The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LR595691	Escherichia coli isolate EcMAD1 chromosome EcMAD	4747851	755367	780001	4747851	integrase,lysis	Enterobacteria_phage(46.88%)	40	748602:748616	778250:778264
748602:748616	attL	AAATTAATGAAAAAA	NA	NA	NA	NA
WP_000533646.1|755367_756438_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
WP_001303849.1|756415_756634_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545745.1|756673_756841_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_000120065.1|757083_757686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763365.1|757896_758118_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
WP_001395510.1|758216_758498_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_023148020.1|758508_758700_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.8e-26
WP_072126246.1|758672_758855_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
WP_001372450.1|758851_759532_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
WP_000100847.1|759528_760314_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|760319_760616_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000233576.1|760691_760898_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000210934.1|761406_762234_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_000389051.1|762230_762980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000858975.1|763102_763792_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|763896_764127_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182899.1|764196_764736_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_077249941.1|764732_765752_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.7e-109
WP_001372464.1|765748_766450_+	replication P family protein	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
WP_000145917.1|766446_766740_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000720581.1|767224_767785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000825400.1|767781_768234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072157016.1|768326_768428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001372486.1|768424_768880_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_000224914.1|768879_769050_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001372487.1|769042_769333_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
WP_001372483.1|769329_769692_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	1.5e-60
WP_000971068.1|769688_769829_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001204777.1|769914_770292_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000780581.1|770447_770972_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_000592543.1|771164_772124_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000839582.1|773393_773609_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_001372488.1|773608_774106_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.0	1.6e-89
WP_000092273.1|774102_774570_+|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
WP_001139678.1|774557_774710_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000079508.1|775061_775472_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_000105084.1|775528_775762_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_001372490.1|776150_776711_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.8	4.9e-87
WP_000239881.1|777601_778270_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
778250:778264	attR	TTTTTTCATTAATTT	NA	NA	NA	NA
WP_001753290.1|778669_780001_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
>prophage 2
NZ_LR595691	Escherichia coli isolate EcMAD1 chromosome EcMAD	4747851	862154	870924	4747851	integrase	Salmonella_phage(90.0%)	12	862100:862113	871242:871255
862100:862113	attL	AAAACAATAAGTTA	NA	NA	NA	NA
WP_001372563.1|862154_863207_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.4e-106
WP_001678408.1|863298_864243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001680871.1|864254_865133_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.4	1.7e-30
WP_000188448.1|865278_865500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460892.1|865532_866042_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000956192.1|866049_866346_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000996717.1|866463_866805_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244224.1|866872_867106_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000752610.1|867105_867333_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_001544405.1|867329_868187_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	9.5e-159
WP_001376443.1|868183_870577_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	93.7	0.0e+00
WP_001376441.1|870735_870924_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	95.2	2.0e-24
871242:871255	attR	TAACTTATTGTTTT	NA	NA	NA	NA
>prophage 3
NZ_LR595691	Escherichia coli isolate EcMAD1 chromosome EcMAD	4747851	1084602	1126600	4747851	transposase,integrase	Stx2-converting_phage(37.5%)	32	1084079:1084093	1090270:1090284
1084079:1084093	attL	CAGAAATTATTTTTT	NA	NA	NA	NA
WP_085947771.1|1084602_1085765_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000627409.1|1085867_1086359_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_000611856.1|1086355_1087342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279872.1|1087708_1088911_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
WP_042002566.1|1089097_1090915_-	hypothetical protein	NA	NA	NA	NA	NA
1090270:1090284	attR	CAGAAATTATTTTTT	NA	NA	NA	NA
WP_001303889.1|1092026_1092323_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_032141622.1|1092567_1092765_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000335695.1|1092983_1094417_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_032180014.1|1095237_1095801_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_001333439.1|1096475_1101434_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000622487.1|1101430_1102867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024167628.1|1102971_1103178_+	methyltransferase	NA	NA	NA	NA	NA
WP_000757210.1|1103346_1105236_-	enterotoxin	NA	NA	NA	NA	NA
WP_032180015.1|1105249_1106425_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_000192271.1|1106436_1108008_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_001544449.1|1108121_1108460_-	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000072197.1|1108708_1109533_+	aga operon transcriptional regulator AgaR	NA	NA	NA	NA	NA
WP_001335688.1|1109595_1110033_-	UxaA family hydrolase	NA	NA	NA	NA	NA
WP_032180018.1|1110114_1110750_-	UxaA family hydrolase	NA	NA	NA	NA	NA
WP_154761740.1|1110912_1111050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104976704.1|1111352_1112580_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	2.7e-170
WP_001295538.1|1113293_1114076_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000350265.1|1114381_1115302_+	ribokinase	NA	NA	NA	NA	NA
WP_000998346.1|1115329_1116646_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000107485.1|1116657_1117671_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_021566758.1|1118125_1118506_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	1.2e-65
WP_000612601.1|1118502_1118850_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	1.1e-60
WP_032180022.1|1118899_1120438_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	7.1e-298
WP_032262852.1|1122170_1122950_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.3e-138
WP_001505166.1|1123157_1123370_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000483766.1|1123725_1125072_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000608644.1|1125337_1126600_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
>prophage 4
NZ_LR595691	Escherichia coli isolate EcMAD1 chromosome EcMAD	4747851	1258063	1268841	4747851	integrase	Enterobacteria_phage(40.0%)	11	1259338:1259361	1270846:1270869
WP_000444487.1|1258063_1259314_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
1259338:1259361	attL	AACGGGCGTGTTATACGCCCGTTG	NA	NA	NA	NA
WP_000741339.1|1259427_1260570_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21929	Phage_21	99.7	8.1e-206
WP_000088653.1|1260559_1260796_-	excisionase	NA	NA	NA	NA	NA
WP_000488406.1|1260935_1261175_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_001678640.1|1261222_1261441_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	3.2e-34
WP_001678641.1|1261594_1262659_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	64.8	1.7e-133
WP_000149533.1|1262655_1262814_-	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
WP_001372461.1|1262810_1263491_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	5.1e-131
WP_072163463.1|1263487_1263799_-	recombinase	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	2.4e-43
WP_001753331.1|1263981_1264521_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
WP_000379042.1|1266885_1268841_+	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	28.6	7.5e-26
1270846:1270869	attR	CAACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 5
NZ_LR595691	Escherichia coli isolate EcMAD1 chromosome EcMAD	4747851	1672737	1692955	4747851	integrase,lysis	Escherichia_phage(30.77%)	23	1682874:1682887	1695239:1695252
WP_012578894.1|1672737_1672893_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	2.5e-17
WP_122083109.1|1672994_1673102_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_023147794.1|1673621_1674602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023147793.1|1674961_1675564_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	31.2	3.7e-08
WP_001678529.1|1675881_1677231_+	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	98.0	5.7e-259
WP_001678528.1|1677778_1678723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001373616.1|1678852_1679275_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	85.6	2.0e-61
WP_000054501.1|1679315_1680281_-	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	9.7e-59
WP_072163420.1|1680261_1680504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1680587_1680776_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083281.1|1680772_1680964_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_001372999.1|1681057_1683529_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
1682874:1682887	attL	GCGGCAATCAGCAT	NA	NA	NA	NA
WP_000005552.1|1683601_1683853_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000877001.1|1683887_1685168_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001360138.1|1685187_1685298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836058.1|1685355_1686375_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|1686386_1687601_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1687806_1688133_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1688267_1688609_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1688643_1689204_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1689206_1689917_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|1690024_1690330_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041556.1|1690528_1692955_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
1695239:1695252	attR	ATGCTGATTGCCGC	NA	NA	NA	NA
>prophage 6
NZ_LR595691	Escherichia coli isolate EcMAD1 chromosome EcMAD	4747851	2245927	2255369	4747851		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292773.1|2245927_2247064_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
WP_001374182.1|2247060_2249061_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001295429.1|2249185_2249647_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2249687_2250158_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2250204_2250924_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2250920_2252606_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2252827_2253559_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2253618_2253726_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2253706_2254438_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569361.1|2254442_2255369_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 7
NZ_LR595691	Escherichia coli isolate EcMAD1 chromosome EcMAD	4747851	2868242	2881425	4747851		Escherichia_phage(50.0%)	12	NA	NA
WP_001272924.1|2868242_2870804_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141340.1|2870909_2871566_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001297141.1|2871616_2872384_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|2872579_2873488_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|2873484_2874747_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|2874743_2875382_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136918.1|2875386_2876163_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104456.1|2876251_2877616_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|2877709_2878702_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|2878764_2879904_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|2880043_2880670_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001374723.1|2880663_2881425_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	2.0e-59
>prophage 8
NZ_LR595691	Escherichia coli isolate EcMAD1 chromosome EcMAD	4747851	4187056	4205575	4747851	integrase,tail,lysis	Enterobacteria_phage(25.0%)	22	4189799:4189845	4205687:4205733
WP_000580417.1|4187056_4188430_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|4188426_4189125_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|4189274_4189775_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4189799:4189845	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000023386.1|4189960_4190941_-|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	99.7	2.3e-185
WP_001192857.1|4191010_4191304_-	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000453534.1|4191456_4191729_+	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_024210514.1|4191704_4191902_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	96.9	1.8e-28
WP_000217670.1|4191898_4192399_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001600138.1|4192995_4193448_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.7	1.4e-79
WP_000554771.1|4193447_4193654_+	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	97.0	2.4e-31
WP_001143634.1|4193896_4194835_+	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	100.0	3.1e-187
WP_001350076.1|4194831_4195857_-	hypothetical protein	NA	Q7Y4B4	Escherichia_virus	100.0	3.3e-198
WP_000368931.1|4195861_4196935_-	ParB N-terminal domain-containing protein	NA	Q7Y4B3	Escherichia_virus	100.0	1.2e-203
WP_060621267.1|4198224_4198650_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	92.9	3.4e-56
WP_000040662.1|4198637_4199063_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	5.5e-67
WP_000917174.1|4199170_4199638_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	1.9e-81
WP_001695629.1|4199630_4200083_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	5.3e-76
WP_060621266.1|4200154_4200940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060621264.1|4201463_4202465_+	hypothetical protein	NA	A0A0C4UQV0	Shigella_phage	91.7	1.2e-176
WP_000972099.1|4202466_4202994_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	88.6	5.1e-86
WP_000014361.1|4203209_4204109_+	hypothetical protein	NA	Q7Y4D2	Escherichia_virus	99.7	4.0e-168
WP_000468308.1|4205356_4205575_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
4205687:4205733	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
>prophage 9
NZ_LR595691	Escherichia coli isolate EcMAD1 chromosome EcMAD	4747851	4622275	4628834	4747851	transposase	Rhizobium_phage(16.67%)	7	NA	NA
WP_000594911.1|4622275_4623100_+	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
WP_000227281.1|4623148_4623721_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000747102.1|4623821_4624172_+|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_001254876.1|4624091_4625243_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
WP_000177060.1|4626294_4626552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|4627109_4627877_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|4627877_4628834_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
>prophage 1
NZ_LR595692	Escherichia coli isolate EcMAD1 plasmid pEcMAD1	98473	2396	48868	98473	integrase,transposase	Escherichia_phage(44.44%)	43	25486:25502	56723:56739
WP_001067855.1|2396_3101_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014837927.1|3137_4265_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000248278.1|4315_4543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|4566_4758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|5239_5782_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|5794_6655_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067858.1|8769_9474_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000027057.1|9911_10772_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|11358_12063_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|12464_13478_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|13635_14109_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|14239_15028_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|15233_15581_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|15574_16414_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|16541_16745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|17319_18024_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000428546.1|18157_18751_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001089068.1|18863_20069_-	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_000088605.1|20150_20774_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_086258557.1|21625_21820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001072355.1|22015_23185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042065278.1|24327_24510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066942.1|24630_25371_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
25486:25502	attL	CAGCAGCAGGTTACGGG	NA	NA	NA	NA
WP_000361610.1|25655_26633_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_001513660.1|27765_28125_-	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513661.1|28152_28332_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001216034.1|28336_28717_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001190712.1|28716_28938_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001553856.1|29120_30677_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	7.1e-104
WP_001617890.1|30673_31957_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.5	2.2e-10
WP_031311986.1|32078_35195_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	2.9e-27
WP_000991832.1|36242_37175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246636.1|37178_38174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000350635.1|38638_40777_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044768.1|40938_41355_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261287.1|41351_41582_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_023909028.1|41888_45008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000545983.1|45270_46404_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000642771.1|46423_46708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000215657.1|46704_46902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023909027.1|47535_47754_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|47755_48061_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016982.1|48061_48868_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
56723:56739	attR	CCCGTAACCTGCTGCTG	NA	NA	NA	NA
