The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LR698990	Bifidobacterium adolescentis isolate MGYG-HGUT-02395 chromosome 1	2173720	736214	802553	2173720	integrase,tRNA,protease,transposase	Planktothrix_phage(18.75%)	52	751032:751048	801904:801920
WP_039774938.1|736214_738809_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CXH0	Yersinia_phage	39.3	6.1e-132
WP_039774940.1|739003_740431_-	DUF349 domain-containing protein	NA	NA	NA	NA	NA
WP_011743016.1|740545_741937_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	30.1	6.5e-32
WP_003808714.1|741984_743784_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_033499166.1|743933_745484_+	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_003808719.1|745480_746221_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.9	2.7e-24
WP_172620212.1|746393_747152_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.8	1.8e-31
WP_011743019.1|747218_748031_+	glutamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011743020.1|748030_748708_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003808726.1|748714_749842_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_021913921.1|749960_750962_+	polyphosphate:nucleotide phosphotransferase PPK2 family	NA	NA	NA	NA	NA
WP_038445364.1|750943_753502_-	DEAD/DEAH box helicase	NA	M1HM79	Paramecium_bursaria_Chlorella_virus	34.4	8.3e-49
751032:751048	attL	TGGTCGCCATCGGAATC	NA	NA	NA	NA
WP_003808733.1|753585_754986_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	42.8	1.1e-84
WP_039776142.1|755187_756636_+	MFS transporter	NA	NA	NA	NA	NA
WP_011743024.1|756741_757362_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	43.6	2.8e-43
WP_011743025.1|757364_758066_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	43.6	1.3e-36
WP_039774942.1|758170_759484_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	50.3	5.6e-110
WP_003808746.1|759949_761314_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	34.5	3.0e-45
WP_003808749.1|761409_762081_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_039774944.1|762082_763000_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_039774945.1|763058_764915_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_039774946.1|764983_766288_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003808757.1|766284_767814_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_003808759.1|767813_768266_-	YraN family protein	NA	NA	NA	NA	NA
WP_003808760.1|768435_769311_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003808765.1|769641_770952_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	25.2	9.9e-14
WP_039774947.1|771185_771737_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_011743034.1|771894_773520_+	energy-coupling factor ABC transporter ATP-binding protein	NA	M1I1A6	Acanthocystis_turfacea_Chlorella_virus	26.6	2.1e-13
WP_033499155.1|773519_774332_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_039774948.1|774341_775361_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021913905.1|775534_776326_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.2	2.1e-35
WP_039774949.1|776367_779010_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_039774950.1|779183_779933_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_039774951.1|780009_782619_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_039774952.1|782796_784140_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_039774953.1|784184_784985_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_039774954.1|785002_786097_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_003826607.1|786343_786709_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_039774955.1|786897_787083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039774956.1|787313_789365_+	DHA2 family efflux MFS transporter permease subunit	NA	A0A2H4PQR6	Staphylococcus_phage	26.4	2.0e-05
WP_117320340.1|790553_790874_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_052252655.1|791002_793006_+	ferrous iron transport protein B	NA	NA	NA	NA	NA
WP_080755270.1|792999_793344_+	peptidase	NA	NA	NA	NA	NA
WP_003808852.1|793391_794216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003808854.1|794330_795278_+	DMT family transporter	NA	NA	NA	NA	NA
WP_033499379.1|795274_796339_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_039774959.1|796516_797431_+	DUF362 domain-containing protein	NA	NA	NA	NA	NA
WP_003808860.1|797442_798063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003808861.1|798108_798699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033499138.1|798819_799659_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_035009793.1|800031_800958_-|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	49.0	2.7e-82
WP_039774960.1|801368_802553_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	33.9	1.2e-55
801904:801920	attR	TGGTCGCCATCGGAATC	NA	NA	NA	NA
>prophage 2
NZ_LR698990	Bifidobacterium adolescentis isolate MGYG-HGUT-02395 chromosome 1	2173720	894403	933089	2173720	terminase,integrase,tail,capsid,head,holin	Bifidobacterium_phage(52.38%)	51	894271:894307	932621:932657
894271:894307	attL	AGCAGAATGTCGCAGGTTCAAATCCTGTCAGCCCGAC	NA	NA	NA	NA
WP_162182096.1|894403_895684_-|integrase	site-specific integrase	integrase	A0A1W6JRD7	Corynebacterium_phage	30.9	1.1e-38
WP_117320374.1|895840_896224_-	ImmA/IrrE family metallo-endopeptidase	NA	I3NLD5	Bifidobacterium_phage	75.6	2.2e-51
WP_080755272.1|896427_897678_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	27.0	2.6e-24
WP_118331923.1|897869_898088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039774993.1|898404_898668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039774994.1|898687_899143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039774995.1|899386_900157_+	phage antirepressor KilAC domain-containing protein	NA	A0A0C5AEJ9	Bacteriophage	51.6	3.2e-65
WP_039774996.1|900156_900477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039774997.1|900400_901078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117779717.1|901246_901444_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_039774999.1|901440_901629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039775000.1|901628_901844_+	hypothetical protein	NA	I3NLC6	Bifidobacterium_phage	92.0	2.0e-17
WP_039775001.1|901840_902077_+	hypothetical protein	NA	I3NLC5	Bifidobacterium_phage	96.1	3.1e-35
WP_039775002.1|902369_902714_+	hypothetical protein	NA	I3NLC4	Bifidobacterium_phage	90.4	9.7e-54
WP_039775003.1|902713_903247_+	single-stranded DNA-binding protein	NA	I3NLC3	Bifidobacterium_phage	76.4	1.5e-66
WP_039775004.1|903262_904657_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	71.7	3.8e-189
WP_039775005.1|904653_905559_+	helix-turn-helix domain-containing protein	NA	I3NLC1	Bifidobacterium_phage	64.6	1.7e-102
WP_039775006.1|905555_905747_+	hypothetical protein	NA	I3NLC0	Bifidobacterium_phage	92.1	2.6e-24
WP_039775007.1|905743_906148_+	hypothetical protein	NA	I3NLB9	Bifidobacterium_phage	91.8	1.2e-76
WP_039775008.1|906144_906723_+	oligoribonuclease	NA	I3NLB8	Bifidobacterium_phage	89.5	4.4e-99
WP_039775009.1|906787_907039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039775010.1|907035_907293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052252660.1|907289_907562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039775011.1|907558_907978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039776168.1|907980_908112_+	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_147538198.1|908183_909044_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_039775013.1|909581_909911_+	HNH endonuclease	NA	M1PFG7	Streptococcus_phage	54.7	4.5e-16
WP_039775014.1|910044_910473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039775015.1|910450_911884_+|terminase	terminase	terminase	V5R8Y1	Arthrobacter_phage	41.8	6.0e-97
WP_052252661.1|913338_914730_+	hypothetical protein	NA	A0A1D8ETG0	Propionibacterium_phage	39.7	2.1e-14
WP_039775016.1|914726_914981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162182097.1|915228_915759_+	DUF4355 domain-containing protein	NA	A0A2R4AQA8	Mycobacterium_phage	36.3	7.0e-11
WP_039775017.1|915780_916662_+|capsid	phage major capsid protein	capsid	A0A2H4PEV4	Gordonia_phage	36.1	2.3e-38
WP_052252665.1|916670_917030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039775018.1|917032_917431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039775020.1|917430_917754_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_039775021.1|917756_917993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039775022.1|917989_918388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052252667.1|918443_919064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039775023.1|919147_919528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039775025.1|919674_919875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039775026.1|919919_922928_+	tape measure protein	NA	A0A1D8EU70	Propionibacterium_phage	38.8	6.1e-43
WP_039775027.1|922914_923742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039775029.1|926836_927079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039775030.1|927081_927879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052252673.1|929146_929413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172620197.1|929455_930328_-|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	26.6	2.5e-05
WP_039775033.1|930411_930723_+	hypothetical protein	NA	I3NL84	Bifidobacterium_phage	54.0	1.1e-08
WP_039776185.1|930828_932058_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_039775034.1|932123_932369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003809526.1|932723_933089_-|holin	phage holin family protein	holin	NA	NA	NA	NA
932621:932657	attR	AGCAGAATGTCGCAGGTTCAAATCCTGTCAGCCCGAC	NA	NA	NA	NA
>prophage 3
NZ_LR698990	Bifidobacterium adolescentis isolate MGYG-HGUT-02395 chromosome 1	2173720	1847260	1861999	2173720	terminase,portal,capsid	Mycobacterium_phage(37.5%)	18	NA	NA
WP_052252734.1|1847260_1850680_-	tape measure protein	NA	Q938K3	Temperate_phage	37.9	7.4e-37
WP_052252736.1|1850710_1851073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039775780.1|1851111_1851381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039775783.1|1851503_1852088_-	hypothetical protein	NA	A0A0B5A550	Streptococcus_phage	39.0	2.6e-27
WP_147538257.1|1852098_1852422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039775787.1|1852490_1852736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039776353.1|1852728_1853073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039775789.1|1853075_1853492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080755303.1|1853496_1854552_-|capsid	phage major capsid protein	capsid	S5Y5B1	Mycobacterium_phage	55.3	2.3e-90
WP_039775791.1|1854570_1855083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162182102.1|1855184_1855946_-	hypothetical protein	NA	A0A1D8ETP7	Propionibacterium_phage	35.9	6.7e-31
WP_052252740.1|1855890_1857447_-|portal	phage portal protein	portal	A0A068F3B8	Mycobacterium_phage	40.7	1.0e-86
WP_080755326.1|1857443_1858814_-|terminase	terminase	terminase	A0A0H4IQH3	Propionibacterium_phage	42.4	1.6e-86
WP_039775794.1|1858884_1859244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052252745.1|1859537_1860167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080755304.1|1860156_1860849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052252747.1|1860845_1861193_-	hypothetical protein	NA	A0A0A0RKU9	Mycobacterium_phage	45.1	3.6e-16
WP_039775800.1|1861639_1861999_-	hypothetical protein	NA	V5R8P9	Arthrobacter_phage	37.0	6.4e-08
