The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 2
NZ_LR699010	Lachnoanaerobaculum umeaense isolate MGYG-HGUT-02522 chromosome 1	2810441	917469	927575	2810441	integrase	Bacillus_phage(33.33%)	8	918640:918660	920480:920500
WP_111525603.1|917469_918672_+	restriction endonuclease subunit S	NA	A0A1V0SLK8	Klosneuvirus	31.0	5.3e-22
918640:918660	attL	GGCGAACTTGATGTCTCAAAC	NA	NA	NA	NA
WP_111525602.1|918927_919911_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	28.6	1.5e-35
WP_111525601.1|919925_920471_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_111525600.1|920467_921061_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
920480:920500	attR	GTTTGAGACATCAAGTTCGCC	NA	NA	NA	NA
WP_111525599.1|921215_924365_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.9	1.2e-65
WP_111525598.1|924659_925844_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.6	1.2e-154
WP_111525597.1|925843_926875_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.8	6.3e-24
WP_111525596.1|926885_927575_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.7	2.0e-37
>prophage 3
NZ_LR699010	Lachnoanaerobaculum umeaense isolate MGYG-HGUT-02522 chromosome 1	2810441	1051927	1060091	2810441	integrase	Clostridium_phage(33.33%)	11	1051907:1051924	1060694:1060711
1051907:1051924	attL	TGATAATAAAATGATAAT	NA	NA	NA	NA
WP_111526138.1|1051927_1052986_-|integrase	site-specific integrase	integrase	Q8SBN2	Clostridium_phage	40.1	1.5e-68
WP_111526111.1|1053432_1054026_-	helix-turn-helix transcriptional regulator	NA	A0A139ZPI6	Marinitoga_camini_virus	28.8	1.6e-08
WP_111526112.1|1054187_1054382_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_111526115.1|1054499_1054691_+	hypothetical protein	NA	Q8SBM7	Clostridium_phage	49.1	6.4e-07
WP_111526113.1|1054703_1056902_+	DNA primase	NA	H9YQD3	environmental_Halophage	25.7	3.0e-15
WP_111526114.1|1057363_1057627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162902545.1|1057631_1057781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_119808260.1|1057783_1058128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162902539.1|1058099_1058273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111526123.1|1058819_1059221_+	phage scaffolding protein	NA	Q5YA71	Bacillus_phage	43.6	4.6e-07
WP_111526122.1|1059239_1060091_+	hypothetical protein	NA	A0A2H4JBI0	uncultured_Caudovirales_phage	47.5	1.1e-63
1060694:1060711	attR	TGATAATAAAATGATAAT	NA	NA	NA	NA
>prophage 4
NZ_LR699010	Lachnoanaerobaculum umeaense isolate MGYG-HGUT-02522 chromosome 1	2810441	1912757	2038600	2810441	capsid,transposase,plate,tRNA,portal,integrase,holin,tail,terminase,coat	Clostridium_phage(33.33%)	134	1988954:1988969	2017050:2017065
WP_111524652.1|1912757_1913255_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_111524651.1|1913251_1914412_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_111524650.1|1914408_1914891_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_111524649.1|1914862_1915465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524648.1|1915464_1917075_-	VanW family protein	NA	NA	NA	NA	NA
WP_111524647.1|1917290_1917998_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_111524646.1|1917994_1918624_-	endonuclease III	NA	NA	NA	NA	NA
WP_111524645.1|1918620_1919115_-	dCMP deaminase family protein	NA	G8DFT3	Emiliania_huxleyi_virus	57.6	3.5e-49
WP_111524644.1|1919122_1920211_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	37.3	1.5e-47
WP_111524643.1|1920211_1921207_-	exonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_111524642.1|1921251_1921557_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_111524641.1|1921564_1922701_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.6	9.2e-85
WP_119808288.1|1922708_1925099_-	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	31.6	2.7e-25
WP_111524639.1|1926193_1927585_-	thioether cross-link-forming SCIFF peptide maturase	NA	NA	NA	NA	NA
WP_007593215.1|1927663_1927810_-	six-cysteine peptide SCIFF	NA	NA	NA	NA	NA
WP_111524638.1|1927958_1930301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524637.1|1930305_1930671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524636.1|1930670_1932650_-	serine/threonine protein kinase	NA	A0A0H4Y184	Salmon_gill_poxvirus	32.6	9.0e-19
WP_111524635.1|1932660_1933419_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_111524634.1|1933422_1934766_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_111524633.1|1934775_1935834_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_111524632.1|1935843_1937136_-	WG repeat-containing protein	NA	NA	NA	NA	NA
WP_111524631.1|1937145_1937769_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_111524630.1|1937779_1939093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524629.1|1939196_1940048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524628.1|1940080_1943905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524627.1|1943910_1944597_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_111524626.1|1944625_1944856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524625.1|1944928_1945783_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_111524624.1|1945788_1946592_-	kinase	NA	NA	NA	NA	NA
WP_111524623.1|1946591_1947830_-	CpaF family protein	NA	NA	NA	NA	NA
WP_111524622.1|1948299_1949052_-	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
WP_111524621.1|1949303_1950221_-	cell surface protein	NA	H7BVE5	unidentified_phage	41.2	9.3e-27
WP_111524620.1|1950230_1950530_-	DUF4406 domain-containing protein	NA	NA	NA	NA	NA
WP_111524619.1|1950617_1951058_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_111524618.1|1951035_1951239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524617.1|1951342_1951786_-|holin	phage holin family protein	holin	A0A090D848	Clostridium_phage	45.9	1.1e-17
WP_162902567.1|1951866_1952013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524616.1|1952002_1952383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524615.1|1952392_1954093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524614.1|1954094_1954469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524613.1|1954476_1955022_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_111524612.1|1955014_1956082_-|plate	baseplate J/gp47 family protein	plate	A0A0A8WJT7	Clostridium_phage	45.8	2.2e-80
WP_111524611.1|1956081_1956477_-	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	54.3	3.3e-29
WP_111524610.1|1956481_1956781_-	DUF2577 domain-containing protein	NA	A0A0A8WJ65	Clostridium_phage	34.7	5.2e-11
WP_111524609.1|1956773_1957739_-	hydrolase	NA	H7BVH4	unidentified_phage	46.3	4.9e-79
WP_172621800.1|1957735_1958335_-	LysM peptidoglycan-binding domain-containing protein	NA	X5J9Z8	Clostridium_phage	44.7	1.5e-30
WP_111524607.1|1958406_1960374_-	tape measure protein	NA	H7BWD9	unidentified_phage	43.6	1.2e-95
WP_111524605.1|1960567_1960996_-|portal	phage portal protein	portal	X5JAB6	Clostridium_phage	50.7	6.4e-31
WP_111524604.1|1961011_1961488_-|tail	phage tail tube protein	tail	A0A0A8WJ62	Clostridium_phage	47.1	8.2e-35
WP_111524603.1|1961501_1962812_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	X5JAJ1	Clostridium_phage	50.8	9.6e-118
WP_162902568.1|1962811_1962985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524602.1|1962986_1963412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524601.1|1963398_1963845_-	HK97 gp10 family phage protein	NA	A0A0A8WFV8	Clostridium_phage	43.6	4.2e-25
WP_111524600.1|1963844_1964216_-	hypothetical protein	NA	X5JAV9	Clostridium_phage	47.9	1.2e-20
WP_111524599.1|1964209_1964626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524598.1|1964644_1965643_-|coat	coat protein	coat	A0A0A7RVZ1	Clostridium_phage	65.1	1.2e-112
WP_111524597.1|1965661_1966279_-	phage scaffolding protein	NA	A0A0A7S0J5	Clostridium_phage	50.2	2.4e-50
WP_162902569.1|1966417_1966579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524596.1|1966575_1968237_-|capsid	minor capsid protein	capsid	X5JAI9	Clostridium_phage	53.3	9.6e-107
WP_111524595.1|1968223_1969669_-|portal	phage portal protein	portal	A0A0A7S0I9	Clostridium_phage	49.5	8.0e-134
WP_111524594.1|1969680_1970964_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0S2MVC1	Bacillus_phage	61.9	1.3e-151
WP_111524593.1|1970947_1971355_-	hypothetical protein	NA	A0A1S5SEB0	Streptococcus_phage	35.6	4.1e-11
WP_111524592.1|1971410_1972037_-	DUF4417 domain-containing protein	NA	H7BVQ9	unidentified_phage	52.7	3.7e-59
WP_111524591.1|1972039_1972462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146246998.1|1972651_1973296_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_111524589.1|1973348_1973762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162902570.1|1973758_1973920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524588.1|1973906_1974158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524587.1|1974157_1974412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146246996.1|1974422_1974746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524585.1|1974732_1975032_-	hypothetical protein	NA	M4NJS1	Sulfitobacter_phage	44.7	1.1e-13
WP_146246995.1|1975028_1975274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162902571.1|1975243_1975396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524583.1|1975395_1975869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524582.1|1975865_1977236_-	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	55.6	4.5e-142
WP_111524581.1|1977216_1977498_-	VRR-NUC domain-containing protein	NA	A0A1W6JQA8	Corynebacterium_phage	51.1	2.3e-21
WP_111524580.1|1977756_1980141_-	virulence-associated protein E	NA	A0A0A7RTG3	Clostridium_phage	44.1	2.5e-196
WP_111524579.1|1980144_1982106_-	DNA polymerase	NA	H7BVQ1	unidentified_phage	54.4	4.2e-202
WP_111524578.1|1982102_1982741_-	DUF2815 family protein	NA	W8CPL2	Croceibacter_phage	45.8	4.6e-33
WP_111524577.1|1982733_1983894_-	DUF2800 domain-containing protein	NA	H7BVP9	unidentified_phage	44.7	5.2e-83
WP_111524576.1|1983893_1984262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524575.1|1984281_1984512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524574.1|1984499_1984952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524573.1|1984948_1985683_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_111524572.1|1985683_1985953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524571.1|1985963_1986188_-	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_119808291.1|1986285_1986510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111524569.1|1986472_1986718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524568.1|1986726_1987506_-	phage antirepressor KilAC domain-containing protein	NA	A0A2H4JCR9	uncultured_Caudovirales_phage	59.0	9.5e-73
WP_111524567.1|1987509_1987701_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_111524566.1|1987966_1988146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524565.1|1988159_1988357_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SDM7	Streptococcus_phage	44.3	3.2e-09
WP_111524564.1|1988565_1988985_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
1988954:1988969	attL	TAAAATATAATCCGAA	NA	NA	NA	NA
WP_146246994.1|1988990_1989398_+	ImmA/IrrE family metallo-endopeptidase	NA	S6B1N5	Thermus_phage	39.6	9.8e-13
WP_111524562.1|1989579_1989930_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1S5S7K2	Streptococcus_phage	47.0	1.9e-17
WP_162902574.1|1990092_1991064_+	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	54.8	5.1e-100
WP_111524560.1|1991436_1992534_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_119808251.1|1998930_2000319_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_111525870.1|2000508_2000913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111525868.1|2000995_2002288_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_111525867.1|2002389_2004723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111525866.1|2004998_2005571_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_111525865.1|2005632_2007072_-	DUF438 domain-containing protein	NA	NA	NA	NA	NA
WP_111525864.1|2007197_2007779_-	TerD family protein	NA	A0A2R2YB15	Pseudomonas_phage	31.1	8.8e-15
WP_111525863.1|2007891_2008251_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_111525862.1|2008297_2008615_-	HIRAN domain-containing protein	NA	NA	NA	NA	NA
WP_111525861.1|2008702_2009692_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_111525860.1|2010105_2010846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_111525859.1|2011060_2011789_-	NAD-dependent protein deacylase	NA	S5M4R0	Bacillus_phage	33.6	1.9e-27
WP_111525858.1|2012099_2013518_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_111525869.1|2013697_2014393_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_111525857.1|2014493_2014925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111525856.1|2016102_2016645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111525855.1|2018033_2019461_-	class I SAM-dependent RNA methyltransferase	NA	A0A2K5B251	Erysipelothrix_phage	28.1	6.2e-46
2017050:2017065	attR	TAAAATATAATCCGAA	NA	NA	NA	NA
WP_111525854.1|2019515_2019782_-	DUF4366 domain-containing protein	NA	NA	NA	NA	NA
WP_111525853.1|2019854_2022062_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	41.1	6.8e-124
WP_111525852.1|2022131_2023019_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	42.0	8.7e-22
WP_009220812.1|2023191_2023647_-	DIP1984 family protein	NA	NA	NA	NA	NA
WP_111525851.1|2023664_2024537_-	EamA family transporter	NA	NA	NA	NA	NA
WP_111525850.1|2024636_2025137_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_111525849.1|2025136_2025529_-	SdpI family protein	NA	NA	NA	NA	NA
WP_111525848.1|2025714_2026854_+	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_111525847.1|2026850_2029616_+	SMC family ATPase	NA	I3WVG4	Acinetobacter_phage	24.6	2.9e-07
WP_119808297.1|2031861_2032065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_119808299.1|2032078_2032450_+|transposase	transposase	transposase	S5VTP8	Leptospira_phage	47.3	7.1e-18
WP_162902575.1|2032835_2033387_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_111525357.1|2034378_2034648_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172621801.1|2034727_2035738_+	permease	NA	NA	NA	NA	NA
WP_111525356.1|2035750_2036059_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_111525355.1|2036539_2036653_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_111525354.1|2036762_2037095_+|transposase	transposase	transposase	S5VTP8	Leptospira_phage	47.1	7.5e-19
WP_111525353.1|2037638_2038016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162902576.1|2038438_2038600_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_LR699010	Lachnoanaerobaculum umeaense isolate MGYG-HGUT-02522 chromosome 1	2810441	2102239	2153828	2810441	plate,terminase,portal,integrase,head,holin,tail,protease,transposase	Faecalibacterium_phage(42.86%)	72	2109997:2110019	2154329:2154351
WP_119808303.1|2102239_2103994_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	27.6	2.2e-45
WP_111524821.1|2104274_2104673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524827.1|2104736_2105897_-|holin	choline-binding protein A	holin	NA	NA	NA	NA
WP_111524820.1|2106616_2108239_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_111524819.1|2108253_2109639_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
2109997:2110019	attL	ATTATCTCTTTGAGAACTGTGGA	NA	NA	NA	NA
WP_111524818.1|2110092_2110323_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_111524817.1|2110537_2110798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162902577.1|2110896_2111700_+	recombinase family protein	NA	A0A097BYD1	Leuconostoc_phage	38.6	1.1e-39
WP_111524815.1|2111793_2112225_-|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	41.1	1.5e-16
WP_111524814.1|2112249_2113167_-	cell surface protein	NA	H7BVE5	unidentified_phage	41.4	6.4e-28
WP_111524813.1|2113221_2113620_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A1L2JY34	Aeribacillus_phage	41.7	3.5e-23
WP_111524812.1|2113677_2113878_-	type II toxin-antitoxin system HicA family toxin	NA	A0A1L2JY37	Aeribacillus_phage	55.6	1.3e-13
WP_162902578.1|2113961_2114105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524811.1|2114097_2114475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524810.1|2114485_2116087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524809.1|2116088_2116868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162902579.1|2116871_2117423_-|tail	phage tail protein I	tail	A0A2K9V433	Faecalibacterium_phage	31.7	1.3e-15
WP_111524807.1|2117415_2118552_-|plate	baseplate J/gp47 family protein	plate	A0A2K9V320	Faecalibacterium_phage	39.5	1.3e-70
WP_111524806.1|2118544_2118844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524805.1|2118843_2119242_-|tail	phage tail protein	tail	A0A2K9V465	Faecalibacterium_phage	31.9	1.1e-08
WP_111524804.1|2119244_2119634_-	hypothetical protein	NA	A0A2K9V325	Faecalibacterium_phage	39.1	3.2e-13
WP_111524803.1|2119630_2120893_-	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	42.4	3.6e-05
WP_111524802.1|2120892_2121099_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_162902580.1|2124684_2125005_-|tail	phage tail assembly protein	tail	A0A2K9V324	Faecalibacterium_phage	33.7	5.3e-06
WP_111524800.1|2125100_2125616_-|tail	phage major tail tube protein	tail	A0A2K9V323	Faecalibacterium_phage	40.7	3.1e-32
WP_111524799.1|2125615_2127070_-|tail	phage tail sheath family protein	tail	A0A2K9V328	Faecalibacterium_phage	46.2	1.0e-128
WP_111524798.1|2127056_2127419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524797.1|2127418_2127886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524796.1|2127882_2128521_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_111524795.1|2128520_2128850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524794.1|2128849_2129137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524793.1|2129138_2129468_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_111524792.1|2129482_2130964_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A2K9V304	Faecalibacterium_phage	42.8	3.7e-118
WP_111524791.1|2131121_2131703_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2K9V308	Faecalibacterium_phage	55.1	4.5e-43
WP_111524790.1|2131695_2133162_-|portal	phage portal protein	portal	A0A2K9V303	Faecalibacterium_phage	53.1	9.0e-149
WP_111524789.1|2133164_2133395_-	peptidylprolyl isomerase	NA	A0A2K9V311	Faecalibacterium_phage	59.2	1.8e-11
WP_111524788.1|2133385_2135209_-|terminase	phage terminase large subunit family protein	terminase	A0A2K9V301	Faecalibacterium_phage	51.6	6.1e-163
WP_111524787.1|2135096_2135729_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_111524786.1|2136103_2136502_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A1L2JY34	Aeribacillus_phage	42.5	5.8e-26
WP_111524785.1|2136562_2136745_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_111524784.1|2136819_2137221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524783.1|2137242_2137500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524782.1|2137502_2138105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524781.1|2138131_2138551_-	single-stranded DNA-binding protein	NA	A0A2H4J8K2	uncultured_Caudovirales_phage	68.3	2.6e-37
WP_111524780.1|2138547_2139162_-	HNH endonuclease	NA	A0A1V0E8E4	Vibrio_phage	36.2	4.6e-22
WP_111524825.1|2139158_2139404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524779.1|2139473_2140469_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218KCA5	Bacillus_phage	37.0	6.3e-05
WP_111524778.1|2140483_2141533_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1W6JNC2	Staphylococcus_phage	24.4	4.6e-06
WP_111524777.1|2141529_2142180_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_111524776.1|2142311_2142653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524824.1|2142694_2143093_-	RusA family crossover junction endodeoxyribonuclease	NA	H2BD71	Pseudomonas_phage	42.0	1.8e-19
WP_162902581.1|2143169_2143625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524774.1|2143591_2144389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147628896.1|2144542_2144854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162902582.1|2144814_2145186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524771.1|2145194_2145389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524770.1|2145426_2145621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524769.1|2145645_2146578_-|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	46.8	6.2e-79
WP_111524768.1|2146606_2146801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524767.1|2146889_2147192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524766.1|2147542_2147794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524765.1|2147815_2148043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524764.1|2148063_2148252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111524763.1|2148260_2148497_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_111524762.1|2148661_2148994_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_111524761.1|2149176_2149509_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_111524760.1|2149669_2149894_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_111524759.1|2150050_2150773_+	helix-turn-helix domain-containing protein	NA	A0A139ZPI6	Marinitoga_camini_virus	29.5	2.1e-18
WP_111524758.1|2150798_2151668_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_111524757.1|2151667_2152039_+	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_111524756.1|2152028_2152613_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_111524755.1|2152781_2153828_+|integrase	site-specific integrase	integrase	H7BVE3	unidentified_phage	61.4	1.6e-131
2154329:2154351	attR	ATTATCTCTTTGAGAACTGTGGA	NA	NA	NA	NA
>prophage 6
NZ_LR699010	Lachnoanaerobaculum umeaense isolate MGYG-HGUT-02522 chromosome 1	2810441	2508429	2574203	2810441	protease,transposase,tRNA	Planktothrix_phage(23.08%)	58	NA	NA
WP_119808251.1|2508429_2509818_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_111526018.1|2510134_2511010_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_111526019.1|2511223_2511820_-	3D domain-containing protein	NA	A0A0H3UZG2	Geobacillus_virus	40.2	1.2e-06
WP_111526020.1|2512078_2512591_-	DsbA family protein	NA	NA	NA	NA	NA
WP_111526021.1|2512727_2513108_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_111526022.1|2513379_2513961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111526023.1|2514015_2515254_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_111526024.1|2515255_2516554_-	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_111526025.1|2516574_2517171_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_111526026.1|2517215_2519510_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	41.2	4.7e-160
WP_111526027.1|2519565_2520849_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.7	2.7e-133
WP_007595427.1|2520858_2521440_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.6	2.5e-54
WP_111526028.1|2521520_2522807_-	trigger factor	NA	NA	NA	NA	NA
WP_111526029.1|2522933_2523443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119808255.1|2523671_2525060_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_111525845.1|2525300_2525774_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_111525844.1|2527520_2528372_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_111525843.1|2528368_2529379_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_111525842.1|2529372_2530323_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_111525841.1|2530325_2531837_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	7.6e-18
WP_111525840.1|2531836_2532865_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_111525839.1|2532874_2533684_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_111525838.1|2533696_2534878_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_111525837.1|2535236_2535719_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_111525836.1|2535735_2536788_-	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_009446225.1|2536819_2537749_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_111525835.1|2537745_2538813_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_111525834.1|2538805_2540335_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.9	3.5e-10
WP_111525833.1|2540406_2541216_-	response regulator	NA	NA	NA	NA	NA
WP_111525832.1|2541306_2542794_-	histidine kinase	NA	NA	NA	NA	NA
WP_111525846.1|2542963_2544028_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_111525831.1|2544050_2545643_-	ATPase	NA	NA	NA	NA	NA
WP_111525830.1|2545652_2546345_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_111525829.1|2546355_2547786_-	L-arabinose isomerase	NA	NA	NA	NA	NA
WP_111525828.1|2548721_2549558_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_111525827.1|2549561_2550038_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_111525826.1|2550098_2551541_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_111525825.1|2551580_2552915_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_111525824.1|2553078_2553735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111525823.1|2553739_2554288_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	L7TIP4	Escherichia_phage	47.8	7.0e-38
WP_111525822.1|2554287_2555316_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0G2SSM2	Proteus_phage	35.8	9.7e-49
WP_111525821.1|2555573_2556800_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	35.5	3.3e-64
WP_111525820.1|2556879_2559048_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2H5BH09	Vibrio_virus	37.8	4.9e-127
WP_162902590.1|2559482_2560433_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_111525818.1|2560422_2561217_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_111525817.1|2561247_2562819_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_111525816.1|2562818_2563583_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.8	8.3e-21
WP_111525815.1|2563596_2564349_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.1	5.5e-17
WP_119808241.1|2564430_2566188_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_111526096.1|2566565_2567015_+	DUF3290 domain-containing protein	NA	NA	NA	NA	NA
WP_111526095.1|2567018_2567654_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_111526094.1|2567774_2568572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_111526093.1|2568665_2569517_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_111526092.1|2569541_2570315_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.1	6.0e-35
WP_111526091.1|2570334_2571006_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_111526090.1|2570986_2571646_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_119808315.1|2572163_2573027_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_119808317.1|2573321_2574203_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
