003786551.1|1590351_1590645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003786549.1|1590651_1590813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003786548.1|1590826_1591780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003786547.1|1591776_1592184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003786546.1|1592292_1592772_-	siphovirus Gp157 family protein	NA	A0A059T5F1	Listeria_phage	35.6	7.7e-17
WP_003786545.1|1592838_1593054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003786543.1|1593131_1593503_-	hypothetical protein	NA	A0A1B1IW37	uncultured_Mediterranean_phage	41.6	2.6e-20
WP_003786541.1|1593582_1593738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003786540.1|1593820_1594273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003786537.1|1594348_1594570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003786535.1|1594571_1594862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003786531.1|1595072_1595435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003786529.1|1595483_1595693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032827696.1|1595942_1596428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003786525.1|1596429_1597569_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	45.3	7.5e-10
WP_003786523.1|1597565_1597841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003786522.1|1597948_1598569_-	helix-turn-helix domain-containing protein	NA	A2I308	Vibrio_virus	34.4	4.3e-20
WP_003786520.1|1598682_1598889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003786518.1|1598898_1599186_+	hypothetical protein	NA	A0A2H4J960	uncultured_Caudovirales_phage	41.3	1.8e-05
WP_032827694.1|1599248_1599500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111694402.1|1599838_1600594_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	48.0	5.1e-23
WP_071461640.1|1600736_1604078_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_143452388.1|1604256_1604511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071461653.1|1604611_1605178_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_060537242.1|1605205_1605442_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_032827740.1|1606347_1606530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003786505.1|1606757_1608032_-	M23 family metallopeptidase	NA	A8ATH6	Listeria_phage	50.4	6.0e-24
WP_050792400.1|1608098_1609067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003786501.1|1609344_1611015_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_003786498.1|1611179_1612658_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_003786496.1|1612690_1613260_-	GTP pyrophosphokinase	NA	Q0H269	Geobacillus_phage	28.7	1.6e-16
WP_032133302.1|1613359_1614985_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	54.7	6.9e-158
WP_003786493.1|1615115_1616024_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_099046168.1|1616160_1617393_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_003786490.1|1617545_1618268_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_032133315.1|1618270_1618624_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_003786485.1|1618763_1619408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003786483.1|1619641_1620100_+	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_003786481.1|1620105_1620975_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_003786480.1|1621016_1621622_+	manganese efflux pump	NA	NA	NA	NA	NA
WP_003786478.1|1621618_1622347_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_003786475.1|1622579_1623302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071461654.1|1623784_1624048_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155114364.1|1624301_1624718_+|transposase	transposase	transposase	NA	NA	NA	NA
1625516:1625538	attR	AGCAAAAGTGCAGGCTGCTTTTT	NA	NA	NA	NA
>prophage 10
NZ_LS483426	Kingella kingae strain NCTC10529 chromosome 1	2006553	1659444	1714316	2006553	tRNA,protease,transposase,terminase	Staphylococcus_phage(16.67%)	47	NA	NA
WP_003786391.1|1659444_1660713_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	49.6	6.9e-113
WP_032827734.1|1661725_1662670_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.4	3.8e-23
WP_003786384.1|1662666_1663842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003786383.1|1663903_1665109_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_003786379.1|1665501_1666671_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	61.7	3.5e-127
WP_003786375.1|1666921_1668715_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	23.0	7.9e-22
WP_111694460.1|1668855_1669446_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_019389315.1|1669912_1670359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003786371.1|1670411_1672769_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.2	4.0e-122
WP_050792413.1|1673706_1674144_+	DNA adenine methylase	NA	A0A2H4JHL6	uncultured_Caudovirales_phage	47.3	3.9e-31
WP_003788974.1|1674226_1674721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111694402.1|1674780_1675536_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	48.0	5.1e-23
WP_003786368.1|1675650_1677228_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_003786366.1|1677359_1678214_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_080561227.1|1678226_1678505_+	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_026036239.1|1678568_1678931_-	YbaN family protein	NA	NA	NA	NA	NA
WP_003786358.1|1679044_1679626_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_003786353.1|1679791_1683652_-	translocation/assembly module TamB	NA	NA	NA	NA	NA
WP_003786351.1|1683705_1685553_-	outer membrane protein assembly factor	NA	NA	NA	NA	NA
WP_032827692.1|1685657_1686557_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_003786348.1|1686824_1687187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003786346.1|1687219_1688092_+	basic amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032827691.1|1688189_1689560_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.5	2.9e-109
WP_032827733.1|1689633_1691403_-	chorismate-binding protein	NA	NA	NA	NA	NA
WP_003786340.1|1691476_1692205_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_003786338.1|1692329_1692701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111694449.1|1693689_1695102_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_003786332.1|1695189_1695933_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003786331.1|1695929_1697306_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003786329.1|1697302_1698499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032827690.1|1698511_1699309_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_003786325.1|1699553_1700564_-	S49 family peptidase	NA	K4I1N3	Providencia_phage	28.3	6.2e-16
WP_003786323.1|1700638_1702171_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.9	6.2e-84
WP_003786322.1|1702183_1702759_-	CvpA family protein	NA	NA	NA	NA	NA
WP_032827689.1|1702758_1703796_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_032827688.1|1703812_1705114_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_032827687.1|1705190_1706087_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_032133807.1|1706229_1706976_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_003786312.1|1707090_1708626_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_003790764.1|1708761_1709100_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	54.0	1.1e-28
WP_032827686.1|1709160_1710480_-	MFS transporter	NA	NA	NA	NA	NA
WP_003786307.1|1710436_1710613_-	cbb3-type cytochrome oxidase assembly protein CcoS	NA	NA	NA	NA	NA
WP_003786304.1|1710614_1710926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003786300.1|1710980_1711853_+	DMT family transporter	NA	NA	NA	NA	NA
WP_060537242.1|1712117_1712354_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_071461653.1|1712381_1712948_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_003786298.1|1713035_1714316_-|terminase	terminase	terminase	E5FFI8	Burkholderia_phage	49.4	5.7e-107
>prophage 11
NZ_LS483426	Kingella kingae strain NCTC10529 chromosome 1	2006553	1740884	1773378	2006553	plate,capsid,transposase,tail,integrase	Burkholderia_virus(32.26%)	49	1738916:1738936	1779268:1779288
1738916:1738936	attL	ACAAAGTGCAGGCTGCTTTTT	NA	NA	NA	NA
WP_003789006.1|1740884_1741322_-	DNA adenine methylase	NA	A0A2H4JHL6	uncultured_Caudovirales_phage	52.7	8.9e-36
WP_032133698.1|1741766_1741976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071461649.1|1743443_1744022_-|tail	phage tail protein	tail	Q6QI98	Burkholderia_phage	52.3	1.7e-47
WP_111694450.1|1744014_1745154_-|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	38.5	8.2e-57
WP_071461646.1|1745150_1745525_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_032133917.1|1745666_1746257_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	34.9	2.8e-16
WP_032827571.1|1746240_1747350_-	hypothetical protein	NA	Q6QIA2	Burkholderia_phage	44.6	7.2e-66
WP_003785084.1|1747349_1747568_-	membrane protein	NA	NA	NA	NA	NA
WP_003785083.1|1747564_1748464_-|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	40.3	3.0e-22
WP_111694415.1|1748463_1749969_-|tail	phage tail tape measure protein	tail	K4ICR4	Acidithiobacillus_phage	26.1	3.4e-18
WP_003788929.1|1750004_1750682_-|tail	phage tail tape measure protein	tail	A0A1W6JT50	Escherichia_phage	56.2	5.0e-62
WP_032827923.1|1750904_1751126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032827925.1|1751175_1751364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003792207.1|1751366_1751480_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_003785080.1|1751532_1751814_-|tail	phage tail assembly protein	tail	Q6QIA8	Burkholderia_phage	37.8	8.9e-05
WP_003785079.1|1751947_1752463_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	47.9	3.1e-40
WP_003785078.1|1752478_1753870_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	44.8	3.3e-100
WP_003785077.1|1753879_1754380_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	34.5	1.3e-22
WP_003785076.1|1754380_1754806_-	DUF1320 domain-containing protein	NA	A0A0C4UR02	Shigella_phage	32.0	3.6e-10
WP_003785075.1|1754809_1755064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003785072.1|1755067_1755400_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_003785071.1|1755448_1756381_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	42.6	6.3e-55
WP_003785069.1|1756396_1757488_-	hypothetical protein	NA	Q6QIB7	Burkholderia_phage	36.9	2.5e-55
WP_003785065.1|1757723_1758074_-	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	42.1	1.3e-16
WP_003785064.1|1758195_1759095_-	recombination-associated protein RdgC	NA	A0A0U1SXS1	Pseudomonas_phage	33.8	6.3e-36
WP_003785061.1|1759208_1759817_-	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	45.8	9.4e-44
WP_003785060.1|1759921_1760341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003785058.1|1760337_1760835_-	hypothetical protein	NA	A0A2H4JFV8	uncultured_Caudovirales_phage	42.2	1.3e-27
WP_003785057.1|1760831_1760999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003785056.1|1761056_1761209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080561215.1|1761210_1762737_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN1	Burkholderia_virus	61.3	1.6e-76
WP_003785053.1|1762657_1763017_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	47.8	2.3e-13
WP_003785051.1|1763023_1763896_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	39.7	3.3e-42
WP_003785049.1|1763932_1764223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003785043.1|1764968_1766114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003785041.1|1766203_1766716_+	TIGR02594 family protein	NA	A0A1L2C8R8	Pseudomonas_phage	60.2	4.1e-56
WP_003785039.1|1766729_1766903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158529714.1|1766914_1767067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003785035.1|1767069_1767330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003785033.1|1767319_1767475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032827305.1|1767458_1767659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003785029.1|1767651_1767858_+	TraR/DksA family transcriptional regulator	NA	V5USD3	Shigella_phage	55.7	1.0e-10
WP_003785028.1|1767850_1768174_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	40.2	1.2e-10
WP_003785025.1|1768170_1768476_+	hypothetical protein	NA	A0A2H4JGU5	uncultured_Caudovirales_phage	60.4	4.0e-27
WP_003785024.1|1768477_1769023_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	47.5	2.9e-36
WP_003785023.1|1769019_1770525_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	66.9	1.5e-199
WP_003785021.1|1770555_1772052_+	DUF935 family protein	NA	A4JWJ5	Burkholderia_virus	44.8	9.3e-109
WP_003785020.1|1772041_1772950_+|capsid	minor capsid protein	capsid	A0A0M4UTA3	Ralstonia_phage	46.9	2.6e-61
WP_003785019.1|1772946_1773378_+	phage virion morphogenesis protein	NA	A0A0U5KRJ7	unidentified_phage	39.9	3.7e-18
1779268:1779288	attR	ACAAAGTGCAGGCTGCTTTTT	NA	NA	NA	NA
