The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483430	Streptococcus pyogenes strain NCTC12044 chromosome 1	1756874	36632	48946	1756874		Synechococcus_phage(28.57%)	8	NA	NA
WP_111686137.1|36632_40358_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	26.8	2.1e-40
WP_023080049.1|40518_41973_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	1.7e-54
WP_023080052.1|42000_43023_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	41.4	9.0e-63
WP_111686138.1|43190_43745_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	1.5e-24
WP_111686139.1|43928_45476_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	E3SNU8	Prochlorococcus_phage	52.9	2.0e-45
WP_002987712.1|45534_46659_-	SH3 domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	7.7e-07
WP_085634632.1|46911_48177_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002987716.1|48454_48946_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	3.2e-18
>prophage 2
NZ_LS483430	Streptococcus pyogenes strain NCTC12044 chromosome 1	1756874	327869	333902	1756874		Streptococcus_phage(100.0%)	8	NA	NA
WP_014635306.1|327869_328505_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.4	2.0e-65
WP_011528291.1|328522_329398_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	47.9	1.8e-72
WP_002985838.1|330060_330384_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	59.4	1.3e-28
WP_002985836.1|330388_331252_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	75.0	1.7e-115
WP_002985833.1|331278_331671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111686176.1|331717_332347_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_011284536.1|332644_333001_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	65.8	6.3e-40
WP_111686177.1|333074_333902_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.5	4.9e-128
>prophage 3
NZ_LS483430	Streptococcus pyogenes strain NCTC12044 chromosome 1	1756874	601087	611692	1756874		Streptococcus_phage(57.14%)	9	NA	NA
WP_011054348.1|601087_603298_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	69.1	2.9e-268
WP_011054349.1|603405_604569_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	5.8e-143
WP_002985140.1|604565_605252_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
WP_002985136.1|605345_606512_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	4.5e-34
WP_111686231.1|606572_606914_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	39.3	2.9e-18
WP_002992646.1|607134_608487_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	23.8	1.0e-29
WP_002992648.1|608567_609845_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_011017641.1|609874_610315_-	membrane protein	NA	NA	NA	NA	NA
WP_002985123.1|610549_611692_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.0	4.1e-24
>prophage 4
NZ_LS483430	Streptococcus pyogenes strain NCTC12044 chromosome 1	1756874	995289	1040846	1756874	transposase,protease	Enterococcus_phage(27.27%)	40	NA	NA
WP_168389357.1|995289_996631_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.4	1.8e-63
WP_002992869.1|996920_997793_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_002984130.1|998016_999327_+	C4-dicarboxylate ABC transporter	NA	NA	NA	NA	NA
WP_011528725.1|999404_999698_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_111686297.1|999730_1000027_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_172453913.1|1000129_1000453_+|transposase	transposase family protein	transposase	U5P429	Shigella_phage	41.9	3.6e-18
WP_172453925.1|1000469_1001201_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_011017916.1|1001315_1001681_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_111686300.1|1001800_1003021_-	MFS transporter	NA	NA	NA	NA	NA
WP_111686301.1|1003394_1004879_+	DUF1846 domain-containing protein	NA	NA	NA	NA	NA
WP_002984115.1|1004983_1005385_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_002984113.1|1005469_1005868_-	phosphorylase	NA	F5CA76	Streptococcus_phi-m46.1-like_phage	74.1	1.1e-61
WP_011106727.1|1006159_1007548_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	D0R096	Streptococcus_phage	98.3	4.5e-259
WP_002984109.1|1007596_1009048_-	LCP family protein	NA	NA	NA	NA	NA
WP_002984106.1|1009255_1009747_-	shikimate kinase	NA	NA	NA	NA	NA
WP_002984103.1|1009739_1011023_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002984102.1|1011133_1012099_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002984100.1|1012100_1012961_-	methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002984098.1|1012976_1014260_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_002984095.1|1014268_1014811_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_111686302.1|1015048_1015786_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002989295.1|1016142_1017402_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002989292.1|1017575_1018772_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	65.4	4.5e-138
WP_111686303.1|1019308_1021687_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_002984078.1|1021890_1022832_+	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor	NA	NA	NA	NA	NA
WP_012560785.1|1022806_1023010_-	DUF3272 domain-containing protein	NA	NA	NA	NA	NA
WP_002984073.1|1023104_1024775_-	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.6	5.1e-47
WP_009881127.1|1024774_1025272_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_111686304.1|1025416_1026226_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002984060.1|1026622_1027249_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.7	2.2e-35
WP_002989254.1|1027346_1028432_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	1.6e-33
WP_002989251.1|1028541_1029816_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_011284931.1|1029910_1031338_-	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002984033.1|1031522_1033256_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_002984031.1|1033260_1033524_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_002989242.1|1033916_1034135_+	redoxin NrdH	NA	A0A249XUR7	Enterococcus_phage	49.3	1.1e-13
WP_002984018.1|1034154_1036314_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	64.0	8.6e-265
WP_002987365.1|1036517_1037477_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	70.5	3.7e-127
WP_014411846.1|1037451_1038765_+	chloride channel protein	NA	NA	NA	NA	NA
WP_002984013.1|1040150_1040846_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 5
NZ_LS483430	Streptococcus pyogenes strain NCTC12044 chromosome 1	1756874	1366568	1414873	1756874	integrase,portal,head,tail,terminase,capsid	Streptococcus_phage(68.0%)	60	1369436:1369453	1411949:1411966
WP_111686355.1|1366568_1369397_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.7	5.9e-306
1369436:1369453	attL	CTTATATTATAACAAAAA	NA	NA	NA	NA
WP_011184907.1|1369622_1369805_-	hypothetical protein	NA	A3F673	Streptococcus_phage	83.3	4.4e-21
WP_011285611.1|1370042_1370843_+	streptodornase Sda3	NA	NA	NA	NA	NA
WP_011017966.1|1371114_1371549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011888701.1|1371598_1372465_-	DUF334 domain-containing protein	NA	Q938J2	Temperate_phage	99.7	1.1e-133
WP_011017840.1|1372452_1372977_-	DUF4065 domain-containing protein	NA	Q938J3	Temperate_phage	100.0	4.0e-99
WP_011054730.1|1373116_1374319_-	glucosaminidase domain-containing protein	NA	Q938J4	Temperate_phage	100.0	3.3e-242
WP_011054731.1|1374429_1374615_-	hypothetical protein	NA	Q938J5	Temperate_phage	100.0	1.7e-25
WP_011054732.1|1374611_1374908_-	hypothetical protein	NA	Q938J6	Temperate_phage	100.0	7.5e-47
WP_011054733.1|1374918_1375530_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	100.0	2.7e-91
WP_021340778.1|1375532_1375964_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	99.3	5.2e-73
WP_111686356.1|1375975_1377991_-	gp58-like family protein	NA	Q938J9	Temperate_phage	84.2	3.2e-213
WP_168625266.1|1378000_1379113_-	hyaluronoglucosaminidase	NA	A7J2A8	Streptococcus_phage	73.3	8.4e-123
WP_111686357.1|1379112_1381095_-|tail	phage tail protein	tail	A7J2A7	Streptococcus_phage	94.5	0.0e+00
WP_002988788.1|1381104_1381947_-	hypothetical protein	NA	A7J2A6	Streptococcus_phage	99.6	8.5e-160
WP_002988786.1|1381958_1386341_-	tape measure protein	NA	A7J2A5	Streptococcus_phage	76.4	3.2e-226
WP_002983445.1|1386355_1386589_-	hypothetical protein	NA	A7J2A4	Streptococcus_phage	100.0	4.4e-34
WP_002983443.1|1386663_1387119_-	hypothetical protein	NA	A7J2A3	Streptococcus_phage	100.0	8.3e-77
WP_002988784.1|1387172_1387772_-|tail	phage major tail protein, TP901-1 family	tail	A7J2A2	Streptococcus_phage	98.9	4.1e-92
WP_002988782.1|1387783_1388143_-	hypothetical protein	NA	A7J2A1	Streptococcus_phage	97.5	6.8e-58
WP_002988781.1|1388146_1388491_-	HK97 gp10 family phage protein	NA	A7J2A0	Streptococcus_phage	99.1	6.1e-56
WP_000639437.1|1388487_1388766_-	hypothetical protein	NA	A7J299	Streptococcus_phage	98.9	4.2e-47
WP_002988776.1|1388776_1389133_-|head,tail	phage head-tail connector protein	head,tail	A7J298	Streptococcus_phage	97.5	2.8e-56
WP_002988771.1|1389144_1390032_-	hypothetical protein	NA	A7J297	Streptococcus_phage	99.7	3.6e-161
WP_002988768.1|1390044_1390614_-	DUF4355 domain-containing protein	NA	A7J296	Streptococcus_phage	97.9	2.6e-80
WP_002988765.1|1390769_1391036_-	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	88.6	1.7e-34
WP_002983423.1|1391038_1391227_-	hypothetical protein	NA	A7J294	Streptococcus_phage	98.4	1.4e-22
WP_015446273.1|1391257_1392703_-|capsid	minor capsid protein	capsid	A7J293	Streptococcus_phage	92.9	3.4e-257
WP_002988758.1|1392662_1394195_-|portal	phage portal protein	portal	A7J292	Streptococcus_phage	98.2	1.3e-286
WP_002988754.1|1394210_1395488_-|terminase	PBSX family phage terminase large subunit	terminase	A7J291	Streptococcus_phage	97.6	1.3e-241
WP_011106637.1|1395477_1395930_-|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	100.0	6.9e-76
WP_002988747.1|1396019_1396436_-	DUF722 domain-containing protein	NA	A7J289	Streptococcus_phage	100.0	6.6e-73
WP_002988743.1|1396432_1396624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111686358.1|1396774_1397464_-	site-specific DNA-methyltransferase	NA	A0A1W6JMZ7	Lactococcus_phage	71.9	9.5e-101
WP_002988738.1|1397472_1397739_-	hypothetical protein	NA	A7J287	Streptococcus_phage	65.2	5.4e-20
WP_002988735.1|1397735_1397903_-	hypothetical protein	NA	A7J285	Streptococcus_phage	94.5	1.9e-23
WP_002988733.1|1397903_1399226_-	DEAD/DEAH box helicase family protein	NA	A7J284	Streptococcus_phage	98.4	1.9e-254
WP_002988730.1|1399222_1399498_-	VRR-NUC domain-containing protein	NA	A7J283	Streptococcus_phage	100.0	9.1e-47
WP_011285674.1|1399884_1402269_-	DNA primase	NA	A7J282	Streptococcus_phage	94.4	4.1e-276
WP_002988723.1|1402273_1404196_-	DNA polymerase	NA	A7J280	Streptococcus_phage	96.7	0.0e+00
WP_002988718.1|1404238_1404796_-	DUF2815 family protein	NA	D2J040	Enterococcus_phage	57.9	2.5e-51
WP_002988715.1|1404806_1405205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002988711.1|1405208_1406363_-	DUF2800 domain-containing protein	NA	A7J278	Streptococcus_phage	91.9	4.5e-204
WP_002988708.1|1406362_1406662_-	hypothetical protein	NA	A7J277	Streptococcus_phage	100.0	1.8e-43
WP_002988705.1|1406749_1406953_-	hypothetical protein	NA	A7J276	Streptococcus_phage	95.5	2.3e-31
WP_002988700.1|1407098_1407485_-	hypothetical protein	NA	A7J274	Streptococcus_phage	88.2	3.1e-56
WP_002988697.1|1407481_1407685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002988693.1|1407677_1407848_-	hypothetical protein	NA	A7J273	Streptococcus_phage	89.3	6.9e-21
WP_002988687.1|1407844_1408120_-	hypothetical protein	NA	A7J272	Streptococcus_phage	95.6	5.9e-46
WP_002988684.1|1408181_1408397_-	hypothetical protein	NA	M1Q1B4	Streptococcus_phage	76.8	4.2e-23
WP_002988681.1|1408444_1408858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002988678.1|1408838_1408994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111686359.1|1409268_1409670_+	helix-turn-helix transcriptional regulator	NA	Q938N6	Temperate_phage	72.9	6.4e-41
WP_002986894.1|1409683_1410064_+	hypothetical protein	NA	Q938N7	Temperate_phage	100.0	5.3e-69
WP_002986895.1|1410074_1410596_+	hypothetical protein	NA	Q938N8	Temperate_phage	100.0	2.3e-67
WP_094751290.1|1410714_1411869_+|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	98.1	3.8e-203
WP_011888617.1|1412112_1413057_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
1411949:1411966	attR	CTTATATTATAACAAAAA	NA	NA	NA	NA
WP_010922629.1|1413189_1413846_+	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_002983142.1|1413978_1414218_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_023605268.1|1414381_1414873_-	single-stranded DNA-binding protein	NA	A0A286QNX2	Streptococcus_phage	74.2	1.3e-59
>prophage 6
NZ_LS483430	Streptococcus pyogenes strain NCTC12044 chromosome 1	1756874	1675171	1694932	1756874	integrase,holin	Streptococcus_phage(56.25%)	25	1678370:1678390	1692233:1692253
WP_002992187.1|1675171_1676392_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	23.6	3.5e-05
WP_111686421.1|1676402_1678385_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.1	1.7e-62
1678370:1678390	attL	CAATAATGTTTGTCATAATTT	NA	NA	NA	NA
WP_172453924.1|1678479_1679631_-|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	44.9	7.9e-84
WP_011185066.1|1679879_1680023_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_011185067.1|1680905_1681586_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JQE6	Staphylococcus_phage	47.9	1.3e-33
WP_011185068.1|1681749_1681947_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I5U5	Streptococcus_phage	63.1	1.3e-15
WP_111686422.1|1681960_1682569_+	phage repressor protein	NA	A0A1W6JPC3	Staphylococcus_phage	46.9	1.0e-42
WP_002992501.1|1682589_1682997_+	hypothetical protein	NA	A0A1X9I5V7	Streptococcus_phage	69.4	1.3e-49
WP_011185071.1|1683408_1683936_+	Rha family transcriptional regulator	NA	R9QNB1	Lactococcus_phage	40.2	9.7e-21
WP_032463079.1|1684180_1684522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003058793.1|1684508_1684730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023080070.1|1684732_1684924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174505.1|1684935_1685265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100459.1|1685267_1685540_+	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	60.0	6.1e-19
WP_032463081.1|1685540_1686398_+	primase C-terminal domain-containing protein	NA	A0A1X9I6L2	Streptococcus_phage	75.2	2.4e-125
WP_063661998.1|1686366_1688055_+	DNA primase	NA	A0A1X9I717	Streptococcus_phage	81.8	6.1e-258
WP_000694577.1|1688341_1688515_+	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	59.6	1.9e-10
WP_014635784.1|1688520_1688694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014407945.1|1688695_1689205_+	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	63.5	1.1e-29
WP_014407946.1|1689278_1689767_+	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	54.3	2.0e-44
WP_020905578.1|1690170_1690533_+	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_014407948.1|1690507_1690891_+	DUF1492 domain-containing protein	NA	Q938L8	Temperate_phage	40.2	6.4e-14
WP_023080229.1|1691096_1691735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063662001.1|1691734_1691965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111686423.1|1692376_1694932_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	23.3	6.8e-43
1692233:1692253	attR	CAATAATGTTTGTCATAATTT	NA	NA	NA	NA
