The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LS483445	Moraxella catarrhalis strain NCTC11020 chromosome 1	1907984	264002	272165	1907984		Moraxella_phage(33.33%)	11	NA	NA
WP_003656256.1|264002_264623_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	42.2	1.3e-29
WP_003656259.1|264803_265709_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_003656261.1|265781_266054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063454133.1|266107_266818_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	34.6	1.9e-35
WP_063454132.1|266857_267178_+	hypothetical protein	NA	A0A2P1EK93	Megavirus	41.6	3.6e-18
WP_003658739.1|267531_269043_+	chorismate-binding protein	NA	A0A0B5J984	Pandoravirus	31.4	8.9e-35
WP_003656268.1|269095_269575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003658741.1|269574_269982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063454131.1|269983_270343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003656272.1|270339_271272_-	AAA family ATPase	NA	A0A0R6PCP6	Moraxella_phage	99.6	2.1e-151
WP_003658746.1|271274_272165_-	WYL domain-containing transcriptional regulator	NA	A0A0R6PH67	Moraxella_phage	99.7	6.6e-171
>prophage 2
NZ_LS483445	Moraxella catarrhalis strain NCTC11020 chromosome 1	1907984	823259	831062	1907984	integrase	Moraxella_phage(33.33%)	12	824216:824275	854315:854482
WP_003656748.1|823259_824339_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	51.7	6.0e-09
824216:824275	attL	TCACCGCATTAACCTAACTTTATATAAGCTTGATGCCATCATGGAAGGGGATTTGACTGA	NA	NA	NA	NA
WP_003667798.1|824384_825383_+|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	42.2	5.8e-67
WP_003661585.1|825412_826498_-	ribonucleotide-diphosphate reductase subunit beta	NA	W6AT53	Erwinia_phage	63.5	5.6e-132
WP_063454242.1|826512_826893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063454241.1|826893_827376_-	hypothetical protein	NA	A0A0R6PGZ8	Moraxella_phage	76.2	5.3e-66
WP_003667805.1|827380_827638_-	hypothetical protein	NA	A0A0R6PHP0	Moraxella_phage	61.2	4.6e-24
WP_063454240.1|827925_828279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667812.1|828290_828812_-	crossover junction endodeoxyribonuclease RuvC	NA	U5PZY8	Acinetobacter_phage	37.2	3.9e-22
WP_003667814.1|828808_829009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003671143.1|829018_829714_-	hypothetical protein	NA	E9NIH2	Enterobacter_phage	40.1	2.0e-37
WP_063454239.1|829746_830268_-	HNH endonuclease	NA	A0A2P9J4Z6	Pectobacterium_phage	43.5	6.6e-30
WP_063454238.1|830330_831062_-	AAA family ATPase	NA	M4SNJ2	Pseudoalteromonas_phage	53.5	4.6e-69
854315:854482	attR	TCACCGCATTAACCTAACTTTATATAAGCTTGATGCCATCATGGAAGGGGATTTGACTGAGCTTTTAGACAGCTTATTGCGTGAACATCATGCTGATTTGATGGCAAGTGTGGGAGCAGAGTAATTTTAGGGTAATTATTTTATGTCAATTACCCTAGGATTACCCTA	NA	NA	NA	NA
>prophage 3
NZ_LS483445	Moraxella catarrhalis strain NCTC11020 chromosome 1	1907984	910254	919229	1907984	tRNA	Acinetobacter_phage(50.0%)	9	NA	NA
WP_003658324.1|910254_910821_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	31.5	1.9e-14
WP_003663566.1|910893_911751_-	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_003658321.1|911747_912809_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_038519548.1|912850_913675_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	47.9	7.2e-55
WP_003673813.1|913707_914799_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.6	1.3e-99
WP_003658317.1|914931_915555_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	65.3	9.0e-74
WP_003658315.1|915780_916164_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_003659685.1|916193_917237_-	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	31.8	3.6e-35
WP_063454224.1|917285_919229_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	1.2e-47
>prophage 4
NZ_LS483445	Moraxella catarrhalis strain NCTC11020 chromosome 1	1907984	1008562	1022081	1907984	capsid	Moraxella_phage(94.44%)	21	NA	NA
WP_063454201.1|1008562_1009459_-	DUF4393 domain-containing protein	NA	A0A0R6PH66	Moraxella_phage	78.7	7.4e-130
WP_063454200.1|1009510_1010161_-	helix-turn-helix transcriptional regulator	NA	A0A0R6PHA8	Moraxella_phage	98.6	2.6e-124
WP_080534137.1|1010141_1010324_+	helix-turn-helix domain-containing protein	NA	A0A0R6PKC6	Moraxella_phage	96.7	1.3e-28
WP_125903619.1|1010764_1011022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063454198.1|1011014_1011980_+|capsid	minor capsid protein	capsid	A0A0R6PH04	Moraxella_phage	48.3	2.5e-70
WP_063454197.1|1012055_1012790_+	hypothetical protein	NA	A0A0R6PK01	Moraxella_phage	92.3	5.3e-65
WP_063454196.1|1012792_1013746_+	hypothetical protein	NA	A0A0R6PJX4	Moraxella_phage	99.7	1.7e-177
WP_003658164.1|1013755_1013998_+	hypothetical protein	NA	A0A0R6PK16	Moraxella_phage	98.8	1.6e-39
WP_063454195.1|1014054_1014408_+	hypothetical protein	NA	A0A0R6PK23	Moraxella_phage	86.6	4.0e-47
WP_063454194.1|1014409_1014766_+	hypothetical protein	NA	A0A0R6PH70	Moraxella_phage	94.9	4.3e-57
WP_063454193.1|1014765_1015113_+	HK97 gp10 family phage protein	NA	A0A0R6PHN4	Moraxella_phage	97.4	1.5e-62
WP_003669653.1|1015109_1015310_-	hypothetical protein	NA	A0A0R6PK05	Moraxella_phage	75.8	4.5e-19
WP_049166895.1|1015681_1016068_+	hypothetical protein	NA	A0A0R6PK03	Moraxella_phage	80.5	6.4e-54
WP_003661873.1|1016076_1016595_+	DUF2829 domain-containing protein	NA	A0A067ZJ48	Escherichia_phage	45.6	1.2e-28
WP_063454192.1|1016629_1017538_+	hypothetical protein	NA	A0A0R6PJY2	Moraxella_phage	99.3	2.7e-164
WP_063454191.1|1017818_1018280_+	hypothetical protein	NA	A0A0R6PKF1	Moraxella_phage	96.7	2.4e-76
WP_003665929.1|1018315_1018564_+	hypothetical protein	NA	A0A0R6PJS2	Moraxella_phage	98.8	1.8e-41
WP_051926237.1|1018645_1019341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051926236.1|1019342_1019828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003661679.1|1021099_1021282_+	hypothetical protein	NA	A0A0R6PDJ5	Moraxella_phage	100.0	7.7e-26
WP_063454190.1|1021244_1022081_+	hypothetical protein	NA	A0A0R6PI23	Moraxella_phage	98.6	1.0e-149
>prophage 5
NZ_LS483445	Moraxella catarrhalis strain NCTC11020 chromosome 1	1907984	1842361	1851732	1907984		Streptococcus_phage(33.33%)	9	NA	NA
WP_003657222.1|1842361_1843249_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	2.1e-07
WP_003663994.1|1843330_1844173_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_003657219.1|1844182_1845025_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	35.0	1.8e-37
WP_003657217.1|1845171_1845660_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003673421.1|1845656_1847456_-	polynucleotide adenylyltransferase PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	35.6	1.7e-24
WP_003660410.1|1847634_1847973_-	ComEA family DNA-binding protein	NA	A0A2P1N0L0	Streptomyces_phage	45.1	8.2e-05
WP_003671881.1|1847962_1848802_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_003657210.1|1848872_1849802_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	56.5	2.2e-84
WP_003660407.1|1850307_1851732_+	phosphomannomutase/phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	23.5	7.9e-09
