The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_LR793264	Klebsiella pneumoniae isolate NGKP54 chromosome 1	5143036	774009	783473	5143036	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|774009_775125_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|775121_777062_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|777138_777360_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|777685_778003_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|778033_780313_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|780433_780652_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|781005_781707_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004209699.1|781751_783473_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 2
NZ_LR793264	Klebsiella pneumoniae isolate NGKP54 chromosome 1	5143036	1139264	1203202	5143036	transposase,protease,holin,terminase,integrase	Salmonella_phage(16.28%)	75	1154269:1154285	1176722:1176738
WP_174890671.1|1139264_1140411_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	3.9e-147
WP_002901746.1|1140625_1141528_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_002901749.1|1141588_1142179_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_004196459.1|1142175_1142937_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.2	1.2e-08
WP_004210741.1|1142931_1143147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108452657.1|1143191_1144238_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_002901761.1|1144285_1144537_-	YciN family protein	NA	NA	NA	NA	NA
WP_002901763.1|1144943_1147541_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
WP_002901772.1|1147886_1148861_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_002901776.1|1149106_1149274_+	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_108452658.1|1149662_1152335_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_002901778.1|1152381_1152984_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
WP_002901779.1|1153147_1153915_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_002901780.1|1154050_1154359_+	LapA family protein	NA	NA	NA	NA	NA
1154269:1154285	attL	CGCGGAGCGGAAAATTA	NA	NA	NA	NA
WP_002901781.1|1154365_1155535_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_004151907.1|1155726_1156464_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_002901782.1|1156463_1156790_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_002901783.1|1156921_1157140_-	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_002901785.1|1157415_1158165_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002901786.1|1158236_1158416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002901787.1|1158574_1160509_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
WP_020802459.1|1160590_1161748_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_174890672.1|1161938_1162727_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_108452665.1|1162925_1163468_-	HutD family protein	NA	NA	NA	NA	NA
WP_004151902.1|1163715_1165095_+	cytosine permease	NA	NA	NA	NA	NA
WP_004140269.1|1165139_1165949_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|1165950_1166943_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|1166942_1167833_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_080925579.1|1167979_1169197_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.6	5.6e-120
WP_080925578.1|1169417_1169657_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	66.2	7.5e-21
WP_080925577.1|1169697_1170807_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	85.6	2.1e-182
WP_080925576.1|1170819_1173918_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	57.4	1.6e-293
WP_016946289.1|1174055_1174211_-	DNA breaking-rejoining protein	NA	H6WRX3	Salmonella_phage	74.5	2.6e-14
WP_004179600.1|1174219_1174411_-	YebW family protein	NA	NA	NA	NA	NA
WP_108452660.1|1174803_1175217_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023341332.1|1175328_1175559_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	45.3	2.1e-12
WP_108452661.1|1175561_1176098_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	67.8	4.1e-59
WP_108452662.1|1176446_1177367_+	replication protein	NA	K7PGZ0	Enterobacteria_phage	60.0	2.4e-91
1176722:1176738	attR	CGCGGAGCGGAAAATTA	NA	NA	NA	NA
WP_108452663.1|1177363_1178107_+	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	54.4	1.7e-63
WP_016946299.1|1178099_1178435_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	4.4e-11
WP_069334955.1|1178427_1179213_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.9	3.3e-65
WP_049124977.1|1179209_1179413_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	83.3	6.6e-26
WP_020804604.1|1179405_1179660_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	50.6	1.4e-09
WP_108452162.1|1179656_1179878_+	hypothetical protein	NA	A9YWV3	Burkholderia_phage	48.1	1.4e-10
WP_142407224.1|1180670_1181045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108452424.1|1181090_1182176_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_004184503.1|1183159_1183393_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
WP_087812871.1|1183803_1184403_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	79.4	1.3e-90
WP_032414240.1|1184611_1184908_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	71.9	6.0e-36
WP_108452423.1|1184904_1185273_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	63.8	5.9e-41
WP_108452422.1|1185269_1186052_+	antitermination protein	NA	F1C595	Cronobacter_phage	79.1	8.5e-114
WP_031280381.1|1186368_1186815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024176410.1|1187455_1187755_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_023286288.1|1187751_1188291_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_004190674.1|1188287_1188632_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004190672.1|1188628_1188904_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_101856931.1|1189992_1190997_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	2.0e-38
WP_004190663.1|1190974_1192282_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_008807834.1|1192281_1193682_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.3	9.2e-127
WP_080882808.1|1193665_1194778_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.3	1.5e-111
WP_004227000.1|1195018_1195195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016946679.1|1195308_1196094_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_004190653.1|1196104_1197058_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_151391665.1|1197066_1197339_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_040225382.1|1197379_1197775_+	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	42.5	4.7e-12
WP_004190649.1|1197776_1198031_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
WP_004184451.1|1198040_1198274_+	hypothetical protein	NA	A0A1V0E8A3	Vibrio_phage	49.2	1.3e-09
WP_064155819.1|1198260_1198644_+	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_080882810.1|1198645_1199197_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
WP_004190640.1|1199193_1199586_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_023325166.1|1199609_1200782_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.3	3.2e-24
WP_023325167.1|1200835_1201318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022631473.1|1201455_1201653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174890805.1|1201741_1202053_+	DUF2545 family protein	NA	NA	NA	NA	NA
WP_174890647.1|1202054_1203202_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.0	7.8e-148
>prophage 3
NZ_LR793264	Klebsiella pneumoniae isolate NGKP54 chromosome 1	5143036	1474770	1485657	5143036		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|1474770_1475391_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_009485280.1|1475383_1476649_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	98.8	4.3e-232
WP_002903955.1|1476660_1477563_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|1477823_1478585_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|1478605_1479466_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_004176262.1|1479763_1480024_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620097.1|1480110_1481199_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176258.1|1481229_1482495_-	MFS transporter	NA	NA	NA	NA	NA
WP_032423486.1|1482549_1485657_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 4
NZ_LR793264	Klebsiella pneumoniae isolate NGKP54 chromosome 1	5143036	2137567	2190087	5143036	holin,head	Enterobacteria_phage(25.45%)	75	NA	NA
WP_108452300.1|2137567_2137816_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.2	3.1e-09
WP_174890705.1|2137949_2138219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174890646.1|2138229_2140506_-	hypothetical protein	NA	A0A0K2FI18	Enterobacter_phage	54.4	1.2e-06
WP_174890706.1|2140630_2143108_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	1.2e-198
WP_071057221.1|2143094_2143490_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	55.6	1.2e-36
WP_174890707.1|2143486_2143957_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	39.1	1.2e-25
WP_063417024.1|2143956_2144433_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.0	2.3e-37
WP_029884074.1|2144478_2144721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174890708.1|2144720_2148089_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	75.3	0.0e+00
WP_032428681.1|2148148_2148562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124043122.1|2148613_2148955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077258341.1|2149206_2149566_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	40.9	1.1e-15
WP_061353713.1|2149609_2150062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016528886.1|2150058_2150631_-	SocA family protein	NA	NA	NA	NA	NA
WP_174890709.1|2150941_2151631_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	53.2	5.1e-62
WP_174890710.1|2151698_2152463_-	immunoglobulin domain-containing protein	NA	G0ZNE6	Cronobacter_phage	44.2	1.2e-40
WP_043906747.1|2152522_2152744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174890711.1|2152746_2153130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174890712.1|2153126_2153495_-	HK97 gp10 family phage protein	NA	F1C5E3	Cronobacter_phage	82.0	8.5e-48
WP_085353132.1|2153497_2153860_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	49.2	1.6e-19
WP_174890713.1|2153859_2154033_-	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	56.1	4.1e-13
WP_174890714.1|2154032_2154434_-	hypothetical protein	NA	A0A1V0E5R0	Salmonella_phage	74.6	1.8e-51
WP_004223289.1|2154500_2154794_-	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	87.6	3.6e-41
WP_174890715.1|2154803_2155880_-	hypothetical protein	NA	A0A1V0E5P6	Salmonella_phage	86.9	1.4e-183
WP_032438677.1|2155897_2156347_-	hypothetical protein	NA	I6S1Q2	Salmonella_phage	85.2	7.1e-65
WP_108452609.1|2156359_2157625_-	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	90.5	5.4e-219
WP_174890716.1|2157627_2158554_-|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	91.9	1.5e-162
WP_174890717.1|2158513_2159863_-	DUF1073 domain-containing protein	NA	Q5G8Y4	Enterobacteria_phage	90.4	1.0e-239
WP_032444936.1|2159932_2160199_-	hypothetical protein	NA	Q5G8Y6	Enterobacteria_phage	77.3	3.0e-34
WP_174890718.1|2160260_2161745_-	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	86.8	2.0e-257
WP_004223268.1|2161731_2162211_-	DUF2280 domain-containing protein	NA	F1C5D6	Cronobacter_phage	74.8	1.4e-63
WP_174890719.1|2162241_2162877_-	hypothetical protein	NA	I6S676	Salmonella_phage	80.7	1.8e-101
WP_020804475.1|2163774_2164152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174890720.1|2164349_2164739_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	50.0	3.1e-24
WP_174890810.1|2164735_2165233_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	81.8	3.1e-77
WP_012542609.1|2165210_2165480_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.8e-32
WP_174890721.1|2166343_2167027_-	antiterminator	NA	I6PDF8	Cronobacter_phage	50.6	3.9e-54
WP_032427735.1|2167023_2167164_-	YlcG family protein	NA	NA	NA	NA	NA
WP_174890722.1|2167160_2167799_-	recombination protein NinG	NA	H6WRY9	Salmonella_phage	68.9	1.4e-74
WP_174890723.1|2167791_2167962_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	71.4	7.4e-15
WP_032748419.1|2167961_2168417_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	72.8	3.7e-61
WP_059065411.1|2168615_2168879_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	72.4	4.2e-25
WP_059065413.1|2168875_2169058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174890724.1|2169134_2169920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049117363.1|2170904_2171099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174890725.1|2171099_2171651_-	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	57.6	2.0e-37
WP_154974831.1|2171647_2171857_-	hypothetical protein	NA	I7B2L9	Escherichia_phage	45.3	5.0e-05
WP_174890726.1|2171928_2172321_-	hypothetical protein	NA	K7P801	Enterobacteria_phage	36.6	7.5e-10
WP_004218528.1|2172317_2172620_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_174890727.1|2172616_2173354_-	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	55.7	4.0e-65
WP_023342713.1|2173350_2174379_-	replication protein	NA	K7PGZ0	Enterobacteria_phage	79.3	1.9e-65
WP_174890728.1|2174375_2175173_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	72.8	3.5e-91
WP_001548453.1|2175258_2175480_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004178811.1|2175520_2175754_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	70.4	3.0e-22
WP_024622727.1|2175858_2176548_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	70.6	1.0e-86
WP_174890729.1|2176835_2177762_+	hypothetical protein	NA	A4KWU2	Enterobacteria_phage	59.2	7.3e-96
WP_174890730.1|2177796_2178000_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	70.1	5.9e-19
WP_174890731.1|2178309_2178435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008807814.1|2178427_2178634_+	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_174890732.1|2178713_2179685_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	89.0	2.0e-64
WP_040220025.1|2179692_2179977_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	61.7	1.2e-28
WP_159178462.1|2179986_2180901_+	recombinase RecT	NA	G8C7T0	Escherichia_phage	90.8	4.3e-157
WP_048281026.1|2180897_2181380_+	siphovirus Gp157 family protein	NA	G8C7S9	Escherichia_phage	93.1	8.2e-75
WP_174890733.1|2181414_2181720_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042935507.1|2181716_2182244_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	8.4e-57
WP_004146321.1|2182240_2182459_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	2.1e-09
WP_080844970.1|2182460_2182676_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	51.9	2.7e-09
WP_174890734.1|2182679_2182922_+	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	80.0	1.3e-28
WP_124073900.1|2182969_2184232_+	DUF3596 domain-containing protein	NA	A0A286S1S8	Klebsiella_phage	94.8	3.9e-233
WP_156234753.1|2184216_2184498_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_174890735.1|2184472_2185282_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004175494.1|2185293_2186589_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	9.6e-62
WP_002910715.1|2186892_2187819_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910717.1|2187917_2188394_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004180410.1|2188443_2190087_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
>prophage 5
NZ_LR793264	Klebsiella pneumoniae isolate NGKP54 chromosome 1	5143036	2404205	2421042	5143036	transposase	Escherichia_phage(33.33%)	15	NA	NA
WP_108452427.1|2404205_2405537_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.1	6.9e-15
WP_015958691.1|2405526_2406360_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_108452426.1|2406388_2407219_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_108452425.1|2407305_2407860_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.1	2.5e-51
WP_108452437.1|2407874_2408765_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	1.6e-28
WP_004175258.1|2408796_2409666_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_108452176.1|2409692_2410757_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.4	2.2e-104
WP_021313308.1|2411596_2412601_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
WP_174890679.1|2412861_2413830_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	7.7e-181
WP_016947628.1|2414067_2414187_+	small membrane protein	NA	NA	NA	NA	NA
WP_000704907.1|2414615_2415782_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_101989088.1|2415961_2416516_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	8.6e-52
WP_108452437.1|2416530_2417421_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	1.6e-28
WP_108452176.1|2418347_2419412_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.4	2.2e-104
WP_065810909.1|2419635_2421042_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	29.4	2.3e-40
>prophage 6
NZ_LR793264	Klebsiella pneumoniae isolate NGKP54 chromosome 1	5143036	2464326	2471231	5143036	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_087637802.1|2464326_2465805_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
WP_004175198.1|2465801_2466524_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004144192.1|2466842_2468204_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004151134.1|2468446_2469343_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004180550.1|2469583_2470357_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004180551.1|2470367_2471231_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 7
NZ_LR793264	Klebsiella pneumoniae isolate NGKP54 chromosome 1	5143036	2816913	2828028	5143036		Salmonella_phage(33.33%)	12	NA	NA
WP_174890760.1|2816913_2819712_-	tape measure protein	NA	A0A1B1W284	Salmonella_phage	32.7	1.6e-45
WP_004140789.1|2819719_2820046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064172567.1|2820340_2820718_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	45.5	8.2e-22
WP_074193881.1|2820747_2821068_-	superinfection immunity protein	NA	A0A0S2SY85	Pseudomonas_phage	45.0	4.7e-18
WP_099973296.1|2821137_2821410_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_029602627.1|2821423_2821870_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_117066039.1|2822208_2824971_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.9	9.2e-296
WP_117038315.1|2824985_2825612_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.8	1.5e-23
WP_004866294.1|2825608_2825821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029497050.1|2825817_2826078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048280610.1|2827046_2827226_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_004177036.1|2827218_2828028_-	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	56.8	3.5e-30
>prophage 8
NZ_LR793264	Klebsiella pneumoniae isolate NGKP54 chromosome 1	5143036	4695146	4754802	5143036	integrase,tRNA,transposase	Enterobacteria_phage(35.29%)	51	4710181:4710206	4763855:4763880
WP_108452416.1|4695146_4695911_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_004152275.1|4696181_4696685_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_009486532.1|4696805_4699661_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.5	6.0e-141
WP_002886953.1|4699660_4700104_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_002886954.1|4700223_4701735_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	9.2e-48
WP_002886955.1|4702124_4703222_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_002886956.1|4703221_4704304_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_064156404.1|4704352_4705855_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	45.1	1.6e-84
WP_004178392.1|4705953_4706775_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_009486529.1|4707126_4708632_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004177654.1|4708650_4709460_+	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_174890796.1|4710128_4710290_+	hypothetical protein	NA	NA	NA	NA	NA
4710181:4710206	attL	CCGGCAAGCGCAGCGCCGCCGGGCAG	NA	NA	NA	NA
WP_004152190.1|4710823_4711681_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031590889.1|4711832_4713746_-	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_004152191.1|4714251_4716192_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
WP_004215323.1|4716238_4717252_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_004152193.1|4717293_4718178_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_004192343.1|4718201_4719101_+	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_087785722.1|4719244_4720555_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023317451.1|4720547_4721621_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	4.7e-22
WP_108452564.1|4721626_4722451_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_019705529.1|4722461_4723349_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_023159708.1|4723338_4724223_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_004177639.1|4724353_4725373_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	31.7	1.1e-44
WP_108452563.1|4725484_4726954_-	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_040183302.1|4726950_4727631_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_044784988.1|4728468_4729722_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	9.6e-75
WP_044784989.1|4729797_4732272_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_064152725.1|4732616_4733183_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.1e-59
WP_004132551.1|4733200_4733446_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	59.3	5.0e-20
WP_064152724.1|4733442_4734180_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.1	2.9e-71
WP_044784923.1|4734740_4735007_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	5.8e-30
WP_077265860.1|4735003_4735555_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	68.4	3.4e-32
WP_004098168.1|4735551_4735779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098169.1|4735775_4736096_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_174890797.1|4736109_4738443_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.2	0.0e+00
WP_032421977.1|4738831_4739527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089503791.1|4739914_4741025_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	30.4	4.4e-07
WP_108452672.1|4741308_4742796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032170364.1|4743737_4744004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108452671.1|4743966_4745223_-	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_108452670.1|4745384_4745648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108452669.1|4745637_4746765_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_174890647.1|4746975_4748122_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.0	7.8e-148
WP_108452668.1|4748650_4749761_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	29.7	3.8e-06
WP_174890679.1|4750174_4751143_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	7.7e-181
WP_004192264.1|4751382_4751862_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_032425515.1|4751864_4752212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108452667.1|4752213_4752888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071587209.1|4753338_4753716_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_174890679.1|4753833_4754802_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	7.7e-181
4763855:4763880	attR	CCGGCAAGCGCAGCGCCGCCGGGCAG	NA	NA	NA	NA
