The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LR778174	Veillonella parvula strain SKV38 chromosome 1	2146482	326867	337695	2146482		Tetraselmis_virus(28.57%)	9	NA	NA
WP_174892181.1|326867_327818_+	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	33.0	4.5e-32
WP_118091047.1|327832_328396_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_174892182.1|328596_330492_+	cation-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.1	1.0e-91
WP_174892183.1|330611_331388_-	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	28.3	1.5e-17
WP_004693956.1|331400_331637_-	autonomous glycyl radical cofactor GrcA	NA	A0A2K8HAT8	Bacteriophage	75.0	1.5e-18
WP_039965381.1|331712_333830_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	44.3	1.9e-160
WP_156697114.1|334351_335224_+	helix-turn-helix domain-containing protein	NA	S5MAC0	Brevibacillus_phage	38.3	3.5e-07
WP_156697115.1|335553_336420_+	EamA family transporter	NA	NA	NA	NA	NA
WP_012863837.1|336672_337695_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.5	3.7e-24
>prophage 2
NZ_LR778174	Veillonella parvula strain SKV38 chromosome 1	2146482	449536	455524	2146482		Prochlorococcus_phage(33.33%)	6	NA	NA
WP_156697151.1|449536_450028_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	47.1	6.7e-32
WP_038149765.1|450162_450876_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FCN6	Synechococcus_phage	44.8	6.3e-47
WP_156697152.1|450887_452306_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.6	3.4e-52
WP_156697153.1|452292_453354_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SQF5	Cyanophage	42.3	6.4e-64
WP_155086392.1|453346_453970_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	32.1	4.4e-20
WP_156697154.1|453994_455524_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	53.3	9.6e-77
>prophage 3
NZ_LR778174	Veillonella parvula strain SKV38 chromosome 1	2146482	466774	543823	2146482	terminase,capsid,tail,holin,portal,plate,protease,tRNA,integrase	Bacteriophage(25.0%)	92	466619:466678	508990:509053
466619:466678	attL	CACGCCATCTTGAGGGGGTGGTGAGCTAACGCTCGTGCGGGTTCAAGTCCCGCCAACCGC	NA	NA	NA	NA
WP_174892197.1|466774_467848_-|integrase	site-specific integrase	integrase	A0A0A8WIE1	Clostridium_phage	29.1	7.3e-31
WP_174892198.1|467995_469279_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_174892199.1|469446_469830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174892200.1|469857_470394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174892428.1|470421_470643_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_174892429.1|470709_471090_-	helix-turn-helix domain-containing protein	NA	A0A1X9H038	Staphylococcus_phage	42.7	3.7e-14
WP_174892201.1|471284_471506_+	DUF739 domain-containing protein	NA	NA	NA	NA	NA
WP_174892202.1|471549_471798_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_118091000.1|471932_472127_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_174892203.1|472609_472999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174892204.1|472973_473615_+|holin	choline-binding protein A	holin	NA	NA	NA	NA
WP_174892205.1|473617_473968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174892206.1|473982_475632_+	PcfJ domain-containing protein	NA	S4U0J0	uncultured_phage	51.3	9.4e-163
WP_174892207.1|475641_477549_+	hypothetical protein	NA	S4TZY3	uncultured_phage	58.5	4.7e-206
WP_174892208.1|477551_477737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174892209.1|477727_478477_+	phage antirepressor KilAC domain-containing protein	NA	A0A2I7SC24	Paenibacillus_phage	52.7	1.2e-64
WP_174892210.1|478487_479360_+	recombinase RecT	NA	A0A2H4JCY8	uncultured_Caudovirales_phage	46.9	2.5e-53
WP_174892211.1|479362_480085_+	MBL fold metallo-hydrolase	NA	S4U058	uncultured_phage	69.2	5.3e-94
WP_174892212.1|480081_480519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174892213.1|480522_481467_+	DUF4373 domain-containing protein	NA	S4TZS9	uncultured_phage	52.6	6.5e-60
WP_174892214.1|481441_482089_+	ATP-binding protein	NA	S4U0J1	uncultured_phage	46.9	1.1e-45
WP_174892113.1|482085_482484_+	hypothetical protein	NA	A8AU00	Listeria_phage	41.2	6.4e-09
WP_174892215.1|482613_483144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174892216.1|483743_484274_+	hypothetical protein	NA	A0A0C5AN04	Bacteriophage	35.6	5.2e-14
WP_174892217.1|484270_485581_+	N-6 DNA methylase	NA	A0A1X9I6H1	Streptococcus_phage	39.3	2.8e-77
WP_174892218.1|485580_485976_+	hypothetical protein	NA	A0A1X9I666	Streptococcus_phage	37.4	1.8e-11
WP_174892219.1|485997_487902_+|terminase	phage terminase large subunit family protein	terminase	A0A2K9V2Q8	Faecalibacterium_phage	43.9	5.4e-138
WP_174892220.1|487910_488156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174892221.1|488165_489773_+|portal	phage portal protein	portal	A0A2K9V452	Faecalibacterium_phage	42.1	1.0e-108
WP_174892222.1|489765_490848_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A0C5AEN1	Bacteriophage	31.0	1.8e-37
WP_174892223.1|490847_491186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174892224.1|491199_492249_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_174892225.1|492263_492500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174892226.1|492499_492853_+	hypothetical protein	NA	A0A2K9V315	Faecalibacterium_phage	33.6	7.5e-09
WP_174892227.1|492840_493374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077708154.1|493373_493853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174892228.1|493862_494090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174892229.1|494090_495530_+|tail	phage tail sheath family protein	tail	A0A059WKP9	Vibrio_phage	47.1	3.9e-120
WP_038125816.1|495546_496080_+|tail	phage major tail tube protein	tail	A0A0C5AJ56	Bacteriophage	37.9	4.3e-24
WP_077708157.1|496102_496399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174892230.1|496568_498905_+	hypothetical protein	NA	A0A0C5ABJ2	Bacteriophage	32.2	2.2e-08
WP_060924349.1|498897_499101_+|tail	tail protein X	tail	A0A0C5AEF4	Bacteriophage	55.2	5.2e-15
WP_174892231.1|499104_500265_+	transcriptional regulator	NA	A0A0C5AJ59	Bacteriophage	34.5	2.1e-47
WP_174892232.1|500254_500719_+|plate	baseplate assembly protein	plate	A0A059WRL9	Vibrio_phage	34.7	5.6e-12
WP_174892233.1|500728_501205_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_174892234.1|501207_501519_+	hypothetical protein	NA	A0A067ZJ13	Vibrio_phage	43.1	3.4e-13
WP_174892235.1|501515_502637_+|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	43.0	5.0e-75
WP_174892236.1|502633_503293_+|tail	phage tail protein I	tail	A0A0C5AJ63	Bacteriophage	39.4	1.5e-23
WP_174892237.1|503302_504190_+	hypothetical protein	NA	A0A0C5AEQ0	Bacteriophage	34.0	1.4e-11
WP_174892238.1|504898_505750_-|integrase	site-specific integrase	integrase	A0A0E3Y5J2	Fusobacterium_phage	32.4	2.9e-30
WP_077708167.1|505776_506166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174892239.1|506167_506308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077708168.1|506324_506876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077708169.1|506868_507261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077708170.1|507261_507837_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_077708648.1|507994_508378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156697205.1|509185_509827_+	hypothetical protein	NA	NA	NA	NA	NA
508990:509053	attR	CACGCCATCTTGAGGGGGTGGTGAGCTAACGCTCGTGCGGGTTCAAGTCCCGCCAACCGCACCA	NA	NA	NA	NA
WP_156697206.1|509936_511310_-	MFS transporter	NA	NA	NA	NA	NA
WP_101928963.1|511521_511734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101928964.1|511799_512885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012863950.1|512969_513761_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_101928965.1|514064_514868_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_004693677.1|514879_515818_+	phosphodiester glycosidase family protein	NA	A0A1P8CWN9	Bacillus_phage	29.2	4.7e-10
WP_101928966.1|515826_516771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101928967.1|516843_518019_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_101928968.1|518005_518332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008602782.1|518876_520229_+	pyruvate carboxylase subunit B	NA	NA	NA	NA	NA
WP_077708186.1|520678_522019_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.6	5.9e-22
WP_004693664.1|522015_522705_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.9	7.7e-34
WP_024061350.1|523373_524471_+	trypsin-like peptidase domain-containing protein	NA	W5SAB9	Pithovirus	32.0	5.5e-10
WP_004693657.1|524830_525160_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024061349.1|525146_525722_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_024061348.1|525731_526160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004698369.1|526436_527024_-	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_008715622.1|527020_527740_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_008715623.1|527928_528558_+	3'-5' exonuclease	NA	A0A2I6PEZ7	Staphylococcus_phage	30.1	9.5e-15
WP_004698377.1|528572_529235_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_021147799.1|529288_530590_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	51.1	4.6e-112
WP_174892240.1|530600_531026_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_021147801.1|531003_532461_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_021147802.1|532465_533101_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_021147803.1|533260_534745_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.1	3.6e-20
WP_021147804.1|534749_535469_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.6	8.0e-42
WP_004698373.1|535572_536391_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_021147805.1|536534_537437_-	1,4-dihydroxy-2-naphthoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_021147806.1|537679_538624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021147807.1|538625_539405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021147808.1|539537_539909_+	RidA family protein	NA	NA	NA	NA	NA
WP_021147809.1|539910_541158_+	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
WP_004698339.1|541314_541947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174892241.1|542023_543211_-	MFS transporter	NA	NA	NA	NA	NA
WP_101928983.1|543313_543823_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 4
NZ_LR778174	Veillonella parvula strain SKV38 chromosome 1	2146482	756397	765868	2146482	tRNA,protease	Agrobacterium_phage(16.67%)	7	NA	NA
WP_004696517.1|756397_756991_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.0	4.0e-55
WP_038125529.1|757024_758257_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	62.7	9.9e-141
WP_156697640.1|758322_760632_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.7	2.5e-177
WP_024062006.1|760631_761330_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_156697639.1|761326_762298_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	23.8	8.6e-07
WP_101928841.1|762299_763190_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	28.5	9.0e-19
WP_156697638.1|763210_765868_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	41.4	3.7e-169
>prophage 5
NZ_LR778174	Veillonella parvula strain SKV38 chromosome 1	2146482	829873	840392	2146482		uncultured_phage(42.86%)	10	NA	NA
WP_004696404.1|829873_830914_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	63.9	4.3e-121
WP_004698613.1|830916_831360_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_038125528.1|831574_833080_+	ribonuclease Y	NA	NA	NA	NA	NA
WP_174892257.1|833337_835110_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	3.1e-55
WP_004696398.1|835138_836299_+	RNA polymerase sigma factor RpoD	NA	F4YCU2	Synechococcus_phage	37.6	9.3e-40
WP_012864569.1|836504_836843_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	69.6	2.6e-43
WP_024061961.1|836829_837564_+	4Fe-4S cluster-binding domain-containing protein	NA	S4TZT1	uncultured_phage	48.4	1.2e-53
WP_004696390.1|837645_838209_+	GTP cyclohydrolase I FolE	NA	S4U0J3	uncultured_phage	67.2	1.9e-62
WP_077708558.1|838541_839273_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_077708557.1|839288_840392_+	Nif3-like dinuclear metal center hexameric protein	NA	A0A2P1EK93	Megavirus	38.0	6.4e-14
>prophage 6
NZ_LR778174	Veillonella parvula strain SKV38 chromosome 1	2146482	1003818	1012082	2146482	tRNA	uncultured_virus(33.33%)	8	NA	NA
WP_123137900.1|1003818_1004850_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.7	3.4e-70
WP_123137901.1|1004852_1006244_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_004696048.1|1006244_1006823_+	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	2.3e-07
WP_123137902.1|1006954_1007236_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	52.7	1.6e-17
WP_004696042.1|1007348_1008974_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.0	7.3e-160
WP_123137904.1|1009307_1009724_+	DoxX family protein	NA	D2X5Z2	uncultured_marine_phage	33.9	5.9e-05
WP_008601096.1|1009787_1011044_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_004696035.1|1011338_1012082_+	Fe-S cluster assembly ATPase SufC	NA	G9BWD6	Planktothrix_phage	25.4	1.9e-09
