The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LR698978	Listeria monocytogenes isolate MGYG-HGUT-02325 chromosome 1	3017944	121861	128388	3017944	tail	Listeria_phage(33.33%)	10	NA	NA
WP_003728215.1|121861_122314_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
WP_003721740.1|122319_122655_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_009927883.1|122871_123300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731177.1|123311_123728_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	37.9	6.5e-20
WP_003728212.1|124007_124397_+	DUF5072 family protein	NA	NA	NA	NA	NA
WP_003721744.1|124409_124922_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_003721745.1|124969_125272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003740367.1|125313_125718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009928420.1|125704_127573_+	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	4.5e-20
WP_003734720.1|127569_128388_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	7.2e-39
>prophage 2
NZ_LR698978	Listeria monocytogenes isolate MGYG-HGUT-02325 chromosome 1	3017944	679692	736098	3017944	head,capsid,holin,transposase,tail,protease,integrase,portal,terminase	Listeria_phage(50.0%)	69	672398:672415	733846:733863
672398:672415	attL	AGCCTTCTAAATCATTTT	NA	NA	NA	NA
WP_012951296.1|679692_680844_-|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	46.3	3.4e-87
WP_012951297.1|680865_681579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951298.1|681633_682134_-	hypothetical protein	NA	A0A1S7FYX8	Listeria_phage	31.9	1.4e-13
WP_012951299.1|682146_682473_-	helix-turn-helix transcriptional regulator	NA	Q0H244	Geobacillus_phage	47.1	1.6e-13
WP_012951300.1|682646_682838_+	helix-turn-helix transcriptional regulator	NA	Q0H243	Geobacillus_phage	57.6	6.2e-10
WP_012951301.1|682936_683263_+	DUF771 domain-containing protein	NA	A0A2H4J474	uncultured_Caudovirales_phage	41.1	4.9e-15
WP_012951302.1|683435_684350_+	conserved phage C-terminal domain-containing protein	NA	A0A1W6JNI1	Staphylococcus_phage	52.3	1.0e-54
WP_012951303.1|684351_684708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951304.1|684704_685121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951305.1|685117_685294_+	hypothetical protein	NA	A8ATL8	Listeria_phage	69.0	1.7e-14
WP_012951306.1|685307_685832_+	hypothetical protein	NA	A0A059T5F9	Listeria_phage	97.7	1.8e-96
WP_012951307.1|685840_686305_+	class I SAM-dependent methyltransferase	NA	A0A059T693	Listeria_phage	96.8	5.3e-87
WP_012951308.1|686301_687015_+	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	97.9	4.5e-130
WP_012951309.1|687025_687970_+|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	95.9	1.2e-173
WP_003762551.1|687982_688663_+	hypothetical protein	NA	A8ATD7	Listeria_phage	90.7	7.9e-116
WP_012951310.1|688659_688875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951311.1|688871_689255_+	hypothetical protein	NA	A8ATZ3	Listeria_phage	78.7	4.9e-46
WP_012951312.1|689276_689525_+	DUF3850 domain-containing protein	NA	A0A059T699	Listeria_phage	85.3	6.6e-28
WP_012951313.1|689524_690106_+	DUF3310 domain-containing protein	NA	A0A059T5J6	Listeria_phage	76.3	5.2e-76
WP_012951314.1|690105_690585_+	single-stranded DNA-binding protein	NA	A8ASP5	Listeria_phage	77.5	2.9e-64
WP_012951315.1|690638_690830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951316.1|690890_691409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951317.1|691405_691948_+|integrase	tyrosine-type recombinase/integrase	integrase	H0USV4	Bacillus_phage	53.3	4.3e-48
WP_012951318.1|692229_692457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102578311.1|692482_692758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049961585.1|692754_693117_+	HNH endonuclease	NA	A0A075M5R4	Enterococcus_phage	44.1	3.5e-14
WP_012951321.1|693211_693739_+|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	46.7	6.1e-31
WP_012951322.1|693707_695459_+|terminase	terminase large subunit	terminase	A0A2H4JCI4	uncultured_Caudovirales_phage	50.7	4.1e-156
WP_023552290.1|695465_695666_+	DUF1056 family protein	NA	NA	NA	NA	NA
WP_012951323.1|695668_696904_+|portal	phage portal protein	portal	A0A2H4JAR2	uncultured_Caudovirales_phage	42.1	3.6e-82
WP_012951324.1|696900_697467_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1D6Z2A7	Staphylococcus_phage	52.2	1.0e-44
WP_012951325.1|697530_698700_+|capsid	phage major capsid protein	capsid	A0A060AI54	Enterococcus_phage	38.1	2.1e-44
WP_012951326.1|698748_699087_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	37.8	8.1e-13
WP_012951327.1|699056_699377_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_012951328.1|699370_699736_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_012951329.1|699738_700137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951330.1|700157_700733_+|tail	major tail protein	tail	M1PRQ7	Streptococcus_phage	42.4	1.2e-32
WP_012951331.1|700822_701170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951333.1|701366_705566_+|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	33.0	1.2e-12
WP_012951334.1|705558_707802_+|tail	phage tail family protein	tail	A0A059T682	Listeria_phage	29.4	1.6e-56
WP_031641434.1|707807_710099_+|tail	phage tail protein	tail	A0A059T7Y6	Listeria_phage	38.1	3.4e-134
WP_031641433.1|710091_711153_+	hypothetical protein	NA	A8ATW1	Listeria_phage	68.6	1.6e-94
WP_003722523.1|711191_711557_+	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_003722522.1|711569_711851_+|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
WP_012951337.1|711850_712696_+	M15 family metallopeptidase	NA	A0A059T7Y8	Listeria_phage	93.3	4.8e-139
WP_023550359.1|713548_714220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003724379.1|714249_714435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003724380.1|714975_715509_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_014929420.1|715572_716490_+	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_021496183.1|716755_718636_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.1	8.3e-107
WP_003724383.1|718730_719459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003724384.1|719598_720249_+	TalA family protein	NA	M4SLG0	Cyanophage	29.3	1.7e-14
WP_003740476.1|720291_722112_-	lipoteichoic acid primase LtaP	NA	W6LM83	Streptococcus_phage	28.7	7.7e-49
WP_003727231.1|722346_723738_+	amino acid permease	NA	NA	NA	NA	NA
WP_009928457.1|723827_724667_+	VOC family protein	NA	NA	NA	NA	NA
WP_003721764.1|724749_725034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003724388.1|725131_726082_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003724389.1|726105_726747_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003727229.1|726789_729480_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_003731019.1|729525_730173_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003731020.1|730182_730719_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003740477.1|730705_731698_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_003721771.1|731888_732098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003727224.1|732165_732873_+	serine/threonine protein phosphatase	NA	A0A249Y183	Enterococcus_phage	28.2	1.3e-20
WP_003724396.1|732918_733482_-	DUF420 domain-containing protein	NA	NA	NA	NA	NA
WP_003724397.1|733601_734018_+	hypothetical protein	NA	NA	NA	NA	NA
733846:733863	attR	AAAATGATTTAGAAGGCT	NA	NA	NA	NA
WP_009928463.1|734060_734690_+	endonuclease III domain-containing protein	NA	NA	NA	NA	NA
WP_023550362.1|734686_735583_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003724400.1|735816_736098_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_LR698978	Listeria monocytogenes isolate MGYG-HGUT-02325 chromosome 1	3017944	1151988	1159411	3017944		Hokovirus(33.33%)	8	NA	NA
WP_003730941.1|1151988_1152372_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
WP_003727002.1|1152393_1153377_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.8	2.0e-11
WP_023550414.1|1153391_1154405_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.2	1.8e-10
WP_003721509.1|1154613_1156104_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_023550416.1|1156115_1156940_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.2	1.3e-67
WP_009929872.1|1156952_1157261_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_009929871.1|1157321_1157726_+	PTS lactose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_023550418.1|1157854_1159411_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.2	6.0e-18
>prophage 4
NZ_LR698978	Listeria monocytogenes isolate MGYG-HGUT-02325 chromosome 1	3017944	1279572	1365308	3017944	capsid,holin,tRNA,tail,protease,integrase,portal,terminase	Listeria_phage(84.85%)	106	1280990:1281013	1326857:1326880
WP_009928777.1|1279572_1280184_+	XTP/dITP diphosphatase	NA	Q66YC8	Euphorbia_ringspot_virus	28.0	8.7e-05
WP_003726034.1|1280220_1280745_+	metallophosphoesterase	NA	NA	NA	NA	NA
1280990:1281013	attL	TGAATGTTTTAGAGATTTTTTTAT	NA	NA	NA	NA
WP_025370561.1|1281030_1282185_-|integrase	site-specific integrase	integrase	A0A059T688	Listeria_phage	98.2	9.7e-215
WP_012951517.1|1282330_1282987_-	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_025370563.1|1283038_1283491_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	96.7	1.7e-82
WP_025370564.1|1283507_1283831_-	helix-turn-helix transcriptional regulator	NA	A0A059T6G1	Listeria_phage	71.0	5.5e-35
WP_025370565.1|1284289_1284607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025370566.1|1284672_1284996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003730994.1|1285143_1285347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009929536.1|1285413_1285617_+	helix-turn-helix transcriptional regulator	NA	A0A059T5F8	Listeria_phage	100.0	3.1e-28
WP_015987310.1|1285618_1285861_+	hypothetical protein	NA	A8ATD2	Listeria_phage	100.0	1.4e-43
WP_023548967.1|1285863_1286049_+	hypothetical protein	NA	A0A059T7Z3	Listeria_phage	98.4	4.4e-29
WP_009929542.1|1286283_1286436_+	hypothetical protein	NA	A8ATD4	Listeria_phage	100.0	1.5e-19
WP_009929543.1|1286572_1287286_+	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	98.7	2.4e-131
WP_031672381.1|1287296_1288241_+|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	97.5	2.1e-175
WP_070215402.1|1288253_1288934_+	hypothetical protein	NA	A8ATD7	Listeria_phage	96.5	1.4e-120
WP_088813762.1|1288930_1289491_+	DUF1642 domain-containing protein	NA	Q8W5X2	Listeria_phage	42.3	4.2e-30
WP_070216517.1|1289490_1289775_+	hypothetical protein	NA	A0A059T7S7	Listeria_phage	100.0	1.9e-47
WP_088813764.1|1289774_1289954_+	hypothetical protein	NA	A8ATT5	Listeria_phage	56.9	6.0e-15
WP_088813765.1|1290230_1290785_+	hypothetical protein	NA	A8ATS5	Listeria_phage	63.6	2.3e-57
WP_088813767.1|1290784_1291411_+	DUF3310 domain-containing protein	NA	A0A059T5J6	Listeria_phage	69.3	1.6e-75
WP_088813769.1|1291407_1291842_+	hypothetical protein	NA	A8ATS7	Listeria_phage	55.6	3.1e-41
WP_069001958.1|1291853_1292075_+	hypothetical protein	NA	A8ATT0	Listeria_phage	52.9	1.5e-15
WP_088813771.1|1292071_1292530_+	hypothetical protein	NA	A8ATT1	Listeria_phage	82.4	3.6e-64
WP_088813773.1|1292529_1292895_+	hypothetical protein	NA	A0A059T6H8	Listeria_phage	79.7	1.1e-52
WP_069001953.1|1293307_1293568_+	hypothetical protein	NA	Q8W5W6	Listeria_phage	50.6	9.3e-17
WP_088813774.1|1293570_1293795_+	hypothetical protein	NA	A0A288TY32	Enterococcus_phage	51.4	4.9e-14
WP_009933642.1|1293791_1293965_+	hypothetical protein	NA	A0A059T5G3	Listeria_phage	100.0	5.2e-24
WP_031647169.1|1293961_1294345_+	hypothetical protein	NA	A0A059T6A2	Listeria_phage	100.0	1.9e-66
WP_014929535.1|1294346_1294826_+	siphovirus Gp157 family protein	NA	A0A059T803	Listeria_phage	100.0	5.4e-79
WP_003743935.1|1294838_1295528_+	AAA family ATPase	NA	A0A059T7T3	Listeria_phage	100.0	2.6e-130
WP_025370577.1|1295591_1296848_+	DEAD/DEAH box helicase	NA	Q8W5V9	Listeria_phage	95.2	3.6e-231
WP_025370578.1|1296872_1297358_+	DUF669 domain-containing protein	NA	A0A059T5G4	Listeria_phage	99.4	1.9e-87
WP_060586930.1|1297380_1299720_+	DNA primase	NA	A0A059T6A4	Listeria_phage	42.1	1.3e-144
WP_060586933.1|1300077_1300395_+	VRR-NUC domain-containing protein	NA	Q8W5V6	Listeria_phage	98.1	7.5e-53
WP_039389924.1|1300394_1300664_+	hypothetical protein	NA	W0GBM0	Listeria_phage	73.6	5.3e-15
WP_060586971.1|1300774_1301305_+	DUF3310 domain-containing protein	NA	A0A059T7T5	Listeria_phage	76.6	1.5e-74
WP_060586935.1|1301304_1301532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031647172.1|1301544_1301970_+	DUF722 domain-containing protein	NA	A0A059T6H4	Listeria_phage	98.6	6.7e-73
WP_009928013.1|1302201_1303101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026749920.1|1303360_1303687_+	hypothetical protein	NA	A0A059T5G5	Listeria_phage	98.1	8.3e-55
WP_009928009.1|1303686_1304001_+	HNH endonuclease	NA	A8ATF8	Listeria_phage	99.0	3.8e-57
WP_025370582.1|1304050_1304407_+|terminase	P27 family phage terminase small subunit	terminase	A0A059T7Y1	Listeria_phage	97.0	4.5e-46
WP_025370583.1|1304403_1306047_+|terminase	terminase large subunit	terminase	A0A059T7Q8	Listeria_phage	98.5	0.0e+00
WP_025370584.1|1306058_1307189_+|portal	phage portal protein	portal	A0A059T6F0	Listeria_phage	99.5	9.5e-215
WP_031645757.1|1307185_1307983_+|protease	Clp protease ClpP	protease	A0A059T5F2	Listeria_phage	100.0	2.8e-144
WP_014930913.1|1308009_1309161_+|capsid	phage major capsid protein	capsid	A0A059T678	Listeria_phage	100.0	6.3e-214
WP_162859696.1|1309167_1309338_+	hypothetical protein	NA	A0A059T7Y2	Listeria_phage	96.4	6.9e-21
WP_025370586.1|1309347_1309647_+	hypothetical protein	NA	A0A059T7R0	Listeria_phage	99.0	2.6e-47
WP_025370587.1|1309630_1309996_+	hypothetical protein	NA	A0A059T6F2	Listeria_phage	99.2	2.4e-63
WP_025370588.1|1309992_1310394_+	hypothetical protein	NA	A8ATA2	Listeria_phage	95.5	2.2e-65
WP_025370589.1|1310390_1310774_+	hypothetical protein	NA	A0A059T681	Listeria_phage	98.4	1.9e-66
WP_025370590.1|1310794_1311382_+|tail	phage tail protein	tail	A0A059T7Y4	Listeria_phage	99.0	1.3e-106
WP_025370591.1|1311452_1311785_+	hypothetical protein	NA	A0A059T7R2	Listeria_phage	97.3	8.7e-52
WP_009931626.1|1311835_1311997_+	hypothetical protein	NA	A0A059T6F4	Listeria_phage	98.0	4.3e-20
WP_088813776.1|1312000_1316920_+|tail	phage tail tape measure protein	tail	A0A059T5F4	Listeria_phage	94.6	0.0e+00
WP_025370593.1|1316912_1318562_+|tail	phage tail family protein	tail	A0A059T682	Listeria_phage	99.5	0.0e+00
WP_025370594.1|1318574_1320869_+|tail	phage tail protein	tail	A0A059T7Y6	Listeria_phage	98.7	0.0e+00
WP_025370595.1|1320858_1321950_+	hypothetical protein	NA	A0A059T7R4	Listeria_phage	91.8	1.1e-188
WP_003733957.1|1322000_1322306_+	hypothetical protein	NA	A0A059T5E6	Listeria_phage	100.0	1.8e-43
WP_003723294.1|1322305_1322587_+|holin	phage holin	holin	A8ATW3	Listeria_phage	100.0	3.0e-45
WP_025370596.1|1322586_1323294_+	M15 family metallopeptidase	NA	A8ATW4	Listeria_phage	97.9	1.0e-129
WP_025370597.1|1323441_1324143_+	DUF3800 domain-containing protein	NA	R4IBV1	Listeria_phage	97.8	6.4e-129
WP_014930932.1|1324621_1324855_+	hypothetical protein	NA	A8ATX0	Listeria_phage	94.8	2.3e-35
WP_031672409.1|1324851_1325043_+	hypothetical protein	NA	A8ATC6	Listeria_phage	98.4	1.7e-28
WP_003726037.1|1325735_1326209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009928186.1|1326314_1326677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026747284.1|1327345_1331035_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
1326857:1326880	attR	TGAATGTTTTAGAGATTTTTTTAT	NA	NA	NA	NA
WP_003726042.1|1331157_1332516_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
WP_003726043.1|1332558_1333152_-	YdeI/OmpD-associated family protein	NA	NA	NA	NA	NA
WP_003726044.1|1333288_1333696_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_003726045.1|1333860_1334460_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	41.0	1.3e-29
WP_009928848.1|1334491_1334752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023550481.1|1334875_1336288_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	4.9e-51
WP_003726048.1|1336312_1336576_+	DUF3116 family protein	NA	NA	NA	NA	NA
WP_003727535.1|1336743_1337220_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_003726050.1|1337257_1337503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726051.1|1337499_1338705_-	MFS transporter	NA	NA	NA	NA	NA
WP_003726052.1|1338909_1339569_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003726053.1|1339608_1339803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726054.1|1339869_1340718_-	YitT family protein	NA	NA	NA	NA	NA
WP_003723553.1|1341047_1341185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726055.1|1341335_1342049_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_014929571.1|1342079_1343726_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_003727531.1|1343744_1345229_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_003726723.1|1345346_1345808_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003726717.1|1345846_1346311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726718.1|1346499_1347414_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023550483.1|1347439_1348687_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.8	7.2e-107
WP_003726720.1|1348670_1349501_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	3.6e-46
WP_003734523.1|1349647_1350787_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003723563.1|1350866_1351262_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|1351412_1351628_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003727523.1|1351751_1352285_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003731300.1|1352300_1352966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003727521.1|1353227_1354166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723884.1|1354280_1355564_+	trigger factor	NA	NA	NA	NA	NA
WP_003723886.1|1355748_1357008_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_003726393.1|1357126_1357693_+	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_003726394.1|1357727_1358297_+	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003727520.1|1358398_1358941_+	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_003726396.1|1358950_1359814_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003727519.1|1359810_1360596_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	37.6	6.7e-26
WP_003727518.1|1360729_1361590_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003727517.1|1361862_1363941_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.5	5.4e-107
WP_003726401.1|1364003_1365308_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
>prophage 5
NZ_LR698978	Listeria monocytogenes isolate MGYG-HGUT-02325 chromosome 1	3017944	1897580	1905866	3017944		Synechococcus_phage(33.33%)	8	NA	NA
WP_003726209.1|1897580_1898147_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.4	8.3e-26
WP_003726210.1|1898143_1899193_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.4	3.2e-63
WP_003722245.1|1899211_1900639_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_009918191.1|1900623_1902843_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.8	6.5e-159
WP_003726212.1|1902835_1903519_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003722248.1|1903522_1903768_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003726214.1|1903779_1904493_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	2.0e-40
WP_003729814.1|1904573_1905866_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
>prophage 6
NZ_LR698978	Listeria monocytogenes isolate MGYG-HGUT-02325 chromosome 1	3017944	2432970	2475228	3017944	capsid,holin,plate,tail,integrase,portal,terminase	Listeria_phage(95.16%)	64	2430071:2430086	2467337:2467352
2430071:2430086	attL	TGCAAAAATCACTTTC	NA	NA	NA	NA
WP_003725136.1|2432970_2433204_-	hypothetical protein	NA	A8ATC5	Listeria_phage	92.2	1.2e-34
WP_023548524.1|2433601_2433769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088813803.1|2434033_2434879_-	M15 family metallopeptidase	NA	A0A059T7Y8	Listeria_phage	85.2	1.7e-131
WP_003722522.1|2434878_2435160_-|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
WP_003722523.1|2435172_2435538_-	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_003722524.1|2435565_2435724_-	hypothetical protein	NA	Q9T1A1	Listeria_phage	100.0	6.0e-19
WP_003722525.1|2435728_2436046_-	hypothetical protein	NA	Q9T1A2	Listeria_phage	100.0	6.2e-55
WP_088813804.1|2436057_2437131_-|plate	phage baseplate upper protein	plate	Q9T1A3	Listeria_phage	99.7	2.2e-197
WP_003722527.1|2437130_2438159_-	hypothetical protein	NA	Q9T1A4	Listeria_phage	100.0	4.6e-192
WP_003722528.1|2438159_2439185_-|tail	phage tail protein	tail	Q9T1A5	Listeria_phage	98.2	4.3e-198
WP_003722529.1|2439193_2440012_-|tail	phage tail family protein	tail	Q9T1A6	Listeria_phage	91.9	6.8e-146
WP_088813805.1|2440013_2445377_-	tape measure protein	NA	Q9T1A7	Listeria_phage	90.2	0.0e+00
WP_003722531.1|2445387_2445993_-	hypothetical protein	NA	Q9T1A8	Listeria_phage	100.0	1.3e-109
WP_088813807.1|2445998_2446421_-|tail	phage tail assembly chaperone	tail	Q9T1A9	Listeria_phage	99.3	1.2e-69
WP_088813809.1|2446475_2446808_-	Ig-like domain-containing protein	NA	Q9T1B0	Listeria_phage	98.2	6.9e-49
WP_088813810.1|2446737_2447172_-|tail	phage tail protein	tail	Q9T1B1	Listeria_phage	97.2	8.7e-76
WP_003737937.1|2447174_2447582_-	hypothetical protein	NA	A8ASK1	Listeria_phage	99.3	2.0e-66
WP_029508830.1|2447581_2447920_-	hypothetical protein	NA	A0A0B5CTV8	Listeria_phage	95.5	5.4e-57
WP_088813812.1|2447919_2448282_-|capsid	minor capsid protein	capsid	A8ASJ9	Listeria_phage	90.8	2.3e-58
WP_010989952.1|2448281_2448677_-	hypothetical protein	NA	A0A059T5E3	Listeria_phage	97.7	4.8e-65
WP_046811263.1|2448695_2449697_-	hypothetical protein	NA	A0A059T6D4	Listeria_phage	99.4	8.2e-186
WP_014601084.1|2449696_2450287_-	phage scaffolding protein	NA	Q9T1B8	Listeria_phage	91.5	7.7e-75
WP_039393322.1|2450365_2451505_-|capsid	phage minor capsid protein	capsid	A0A0B5D147	Listeria_phage	96.8	4.9e-203
WP_014601086.1|2451510_2453001_-|portal	phage portal protein	portal	Q9T1C0	Listeria_phage	99.6	3.3e-284
WP_010990214.1|2453013_2454345_-|terminase	PBSX family phage terminase large subunit	terminase	A8ASJ2	Listeria_phage	98.6	1.1e-259
WP_010990213.1|2454313_2454856_-|terminase	terminase small subunit	terminase	A8ASJ1	Listeria_phage	98.9	5.4e-91
WP_010990212.1|2454913_2455177_-	hypothetical protein	NA	A0A0S2MYE7	Enterococcus_phage	78.2	1.7e-34
WP_009911405.1|2455203_2455503_-	phage protein	NA	A0A2H4JBC0	uncultured_Caudovirales_phage	40.7	3.8e-14
WP_003735131.1|2455897_2456332_-	hypothetical protein	NA	A8ASQ1	Listeria_phage	99.3	4.3e-75
WP_015967177.1|2456350_2456515_-	hypothetical protein	NA	A8AU02	Listeria_phage	100.0	3.9e-21
WP_088813814.1|2456643_2457027_-	DUF2481 family protein	NA	A8ASP8	Listeria_phage	93.7	2.4e-61
WP_088813815.1|2457030_2457435_-	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	87.3	1.1e-59
WP_088813817.1|2457379_2457562_-	hypothetical protein	NA	A8ASP6	Listeria_phage	81.0	2.9e-17
WP_088813818.1|2457580_2458063_-	single-stranded DNA-binding protein	NA	A8ASP5	Listeria_phage	91.9	5.1e-77
WP_070243068.1|2458556_2458835_-	DUF1642 domain-containing protein	NA	R4IBV9	Listeria_phage	54.4	3.3e-20
WP_070210907.1|2458846_2459074_-	DUF3850 domain-containing protein	NA	A0A059T7N3	Listeria_phage	96.0	1.1e-34
WP_070243069.1|2459095_2459479_-	hypothetical protein	NA	A8ATZ3	Listeria_phage	89.8	1.7e-54
WP_088813819.1|2459475_2460000_-	hypothetical protein	NA	A0A059T7V5	Listeria_phage	48.0	2.5e-32
WP_031670092.1|2459996_2460545_-	DUF1642 domain-containing protein	NA	A0A059T7S4	Listeria_phage	75.3	3.7e-71
WP_023548471.1|2460541_2461222_-	hypothetical protein	NA	A8ATD7	Listeria_phage	97.8	3.3e-122
WP_031644274.1|2461234_2462179_-|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	98.4	4.5e-178
WP_031690742.1|2462189_2462903_-	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	97.9	7.7e-130
WP_031644200.1|2462899_2463832_-	DnaD domain-containing protein	NA	A8ATY7	Listeria_phage	89.3	2.6e-149
WP_031644198.1|2463851_2464667_-	recombinase RecT	NA	Q9T172	Listeria_phage	94.8	1.7e-144
WP_031644196.1|2464669_2465629_-	YqaJ viral recombinase family protein	NA	Q9T173	Listeria_phage	83.1	8.7e-153
WP_031644195.1|2465860_2466049_-	hypothetical protein	NA	A8ATY3	Listeria_phage	98.4	1.3e-28
WP_031644193.1|2466156_2466372_-	hypothetical protein	NA	Q9T176	Listeria_phage	87.3	1.8e-26
WP_031644191.1|2466364_2466901_-	hypothetical protein	NA	Q9T177	Listeria_phage	88.1	7.2e-80
WP_025370647.1|2467864_2468107_+	hypothetical protein	NA	A0A059T7Q3	Listeria_phage	98.8	1.5e-37
2467337:2467352	attR	TGCAAAAATCACTTTC	NA	NA	NA	NA
WP_003727748.1|2468099_2468261_-	hypothetical protein	NA	A0A059T7X7	Listeria_phage	98.1	1.2e-19
WP_003769995.1|2468292_2468574_-	hypothetical protein	NA	Q9T180	Listeria_phage	96.8	1.4e-39
WP_003733634.1|2468570_2468807_-	hypothetical protein	NA	A0A059T5E9	Listeria_phage	100.0	3.3e-37
WP_003769996.1|2468846_2469131_-	hypothetical protein	NA	A0A0B5D168	Listeria_phage	98.9	1.6e-46
WP_088813821.1|2469142_2469337_-	hypothetical protein	NA	A0A059T6E5	Listeria_phage	98.4	3.7e-26
WP_003727743.1|2469560_2469827_-	hypothetical protein	NA	A0A059T7Q1	Listeria_phage	100.0	2.5e-41
WP_003731220.1|2469830_2470082_-	helix-turn-helix transcriptional regulator	NA	A8ATX6	Listeria_phage	100.0	7.6e-40
WP_009911345.1|2470230_2470539_+	helix-turn-helix transcriptional regulator	NA	A8ATX5	Listeria_phage	98.0	7.8e-47
WP_009911346.1|2470569_2471061_+	bacteriophage gp35-type protein	NA	A8ATX4	Listeria_phage	98.8	1.1e-90
WP_025370648.1|2471083_2471302_+	zinc-ribbon domain-containing protein	NA	A0A059T6E3	Listeria_phage	97.2	1.3e-32
WP_003770013.1|2471317_2472040_+	hypothetical protein	NA	A0A059T7P9	Listeria_phage	84.6	7.4e-88
WP_003770015.1|2472061_2472937_+	hypothetical protein	NA	A0A0B5D0D1	Listeria_phage	94.5	2.2e-150
WP_009911646.1|2473000_2474359_+	recombinase family protein	NA	Q8LTD8	Listeria_phage	97.1	2.0e-251
WP_031644186.1|2474349_2474826_+	competence protein ComK	NA	NA	NA	NA	NA
WP_003739618.1|2474880_2475228_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	40.7	9.9e-06
>prophage 7
NZ_LR698978	Listeria monocytogenes isolate MGYG-HGUT-02325 chromosome 1	3017944	2619551	2627393	3017944		Streptococcus_phage(50.0%)	7	NA	NA
WP_003725407.1|2619551_2620523_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_003731212.1|2620530_2621499_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.6	1.8e-68
WP_003722606.1|2621500_2622376_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_009927825.1|2622483_2624214_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.1	2.1e-173
WP_009918600.1|2624255_2625317_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_009918601.1|2625333_2626317_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	3.1e-52
WP_003722610.1|2626433_2627393_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
