Region | Region Position | Best matching Phage(blastn) | Best matching Phage(blastp) | Prophage annotation | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
DBSCAN-SWA_1 |
259 : 35905
DNA in the prophage region>NC_019418|259:35905|DBSCAN-SWA TTTAATAGTTGGAAATCTCTTTAATAACATCATCCAATTTCTCGATGCTCACAACCTCATGTGGCTGTACTTTTTCGCCAGGCAATACAAAATCAAATATTTTACCGTCTTTTCTCACAACCTGTACAAAATCACTAAACCAACCATTTTCAATGCCCTCTACAAAAATATAATACGTTTCACTCACTTTAATTACCTCCTTACCTAATAGTTCGTAAAAGATTTAGAAATATTGAAAAATCGCCCTAGTTTTTTTTGCTAGAGCGATTATTTTTTTATTCTATAGGCAATCATACCCCTTGCAAGTTGAAAGCCAAATCTGGGCTGTTATGGGTTATTTTAACGTACCCCACAAACTTATACGGTGACCGTTAGCATCGACTTGACCAATAGCCATATAACTACGCTTGCCACTACGACCAATCCAACTAATCCAACGGTAACCAGCAGCAGTTAGATAGCTATCATAGGTTACACTTTCGCCAATCTGATATGTTGCGACAATTTCGCCAGAAAGGTGGGGCTGTCGGCGTACATTGATTGCTGTACTGTTCAAAGTAAATACCCCAGTCTCAGAAATACGACCAGTTTCAATTTGTTTGGTTGGTTCTGAACTCACTGTAGAATCTGCCAACACAATAAAGCCAACCATACCATTCATACTACGGACATGATATTGTGCTGGACTGCCAACGTTAAGATTACCCGCAAGGTTTTGTTCAACAGTACGCATACTGTTGCCATCGCTGTCCTCAACAATTACGCCAGTATGACCATAATCAATACCATCTCCTGCAACGTAGTGCATGACGAAAATCCACCCTGCCTTAGGTTTGATACCAGGTGCATACGGCACAACCTTAATGCCCTGCGCTTTTGCACTATTTAACAAATCAATAGCATTCCCCCAAAGGTCAACACCACGCCAATTTTTTACAATAAAACAAGATAAATCTGCGCATTGGTAACCCCATGCACCATCTTTATCAACACCTGCTCTAGCATTGGCTAAATTCTTGGAATACAAAACAATCTGATTTAGCATGTCAATCCCCCTTTATTAATAATTCTAAAAACGGGCTAACCAAGAAAACAACAAAGCTAATCACAATAAATAGCGGTATCAAGACCAAAATCAGTAGAATTTTCCCTATTGCTTTCATGATATGCCTCCCTAATTATTTTCTTGATGGTAATTTTTGCTAGAAACACCAAGTACCGTACCACCAAATGTTGCAAATAGGGCAATTGTTCCTGTGATAGCTGTTGTATCAAATTTATACAAAGCACCCAGACCAGTAATTAGCGTGATACCTGCTGGCACAACAACTGTAACTACCTTCTTAGCAACATCATATTGTCCGTTTGTTAATTTCATGTCTATCCCCCTTTCTTAAAGGCAAATCAATAAACTCCTCTTTATACATCATTTCAATCTCACCATTTCCATCCAACATTTTGTAAGAGTCAAATAGTTTAGCTATTTCACGCTTGTTTTCTAATGTGGTATAACCATTTAGAATGTCTTTTGTCATGTCGTGATACAAGCGGTATCTAGTGATGTCCTTAGAGTTCTTTTTTAGCTTGTCAAGTTCCTCTGCATTACTAGCTAAGTCTGCCTTTATTTTTATATTGTCGTTTTTTAAGACATCCAACGACTGGATGATTTCTTTTTGACCTTGTTTAACTTCATTATCACGTTTTCCAATAAAAAAATTTGAAATGGTACTGATTAACGTACCAACAACCCCTCCAGAAACTGTGATAAGAGCGACAAGGACAGCACTATCTTTCAACCAAGGTGGCACTCATTCACCCCCTCAGTCTGTTTCAGCATTCTCTGCTTCAAGTTCAGCTAAAATCTCATCCTCAATTTTATAGCGTAACTCTCGCAACTCTTGCTCATGCTTGCGCATATCTCGACGGTTTTTAGCATAAAGCTCTGGCTCGTGCAATGTTTCAAATACCGTTGATACTGCATCAGCACCTGTGTTGATTACCGTTGTTTTGACAAGTTTCTCCTGCTTGTCCTCGATTACAATAAATTCAGCCGTTGTTTGGCGTGTCTTTGTGACTTTCAACATAGTTTTTACCTCCTTCATGATTTCATTATCTGATAGATTTCTAGGGATTTTTTACGTATTCTTAGTTTGGATATGGGTCATTCGTGATGTATGTAATCGTGCCAGTATATACATGAGCACCTCCAGTCCCATTTGTTAATCTGATTTTTCCATCTGATGCAAAATGCAATATTGATGGCGATTTTGTAAAGCTACCTACATTCGGTGCCATAAGCATGTGCGTCTCAACAGTCGGACGATATCCTAACGGGATAGTCTCAACCATTTGACTATACTCAAAGACATCAATGTTGGTAATGCGACGATTAAGCGTGATAGTAACCAGGCTATCCTTGCGTATCAATGTCGCATTAAGTCCATACGGAAATCCCATCGTCAATGTCTTTAATGGTTTCTCTTGTAGCATTGGATGATTTGTCTGTGGAGTTATTTCAACCCAAGGATACCATGTGGCAGAACCATTTGAGGACTTGTAATTGTTAGCATGCCGTCTGTACACCTTCCATCCGCCAGACCAGGATTTTGCAATCTGAAATATATCTGTAGTAGCTCTGCATGTTTCAATCCAGCCATAGTTTGAAGGAAAAGGACTGTTTGCACAACCTGGATTTATCCAGCGTGTGCCATTATTAACATGAGTATTGACATCTGTATTGTATGCGTAGATAGTATTTCCTTCGACATTTGTCAATTGATACTGTTGTATCTGCTTACCACCTGCATAGATATTACCTGCCACATCCAATGACCCCGCAGGTCCGTTTTCGACAATCTTACCAACACCAACCCTGCCATCTTTGTCATAACTCATCACGACACTCTCGGTTGCTACGGTTGCTGAAAATTCGACACTTGTAAATTTATCAGACAACGTACCTATGATAGTAAATGACTTATTAGCTGGATAATTACCTGCCATATTAGCCGCTGAATTACTTAGAGTGTGTTGAGTTGTCCAACTGCCCGACGCACTTCCATTATCAGCAGTGTAGCTGGTACTACCTAGCGGGGCAACCTTAAAGGACAAGGTCATAATGTTCTTTTGGCTACCAGATAGTGTCATTGGGGCTATCTTAGCGTTTCTGACAATCTGGACGATATTAGGTGTTTCTCTCGTCCTTAGTGCTGTAAAGCTCAAAATAGGGGCGAAATACTCTATGACATTAATAGTAATATCTCTTGTATCTGACCATCTGCCACGACTATCCACGACACTGGCACGGATAGTAGCAGAGCCGCTAAAGTTCATCATGCCAAGTCTACCACCATTTGATGTTGTGACTTGGTTTCTATTGACAATTTCTGCCCTATACCCTGTGATAGATGAATCATAGCTACCTGATGCACCATTGAAAGAAACTTGAATATCAGAAATAATCTGCAAAAAATTATTACCACTTAACAAACTTCTAGCAACACCGTTGGCATCAGTAAGGGTAACACCACTAAAAGTAGGCTTGATATTAGCTGGCACGCTTGCCGTAAAATTGATTTGCTGTGTGCCTGTCTTTGTATTGCCGCTGTATGTGTCAACATATAGCGTACCTGTGCCACTCGTTGCGTTTGGTATATCATTGGCAAAGTCATTGGGAATAATCCAAGAATGACTAGCTCCAACATTTGATGCAATAGTCCCTGATTTAGACCCCCAGGCATATCTTAAAGTATGTGTAAAGCTATTGTTTTGACGATTGATGGTAATAGCTAAACTGCTACCAATAACTCCACTCCCAACACTCAAAGAGCTAGAGCGTGGGATAGTTGCCAAACCGATATTCCCCGACACAGTGATAACCCCATGTAGACCGTTATTAGGGTTAAACGTTGCCGAAAACGGAAAACTCTTTGTGCCGTCTGCGTTGTGTCCAACAGTTGTCGAACCACTAGCCATCAGAAATTCCTCGCCAGATGTTCGCCAACGAGGATTTGACGTATGTACTCTGCCACCATTAATGTCTAAACTAAGTGTACTATCTCCTTGCTCATTGCGTGTCAAGTAAGCACCTGTACGACTTACAGTTATTCGCCAATTGACAACAGTTGTGTTAGCATCTATATTTTGTGCGCCTGGCTCAATATACACATTTAAGTACAAAGACCCACTCGCATTACTAAATTTTGCCATTATCTATCCCTTTCTACCCAACATACCGTATGACATTCATGTCGACATTGAGATGATATTGTTCAGTCCTAAATTTACCAATCTGTACAGAGGCAGTAAAGATACCATTGTCGATATGGATAACACCTTGACTAATATACATTACTTCCTTCCCTGCCGAAAACATGGAAATTCTATCGCTTGACACTTTAATGGTTGAGCTTGCATCATTCTTACCGATAATCAAACCCTCGTTAGAACTTGACATATAAGTATCAATAAATGTTTTCAGCTCTTTAAAACCACCAAATTGAGTAACAAGCAAATCAATCCGTCTGCCTGCCTCTGCCAAGTCTGACTCTGCTTTGGCTCGGCTATCAGCATTTGATTTTACAAATGATTGATAAGCTTTCTCGAGGTCACTAAGCGCATTCATAGACGCCTTTGCTTTAAGCTCTGCATCAAGTATCTGCGCCCGCTCGTTTAGTGAATTAAGTTGCTCTTGGGTCAATGCTTGGTCCGCTTTTGAGTCAATCTGATTTTCTATGTCTTCTGGAGCTGATGATGGTGTCGTTGCAACAGTACCGTCTTCGAGCTGTGGGTCGCGGATATAGACCACATCGCCAACTTGCCACTGACTATTGCGGATGTAAAAAACAAACGACCACGTCGAGATGTGCTTGACTTTACCTGTCACAGCAAATCTCTGCCACTCAGTCGACACGCTTTGGTCCTTCATCCCAGATTCTATCGCCTCGGCTCCAATTGCGATAGTAACGGCTCGTGAACATTTAACATCAACTGCATAGGTCATTGTACGACCTTGCCAATGTGCTCCACGTAGGTCAACAAAAGGTCGGTGGAATCCTCCGCTCCCCGCCTGTGTACAAGTCGCTTTAATGTGATAACCACTTCGTGATGTCGGGTCTGCAATTCGTTCGTAACGCCACTGTGAGTTAGCGTTGTTTAAAGTATAGCTACTGTCGGTAAAACCAAAATTACGAATGTAGTTCCGTCCGCCAACCTCAATCTTTGCCCATCTATCAGCCCAGCGATACTTTGTCTTATCCGTACTATCAGCCTGGGTATAGTCCGAATAGTGTCCAATGTACCTCTGACCATTATCAGACGTGGTCAGACCTGTGCCGTCTGCGTTGTCAGAGTATGCAAAGTGCACATAAGGTGTACGACCGTCAGCACCTTTTGGTCCAGGTATTCCCTGGGCACCGTCAGAGCCTTTCCATTTAGTCCAGCGATAAGAGTTTGGATTATTACTGTCGGTAGCATTAAAGTCCTGATACATACCGATATAGGCCTTTGTCTGGTCTGTCTGGCTAAACCCTCCGCCAGCGGCATTGTCTGCATAGGCTATATGAGTGTATTGAGTACGACCATCAGCACCTTTCTCTCCTGGGATGCCTTGCTCACCTCTGACACCCTGTATACCTTGAATACCACGCGCACCAGTATCGCCCTTATCACCATATACACCAATAATGGCTGGCTCTGTAGTCTTGCTTGTGCCATCGGTGTATAGTTCTACTCGGTAATTCCAGTGATACCGCTTGGCACTTGTGATTGTCTGGGGTATAGTTGTCCAGCCCGCTGTACTTCTTGTCACCCCTGTTGAGGCTGTGGTAGCAAGATAGTAGTTCGTGACATTGGCAATCCCATTGCCATCTGCCCCCTTGATTAAAGTCCACTTATAGACTCTGTAATCTGTGCTGTCTACCTGCACATAGTCCGTGTATGTGCCAATGTATGTTTTATTGACACTATCCGTTGTTGAAAATCCCTGTGAGCCATTATTTGATGTGGCATAGGCAATGTGTAAGTATGGCGTCCGACCATCTACGCCTGCCTTACCTGCTATACCGTTTGCTCCGTCAGCCCCTTTTACAAGTGTCCAAGCATAATCAGATGGATTAGTACTGTCTTGGCTGTTAAAGTCCACATACATTCCTATATAGGAGCGATTAGAGGCACTTGTACTGAAATCAGTACGACCATCGCTAGAGTTGGCATAGGCAATATGGGTGTACTGCGTTTTACCATCTGCACCTTTTGCGCCAGGTAACCCTTGCTCGCCTTTTTCTCCTTGCAAGCCATCAAGTCCACGCTGTCCAGGGTCTCCCTTATCCCCCTTGTCGCCTTTTATTTTTGTCCATTTATATTTTCTTGGGTCTTGACTATCCATTGGCTCAAAGTCAGTATAGATACCAATGTAGAGTTTATTAACAGAACTATCTAAAGAAAATCCATCCGTACCTGTTGAATTATTAGCCCATGCCGTATGTACATAAGGGGTACGACCATCTTTACCTGGCGTTCCTGGCGTTCCCATAGTGCCATCCAAGACATTGACAAAGGAAATTTCATCAACCGCCACCTCATCGTTACCAATGTATGCTGCAACCGTCAATGTAACCGTATCTGTCACATCTGCTCCACGAACAGTGTAAGTCATGCCAGTTGTGACCGTACCATCTAGCGACCAACGCCAAGTGACACCAGAAACCACTGGCTTACCACCTCGATACAAGGACGGTGTAACCAGGCTTTGCCCAATCTGATTTTTGAAAATGACCCCGTTGTCTGTGGATAACTTAATAAGGTAGGGCTTAGATGCCTCAAATAAGCGCTCGAAAGCTGCCTGTATACCATCAGATAGATTGTTTTCAAGAGCCTTGAAATTGGCAAAGGTTGTTTGGTTGCTTGCTGGATTGGTAAAACTGATTTTTTGATGTGATACCCTTGCTTGTACAAGCAAAATAGGAGTAAAGCCCTCATCATAAATCCTGATAGTATCACCAATTTCAACATCAATAAAGCCATCCACTTCATAGGTCAATGCAGGATAGGCGTTTTTTCTAAGATTTGCAATAGCAGACGCCCTAATAACTGATGGACTATCACTATCAACCTCCATATCTTTCCTAATCCATTGGTCATTTGTGGTAGAACTGGTAAAAGTTGATGGATACATCTGCATTGACAATGGAGCGTAGAGCATATCTCCTTGCTGGTAAAACTCACGCACCCCATCCTTGTTATTTTCAGACCATTCCCCAAGGCTACCGATGGTTACAATTTCCTCTACTTCTTCCCCTTTACCATTTTTTACCGTTCGTTTCCCTGTTGGACGGATAGCATTATAGACACCTGTTTTATCAATCTTACGTGTGATTGATTTAAGATTTTTCCCATAGGTTAGCTGAATATCGTTTCTGACACGCCCTACCCCTTGATGTTTATCGTCGTTTTCATAATACACATTTACCTTAAATGATTTGATGGAACTATCAGCATTTAACTGCGTATCAAAATCAATCTCTGCATCAAACTTTTTGGCAAGACTTAGTAAGCGGGCAAGTTTGGTATCCTGCCCATCCCATTCTAGAGTCCGTTTTTGGTCCGAAATCTCATTGATACCAACGGATAAATGAGTGAAATTCAACAAATCCATTGCATTACAATACTCAACAAAAGACATGGCTTTAGTAGCCTTGTATGGGTTAGCATATTCATTGATAAGCTCAAGATTTAGGTTTTCACAATAGCATTTGATGGTTTGCTCATTTTCCTCAACAGTCATCACATTAAATACATAGCTTTTGCCGTTGTGTCTAAATGAGACAAAAGCACGTTCATTCAGCAAGTTATATGTTTTATTTATCGCTGTATCAGACTTTATAGCTTTCTTGTATACTGTAAATTCAAAAGTTGAAGACCCTGTTTCTAGGCTGCGTGTCCAAGTGTCATCATAGTAGTTTAAAGTTTCTTGTTTATCGTTATCAATAAATGCTACTTTTCTTAGATTTGCATCATGAATTGTTAATAGCATCACAACCACCTTTCTTCAAATTCTACTTTTACAGTCGGTTTATTTCTTACCCAGCTCGAGCAATAAATTTCCAACTGTGACTCTCCTTTTGGTATAGACAGTCTCCAACTAGACCCATCAACTAAATCAGAAGATTTAGACAAACCATCTACAGTTACACTATCGTTCTCACAATTAACAACGACATTAGACCCTATCATATAGCGATTGGGAATATCCTTTGTTCCCTGTACAAAATCTTTACGATAAACGATACTATCAATATAAGCATGATGGATGGCTGGTTTCCCTCCTACTGCACCTATTGAAACATGTATCTTAGCGGACTTTTTACCTTTTATTTCTGGTATGGTAAATACTGGATAACTCCCCCACCAAAAAACCTGCACTTGGTCATCATTTCGTTTTATATCTGACCACCCTCTTTCGGCATTAAACGGGTTATCGCTATCAAGATGAGTAGCATTAAAAGTCCAACGTTTTAATACATTAAATCCTCCCTTACCATCTGATGCTAAAAAGTTGTACTCGCTTTCTACGCCGATAGAGCGTTTATATGTCTCAACTCCATATAAAAACTGTCCTTTTTCGTCAGATACCATAACTTTAATAAAGCCGTATTGATTGACGGCACCAGCCCAAAATATCTGTCTCCACCAGATATATTCATTTAGCGACCCAGTTTGACCAGCGCTATCCAATGGTATATCCCAACTGACCGAACCAGCATGGTTAGGTCCGACACCAGCTCCACGATTACCCAGAGCTAAATGCGGGCGACCAAATTCATTTTTTACGTACAAATTCGTATCAAACGATTGTGAGTTGTCATTTAAAATAGCCGCATTTTTCTTCCCATCAGCAAAACCCTTGATAATTCCATTATTGGAAACATAATCAAATAAGATTTCTGACTGTTGGTAAGTCTGGCTATCCTCCTCCTCGATATTACCTAGCTCAATTGCACCAGTACTATTAACAATGCCGATATAACCATTTTCTGCATTATGCTTAACAGTAATGATTGGATTTGCTGGTACATTTCCATCATTTCGTAAGGTAAGCACCATCTTTTCGCCTATTACAGTTGCATTATCAAACTTACGATAAGTCGAGCTATGAGCAACGCCATCGGGTATGAGTAGCTTAAATTCTGACCGTTGAAACCAACGTGTTAAGTTATCTGGTGTAATATCATCCACAGGTATTCCCATATAATATTTATCTGGCTCATCCCCATAAACAATTTTTACTGGCTCTATCACATCAAGCACACCAGCTAACTCATGCTTTAATTGCTCTAAAATCATTACATCGCTATTTTTCATGTCAAATTTGATGATGTGTTCTTTAGCTCCACGTTTCACTTGCTGGATATTAACCCCTAAAGAAGGAGCGTCATCAGTTGTTACGCTCCTTTTGTTACCGATAGGGCGGATAATCTCTGTAATTCGCAAGTAGCGTGACAAATCAACACCGTTGAATGTCATTATTGCTGTCATGTGATTATTCCTTTCATTCTGTTTTCTCGTCTGGTTTGTTCTGCATGATATGTGGCATACTTACCACCAGTTTTGGCTACAAGAGTGCCATCGTCTAGTATCATCTCCGCTGGGCGTTGTACGGCTTTTTCTGCAATATCAAGAGCTTTCTCGACAAGGTTATTGGATTTTTCTTTAGCTACTTCAACGGTAGCTTTAATAGCACTCTCAAGGTCTGATTTGACCTGTACAACCTTAGATAGTTTCGTTTTACCGACACCTATCACATCCTCTGCTTTATAGTTAAAAGCGTTGATATGCTCATACATACCATCCATAGCTTTGTCAACATACTTAGTATTTTTCTCGATACCAACAGCAACACCCATCGGCAAGAAGCGACCAATTGCATCACGGAAAAGCCTGGATGGTGAGTGGATTTGCGCCTTGGCTTTTGCTGCTCGCTCTGCTTGTGCTACCAATGCATTTGCAGCAGCGGTAACAGAACCGATAGATGACATCATCCCCTGCGCTAAACCTTGACTTATCATGCTACCTACCACACGCATAGAACTAACGCCCTGCATACCTGTGTCACGGATTGCAATCATCATAGCGTGCATAGCACCGCCAGCTTGACCAATTCCAGACCGAATACCTGTAACAACACCTTTTGTCGTACCGTCCCCTGCTTGTTTACCAGCCTGTATCATCTGATTGGCGGATAAACTTATTGCATTTACTATCTGTGTCATACCACTTTTTGTACCTGATACTGCCAGTTGAACTCCTGCGACAAGCATAGACATTGCGCTAACTGCAACATTTCCTAAAGATGCTAAAGAACTAGAAGCAATGGCACTTACTGATTGCACTGTCATCAAACCTTGAACAATAACACTCAAAGACGAACCAGCGCTAATAAGTCCACCAGATGTTGCTCCTATAGCCCCTAATCCAGCGGCAACCGCAGCTAGACTTGCTCCCATATCAAGTAGATTAAGTTTGGTTATACGTTCTATCCCCTGCGCTAATTGATTGAAACCTTTACCTGCATTTAGAGCTGCATTGCCAATACTGTCAAAGATACCTGCAATGCCATCCAAGACATTACGAATGGCAGAGCCAAATGACTCCACAACCCCACCAACGCTATCTAAGATAGATGTGATTTGTTCGCCAAGTGTTTTGAATAGGTTTGCGATGCTGTCAATGATTGGGCTAATCTGACTAATGAGATTGTTGAATGCCTCAACCAATGCTTGCAACACTGGCGCTACCGCCTGCACCATCTCACTAACTGCTGGAATGAATGGAGCAAGAGCCTGTATAATCTCCACAATAGCTTGTGATACAACAGTTACGACCTGTACAAAGGCATTAGAGATGATTGCCACAATAGGGGTCACAGCCGTAGCAATTTGAGCGATACCAGAACTGATAGCAGTAATGACTTGGCTCAATGCTGTACCTAGTGCTGTAATGACTGGTGCAAGGCTACTGAATGAGCTGACAATCATACTGATTGCCGCTCCTGCCGCTATAATCACAGGAGATAGCATTGCAAAAGCTGAGGCAATGGTAGGTAACACAGGGGCTACAATAACCAAAGCCTGGGCCAAGCCTTGTAGTGCTAGATTGAGGATAGTCCCTATAGCAGTACCAACGCTGACAATAACACTCCCCACACCTTGTAGGATTGTAGCTATCCCTTGTCCTTGCATACCCATTAGGGAAAAGGCTGCACCAAGTGCCAAGATAGGTACTGCTAAGGCTGCGATAGTAGCAGGATTGACCATAGCCAAGCCTTGACCAATACCACGAAAAGCGGCACCTATGCCCTGTCCAATTCCTCTAGCAGCAGTTGCTACACTTTTACCAAGGCTACGGATAATTGAGACTACGCTTGCACTAGCTGACCTAACAACTGATGTAGCACCGCTCACACCGCTTGTGGCATTTTGTTTGAATAGGTTAAATGGGTTAAAAGACTTCAAAAAATTAAAAGCCTTAAATGCTACTAATGCACCACCGATACCAGTTACAACACCACGCCAAGCGTCACCACTCATGGATTGGGAAAATTTAGCTACCGATTGGATGATTTGAGCGATAAACTTAACAACATGCCCAGCGGCTGCCCCGATGGTTTCCCATGGGATAATGCCAGATAACTTTTCTGACAAGTCAAGCCCTGCTGTCAGCAACTCTGATAAGGCACTCGATAATACCTTGATAGCCCCCGTTTTCTCAAAACCTTGGTAAAAGTCTTGAAAAGCCATCACCATGTCACTAATCGAAAAAGTGATTAGGTCAATGACCTTTGTAACGCTATTTAAAGCATCTTCTGGTAATAGACCTTTTAAACCGTTAACAAGAGCAGGCTTAGCGCTGGCTATAAAGGTAGACAGAGCCGTTGGGAGGCCTTTAAAAACATTAGCAATCATTGGGATAAAGTTCCCAAAGAAAAACGTTGAGGCACTTTCTGCCAATGATTGCAATGGCTTTGTAATATCACCGCCCGTTGTCAAGTTTCCGAGGAAATCGTTAAAAGCCCCTTTCATCATTGACAAAGAGCCAGAAAATGTTGTAGAGGCCTCTTTCATTGTTGTACCTGTGATGTCTAGTTTCTTCTGGACAACAGAGATAGCCTTTACCATGTTGGCGAAAGACATATTGCCTTCTTCAACCGATATACCAAGCTCATCTTGTATATCTTTATAAGAGGAGGCATCCTTAATAAGCCTTTCCATTTCTGCCTTAGTACCACCATACCCTAGTTTTAAGTTGTCTAGCATAGCGTAGTTACCACGAGCCAAAGATTGATATGTGCCAGTAATAGCCTGCATATCAGTACCCATCTTGTTCGCATTGTCAGACATATCTGTCATGGCTCTGTTTGCCAATTCAGCAGCGGCTGCTGTATCTCCGCCTAAAGAAGAAATCAAACTAGCAGAGAACGAGGTTACGTTTTCCATGTACTCATTTGCTGAAAGCCCTGCTGTCTTATAGGCATTGCTTGCATAGTTCTTTACGGTATCCGCTGAGTTCTTGAAAAGAGTATCGATACCTCCAAGAGACTGTTGCAGTTTCGCTCCCTCATCAATAGCTGATGAGAAAACATTCTTGACAGCTCCGCCAAGGGCGGTAAATCCACCAATTAAAGCACCGCTAACTAGATTTGCACCCAACATTGATTTGAATGTTGAGCCAAGCCCACCTAATGCACCTTTTAACTTTTCAATGCCTCCCTGTGCTTGTTTACCGTCTAGGTCAACCGAAAGGTTACTTTTCCATCTGCCATGTGTTACCTCCTTTCCCTGTTAAATATCGGGTAATGCGTATTCTTCTTGTAGTTCACGCATTCTTTGTTTTTCCTTAGTGCTATCCCCTTTTGAGGGTTTCCAAGCCCTAATTTTCATCACTTCAACAAAACTTTGTGCCATCTGGCAATCCAGATAGTAAAGCGTTAAATTTCTTCCAATGCAGCTTACCTTGTTCCTCAATTCAAATCAATGTTATAGGCTTGCATAAACGATGAAAAAATGTACTCGCCATCATATTTGATGCTAAACAAGGGTTTATCATCGCTTTCTAGGTCATCTTTGGGTTTCTTTGGCATAACATTTCCCTCAATGTCATATCTATCAACCTCATCAATAGCTCTAGTGACTTGTATGTGCTTTTCAAATATTTCTGCATAAATTGCTAAAGCCTCTTCTGTATCCATATCTTTAAAAGTCACATCATCAGTTAGTTTTGCCAGCGCTAACTTAGGTTTTAATTGTGGTGGTATTTCTTTATTTCCCCACATATCAAAGACCCATAAGACCCTATCAAACGATAATAAAAGCTGATACTCTATGTTGTTGAGTACCAGCTTGTCATCCATTTTTTTGGAAATATCAAACATTATTCAGCAAGATACTTCTTAAATGTTTCATCGTTTTCTTGTTTTTTCTTAGTTTCCATGATAGCCTCTGAAATCTGCAAGAATACCTTGAGATAAGCCCAAGTGTTTTCACTTGCTTCTTGGTAGATTTTGGCTGGGGCATCCGCATCAAACATTGTGCTAAAGTATTCATCCAGCAACTCTTTGATGTTCTTACGATTTTCCCACTCATCGCCCTCTTTTATGTTGTCAGCTTTAGTCTGCAACTCGATAGCTTTTTCAGACACTTCTTGTGATTTTGCGTCGGTTGGAACGAACTTCAAAGAAAGCTCACCGATGTTGAAAATGATACTTTCATCATTTCCTAACAGATTAAAAGTATTTGCCATTTCTATTTCCTCCAAAAATTCTTATCCACCCACACCTGCAATAATTGGTTTCTTAATCCACTTAAGTGTGCAACCAAACTCTTCGTAGCTTGTTGCATCTCCAGAACCAGCTTTGATTTCAGAAACATTTGCGACTTGGGTATAAGTTTTTTTCTCATTTGACTCTGTCACACGATGCCATACACGGCGCGCATCACCAGTTTCGTACTTCATCGCTGCAATCATAGCTTGAGCGGCATCATCTGGGTCGTATGACCCAGAAACAGAATATGCGCCAGAGACACTAATGACGGTTTCTTCTGGAGTCCCATCACCGTCATAGTAACCAGTATCATCCGTTTCTTCATCTGTTTCATCATCGATAGTTTCAATGTATTTGGCTAGTCGTTTCCAAGCCTCTTCTCCTGGTACAACTGTTGGATTTTTGGGGTCAAATGGCGCAATCTCGTGTTTACGTTTGGCATTTTTATTCCGTACCATTATTTATCCTCCTGCTACTTCTAGTTTTGCGGTTACTTGCATCGAATAAACAAAGTAACCTTGTTCATCTTTGCCATTGATACCTGGTTTGCCCACTGTCAATGACAAAAAGGTATAAGAGTTGTCTGTACTAGCTAGGTCAATGTCAAAGTCTGACAAGTCACCGTTTAATAGCCAAATAATGTCATTGGCTACTGCATTTGTTTTGCTCTTTACAGCAATTTCAAATGGTAGTGATACCTCTCTAGTACCATCCATATACTCTTTGTCAATAATTCCACCACTTAAAGCATTAATAACTAAATCATCTTTATCATCTTCAAAGTAATCTATCCTTGCTTTTAGTGGCAGGTCTTTGATGTTGTTAATGTGTGCTAGTAGCACATTTTGAAAGTTCTTGTTGTTTTGCATTTTATCTAATACCCATTCCTTTAATAGCTGCTTTTTTCAGTCTTTCTATATTTGCTTTTAGTGGTTTATCCCACCGTTTTCCAGTACCAGATGTTGTGTATTTTTTAAAAACAACAATCCCATTAGTACCGTGAAATTGAGCTCTGGCATAAACCGTGTTATAGCTCGCATCTCCATTAGGCTCTACACGCCCAGAGGCTCTTAAAGCCCCTCCACCTGCCCTAAGAGGCACTGAGCTATCCATAATAAGCAAAGCCTCACTACCTGTGGCAATCTTGCCACGTTGCATAGCTTGAGGCGACACTTTTCTCTCTACACCATCAAGGTTTACTGTTACTTTGACATCAGCCATCAGATAACCTCTATCTCATAACTAAAGACTTTACCATTAAGGTAATTTGGTTGATAACCTATTACAAGGTAATCACGTTCCCCATCGTTTACAATTGCACCCAGCCAACTCTCGTCAACTGTCACATTTGCAAGCTTAGGGTAAATGTATACAACGCCTACTTTCTGTCTGGTTTTAGAGTTGTTTGTACCTATAACTGCCACCGACCTATCAAACCTTACTGACTTAATATCCAATGGGTCAGAATACGTTACATCTCCAAAATCATCTTTGCCCTCAACCTTACGGACTTTAACAACATCTTGTAAAAAGCGTTTATCTATCATATTCAACTCCCACAACTAGGCTAAAACCAGCTTGTTTTAGGGCGTTTTCAGCATCCAAGCAAAGGTTGAATTGCTGACCTGCTGAAATACGATGTTGACCGCCATAATCAATTTTTGTGCGACCAATAGAAACGCTTGTCATAGCTTGTTTATCATCGGCTGTCATGATGCCAGAGCTATCCAAATAAGCAATCTGAAATGCCATAGCCAGTTTGACAGCAGCTTTGCGATATTCAAACTCTTTTTCAAAGTTAATGTACCGTTGGTAAATGCCTTGAGTATAGAGATTGATAGCAATTTCTGCTCTTTTAGCCAGCTTGTCAAAGTCAGTTACATCATCAAAGCCTAAATCTTTAACAAACTCATCTTTAGTTAAATAAGGCATAGTAACCTCCCTTAAAAACAAAGGGTGTTGCCACCCCTTATCTATTCAGCAGCATCTTCTGATGCTTTAGTTTCAGCTTTTTTACTGCGTGAGACTGGTTTTGTCTCCTCAACCAACTCTAAAACGGCATCCACATTAGGAAATGTTGATTTGAGGTCATTATTGACTTGTTCAGCATAAGCTGGTTCAAGTTCAACAACTTCTCCCTCTGCGACATAGATACCCGGTGTTTTAAGAGTGAGATTTTTAGTAGCTTTGTACTTGTTCATCTGTACCTCCTAACAACTTAATCAACGCATCTTTGTCTAACTTAGAGTAGCCTTCTAAACCTCTTTGCTTAGCAATTTCTCTAAGTTCAGAGATTTTCATTTTGGAAATATCGTCATTATCAGACTTGTTTACCTTATAATGACGGCGCAATAACATCCCCATTACGCACCCCCAAACTTAACTACCTTTTTATCGTTATAGAGATATGCCCCGTAATACTCATCGCCAGTAATTACAGTTGTTTTCTTGATGATGTCACGGTCAGCTTCGATTTGCACATCACGCTTTAGATTGAGTACAAAAGCACCATAACGTTGGTCATGCTGGTTTTCTGTTTCATCGGCAGAGATTTTCACTAGGTAACCCTTGCCTTGCTCTACCTTTTTAGTGCGTACAATTTGTACCCCAGAAACCTCTCCGAATGTTCCAGATACAACCATGTTTGCACCCACTTCTGAACCACTCAACCAGTTCTTACCTGCATCCTTACGCAATGCAATGGCATCTTTAGGATTTACTAAAGCAACATAACGTGCATCTTCTTCATCCTCAAATACGGTTAGAGCCTCATCAATCGCATCTACTGTGGTTGGAGCGCTTGCAATATGTTGTGTAGCTGTTTTAGCTACTGCAACAAAGTCATTATCAATCTTATTTGCGATAGCCAAAGCAATTTGATGCCCTGCCTCTCCAATTGGGTCACCAAGACCAACCAAAACAGCCTTATCTGTAATTTCAACACCTTTACCAGCTTGTTTGATTGTCATAGTTGTTGTCTTTGTTCCAAGTTTATCTGTTGGAATTGCCTCACCCTCTTCAATATCGGTTGCATCTCCGATATATGTCCATTGAGGTACAGTGATTGTATCTCCAGCACCACCAACTAACTCACGTTCAATGTAAGCTAATGGTGCAAACTTGATAAGTTTCGGCAATTTCGCTGAAACAATGTCAGCTAGAACTTGTGGATTTACTAAATCTGATACTTTAGTTTGTGGCATGTCCTATTCTCCTTTCAATTTTTCGTATAGCGCTGGGTTGCGCTGACTTAGTTCATTGCGCTCCTTGTAGCCCATCTTGTCAAAATCAGCTTTTGTGATTTCTCCTCTGGCTGTTGCGGATGGGTTTCCAGGCAATACAATATTTGGGTTAGGTTTGTCATCATCTGCTTTGAAAAGATAGGGGTCACTTTCTTTTAGACCGTTGAGGATGTCATCTAGTTTTGGCTTGCCATTTTCATCAAGTTCAATGGCATCAACATCAATGAACTTCATCAAGGTTGATGGATTGTGTGCGGTGGTATCTTTCAATGCAAGATTGATAGCATTGACCTTTTGAGTTTGTGCAAGTTCAGCAGCCGCATCCGCTTTGTATTTGTCATATTCAGCTTGCAATTTATCAAGAGCTTCTTTCTGTTCAGCACTTGTATTTGCATCTGCTTTCAACGTTTCAAGCTGTGCCTCTGTGTTTTGCAACTGTGATTTAAGGCTATCTCGCTCTTGTGTGATAGTTTCCAAGGCTGATTTATTAGCATTTAAGTCTTTGCCATGCAAAGCAAATACATCTTTAGCCTGTTCCTCTGTCAATCCAAGTTTGAGCAGTTCCTCTGTTGTAAATGCCATTTGTACCTCCTTAGTTCTTTTTTAGGTGGACAACTCCCACCAAAAAGCAAAATATTATTTACTTTTTCAGTTTACTTTCTTTAGAATGGGATTTTTTACTGTTTTCAGCCCATCTAAAAAGGGCATTGCCAATGGCAACACCCAATCTATGTGTAAATCTTTTCTCTTGTATAATCTCGTGATAAAAATTCATGCTCATCAACAAGAGCTTTGATTTTCCCTTGATACATTCTGACCTTGAGTCTTTCAGCTTGTATCAGCTCATCATCCCCCATTGTGTGTGCATAATGTAACCTTTCTTTATGGTTCTTAATGGTGCGCTCTAATGCTCTTTGTTTAGCCTCGATGCGTGCATTTTCTTCTGCTTGTTCTGGTGTTAGGTCTTGCAAAAAGTCTGGTAGGTCTGGCAACTCGTTTACTCCGACAATGAAAGGCGTGAGGTAATGCCCACAATGGACACCAAGGCAACCACTAGCCGTGCCATATCCGTAATCTTGCAAAGAGTGTATGGTTATGCCGTGTTCTTTCCGCTCGCTCCCCTCTTTGGTAACAATCTTGCCCTGCAACGGGCTACAAGATGGTCTGGCTGTCCGCTTGATAGAGTAGTAATAAGTATCTATGCCTAGTTCTTCTGCTGGTCTAGTACGCATGTCATTATAGACCCTGTATGTGGTTGTTTTTATGATTGCCCTAGCATAGCTGTCTGCCCGCCATTCCCTGCCAGCACTATCCGTAAAGCCTGTAAAGTTCTTTTTCTGCCAGCTCATGATTGTATCATTTAAAGCTCTGTCAGCAGTCTTTGTACCTGACGCCACTTGTGCTACTGTCTGCTCTACTACCGATTTAAAAACAGCCTGTATGCTTACTGGTAGGGTTGAATTGATAAGATTGAGGTCATTTATAGCTTGCTGTGTGTAAGCCTCCAAGGCATCTGTCACACCGTTTCTGATTTTGCCATCTGGAAACTTGCCCATATCCTCCTCTAGTTGCTCCTTGGTATCCTTATAGACCTTTAGTCCCTCATTTGCTATAACATCCCGCAAAAGCTCTTCTGCAATGCCTGTGCGCTCGACAATGATTTTTAGATTGTCCTCATTTAGCATATACATATCATTCAGCTTTTCCAGTTGCCAAACGTATGGATTTTCCACAAGGTCTGCACTTCCACGCTCTTTCAACCGTTTTATCATGCTATCAAACAACTCAATCTGCATTTTAGAGTAAATATCACTCACAGCTTGCATCTGTAATGATAGTTGCTGGTCATTGATAGTTAGGCGTTTTTTTGTATCGCTCATGATTAAGCCTCATCTTCATCATCTACTGTATCTTTACTGTTTCCTACTGTATTTTGTTGACCTTTACCATATAATGCCAGCTCTGCATCGCTCTCTGGTGGTAATTCTCCATTGATTTCAGCAAGTTCTTTCTCTGCCTCCTCCTCTGTGATACCTAGGGTTTTCGCAATACCTCGTTTCTGCGTGGCAAATCCAGCCGCTACCATCTTCATCCAGTAGTCAAGCTCTGCATGTCTATCAGTAAACACGCCATCGTCAAGATTTACAGAAATATCATCAAGTTCTGGGATAGTGCCTCTATAGATACCAACAACCTTACCAAGCTCACACATGGACACGCAGAGTTCTTTGATGGATTGCTCCACCAATGCAACAATGCTATTACGCATTTGGTATGTATCAGAGTTTTCACTTACAATCTCTGTTGCCGTCTTAACTCCTTGACCATCAAAGGTAAACATGCCACTAGATACACCTATCTGCATTTCAAACAGTTTAAGCCCCTCTGAGATGGCTGATATATAATCAGATGACCTAATAGGTGTAGTGAGGTCAACAATACCCCCACTATCCATATTACCTGCCCCAACTTGCATATACACATTTTGCTCAACATCAAAGCGGCGTTTAAAAGCGATGTTACCTTGATTATCTTGTACCTTTAATTGTGTCATTTGCTCTGGCACAATCACGCGCCTTTGCCCCATCTTAATCTCCCACATAAATTCATCGTAGGTACGATTGATAAAATCAATGGTAGTTTTAGCATTGTCAAAGATTGATAGACCTAATGGGCTATTGATGTCTTTGTTGTTCATGCCCGGTGTCTTTAAGTAAGTAAATAATGGGCGTGATAACCCTTGAATTGGTGTTACTGGTTGCAAGTCTGGATATAACTCGCTCAAGTTCACACGCTCCCCTAATTGGCTATCAGATGTTGATTTATAAAGCTCATTAGTAATACGGTATAGGCTCTTATCTTTCGTACTACCAACTTCTTGCCCAGTTGGTGTTACCCACTCATGGAACTCAACAAGTGTATAGTACACATTCTTTCTATTTTCAGTTTTAATGGTCTTTGTTAAGATAGCAGCGCTTGATACATCCTGTGTATTACTTTGTAACGGCAAAAATACGGGCGCTTGAATAAATGCCACACGGATTTTATCGCCATCAACGTAAGGGCGCATGGCAAGACCACCAAGTGCCAAAGCACTCTCTAAATATCGCTCAAAGTTTTTGTTAAAGCGGTCATTAGAAAGCATATCACTCAAGAAATCATTAAGTGTTTCATCCTCTGCTGAAATCTCTGCTTGTTCGTTATAAACAAGGCTGGCAATCTTTTTAGCTGCCGTCCGTGCAATAGGCAAGTGTTGCATCTTCCTACGTTTTCTATCACCATCAGTATTCGTATACTCAATATCATCAAATTTAGATTGATAGTAAGCTAGGTTATGCTGTATCCGTCTAAATTCAGATTGTGTTACAGCTACTTTTGGATGGTCTAGGATGCTACTTAAATGTGATGTCGTCATGTTATACCTCCCACGGTTGAAAAAGTCCTTTACTTTTTGAATTAGGCTCATATTTTACCCTCCTTATGAATTACCAACACGCAAACTAAGTATCTTTGCATTGTCTAATACAAAATACTGTGCAACGTCGCATGTGTGGTCATCGTCTTTAATGACATTTGGGTTATCAGATTGGATTGTCTTTTCATCCCATCTATACATCTTGTGTTCTTCGATAAATACCTTATTGTTGTCTGTGTCCAGGTAGTAAAACCGACCTTGTGCTAAGAGTGACTGAAATGTGTCAATCATTGTCACTTTCTTTAATTTAGCTACTGGATGCCATCTAATCGCAAAATCAAGGTACATCTGATTTCTCAATGCCCCCTCTGCACTATCAATTGTATATTGCAAGATAGGTACTTTATACTTGCTGATAACTTTTGTGGTGAAATAGTAAATATCTTGTGATAACTGGCTAGGTGCTTTCTTGATTGCTTGACCTGCTGGGCTATAATACCAAGTATCAAGTAAGATTACTTTGCCTTTAGCTGTAACGCCAAAAGCACAACAAGCAGTGGCTGATTGTTGGTGTCCTCCATCAAGTGCAAAGGAAATACCAATCAGCCTATCATCACTAGGCAAGGCATCTAATGGGTGAAATGTGCTCATGTTATAGATATTATTACCAAGCCCTACTGGCTCGCCTAAATAGACATACCTGTAATAGTCGTAGTCATTTTCTTTTATACGCTCTATATCAGCCAGCATTTGCTCATTTACAAAACCTAACTCATCATCTAGATATGTACTAGAATGACACAAGTAATTATCCATTGTGTTCATTCTTTCATACCACTCATTTATCCAACTGTACGGATTTATAGGTGGATTATAAGACCAAAAAATCTGTACAAAGGGTGCAAGCGGGTGTTTCTGCCTCATAAAAGTAATGTTGGTTTGGTCAAACTCCTCTGCACTTGAAAACTCGGCAGCCTCCTCGTACCAAACAGCAATGATATTACCAATGTTGTTTGATTTCAACTTTTGATAATCATCCAGACCGTAAAAATAAAAGGTTGATCCTGTTTTTTTATGAGTTATCTTAAATGGGCTTACTGTCATCTTAAAGCGACTGGTAAGACCAAATAGACCTAGCCCCCATTGAATTTGATTATAGACACTATCCCTAATGGTATTAGCTACCTTACGGATAATAACAATGTTTGCTGTTTCTCCCCTAACGATGTACCAAACCATCATGATAATTAGCTTTAGAGTAATAACGGATGACTTGAAAGAGTTACGCCCACCTTTTAGGATGTTGTAAGGTTTCTTAGATAACCAAACGCTCTTAAAATGTGGATTTACATTTTTTTGAATATCAATTACTTTCATCCCCAACCTCCCAACTATCAATAATTGTGATGGTATCATCTTCAATCTGTGCCTCTGTCAATTGTGATTTTAATTTTTCAATCTCAAGCTCTAGTTTTTCAGACTGTTTAGCTGTTGGGTAGCGTTTTAAGATTTCAGTAATTGCTTTAATAACTGTTGCATTATCAGCTTTCTTGGTGTGTCTCTCAACTTTCCCTGTTGTTGGGTTAAGTATCAACACCTCCTCATCTCGTTTACCTCTAGCGATTTCAGAAAGGATATAAAGCGCCTCTGTGGCATCCATGATGTTTGACTTATGCAGCTCTTGCATCTGTTTATTGATGTACTCTTTTATCCCAACATTTCCCAACAATTCTGTAATGCGATTATTTGCATAATTCTCACTATAACCAGCTTTAATTGCCGATTGATAGCCGTTACCTGTTTTTATGTACTCATCTGCAAAGCGCCTTTGTCTTTCATTCATTAGATACCCCCTTTCCAACAAAAAAATCACAAGTATTACTACTCATGATTTCATTTTATAAGGTTGAAAAGGGGATGTTTTACGCTATTTTTGGGATATAAAATAAAAAGCCCCAATTAAGGGGCTAGGAAGTAACGTAGTAGCCCGGATTCGAACCGGAATCTCCTCCATCAAGGCGTAATCCCTATATACTACTCCCTACGTTTCTTAAGATAATTATACCACTCTGTATGTACTTTTTCAACTAGCTTTACCTCTTTCGTGGTAAGTTTGCTTGCTCCTTTTTTGCTGATTTCATATTCAGCATGGTTGTACCCGTGATGCGTGTGAGGTCTCATTTTCTGATGCTCATGGTCTAGGTCAACCTGCTTGCTCCGCTTATTGTCCTTATCAAAATAAACCATACTTTTAGGGGCATTCTTGTTTTTGTCAATAAGCACATACACACGCCCCTTGGTCATGGTTTCCATGGGGGTTTTCTGCGACCCACCTGCATTTTGAGTAACAAATTTTATATTACCCGATTGATGCACCGTGCTATACTCTGTACCATATTTCTTTTGCTTTTCGCTCATTCCAGAGCTTGCCCCTCTGCCTCCCATGTGTCCATCCTTTCTGTTGTATCGTTAGCAAAATAATAGACATCGATACCTTTATAGTCATAATCAATGTGACCGCCATAAACCAAAATTTTTTTTGGTTTCAATTTATCAATCATGGCATCCATGCCATCTTTCCATACCTTGATACGGTCTTTGCTTTTCTTGACACCAATTGTACTAACTGCAACAATGCTTTTTGTAGGTATGCCGTCAAAACAAAACTCATAGCTTTCTTTGTGAGACCAGGATACCGTGGGGATAACCGTATAGCCCCAGTTCTGCATCATCTGACCAATCAATCTTGAGCGATACACATTCCATACCTGCATCGCAAGTGGCATGTCAGTATAGAGGCTGAAATCTGGTGTAAGCACACAATCAAAGTCAGCTAGTTTATCAATATAAAAATCTGGGCGTTTCCAAACTCGTTCAAACTGGTAATCATCCAAAAAGAAGTGGATACCCGCCGAATAGTTAGGCTTGTTCAAAACATAGTTAAACCCTTGTAGTTTGGTTGGCACATGGTCTACTGGCTCAAGAGTAGGGATATTATACTTGCCAGCTGTGCGCGTGGCATCATAATCTAATAGGTTGTACTGGCTCAATGTGTTCTGCCTGTGATGTGGTTTTAATGTTCCCATGTTTCTCCTCCTGCAAAAAAGCCTATGTACCTTGATTATAGATACATAGGCTAGGGAATTTTTACTGTTATCTTTCCAAAGGGAGGTATTTATAGGTGGCGTAGAAATAGGCATCAAACCATTTATTGAGGTGGGTATAGGCTGGGCTGGGGCTTAGGAATAAAATCTTTTGACACGCTCCAATGACATTGATATTTTCATAAACATAGACCTCTTTTATAGTCTCAATCAGCTTTTCTTCTGAATTTTCCACATGTTCAGATGTCACCAGCTTTAGATTGACCAAAAATGTTGCCTGGTCTGTGTCATTCTTAACGAAACTATCATGTATCATCTGCTCTAGTACCGTCTTTTTAGGATTTTTCTTATCCCTCAAAAAATACCACTTGAGCCATGTGATTTCCCTGCGGTGTATGACTGATAAGCGCTCTATTTTCTTTTTTGTCATCTACTATCCTTAAAATCTGATTGATAAATATGCCCATCTAAATACACTGTACAATTTTCGATACACTCGTAAAGGTTCTCCCAAACTTCTTTACCATCCTTAATATCCAGTAACTTAAAACAGCCATCTTTTATCACAACTTGTGCTTTGCCTCTATCTTCCCATTCATCCCAATATTCCCAGTGGATAATGTCGCCCTCATAAATATCATCGCCTGTAATATCTTTCATATCAGAACATAACATTACATCTTTATGTTCAATTTTAAATTTGCTTAGACCTTGCCAGAATTGTACATAATCATTATAAAATGTAACATCATGGTCTTTACTAAATATAAAAATATAACCACCCCTTGTTTTTATAGGCGCTCTAAACTTCTTTATCAAGATATACCTCCTCAATATCAAATACCAACTGATAGTGTCCTTTTTCTTTACTCAATCCACCATAGACAAATGATAGCTTTTTAATAACCTTATGATTATCATCTGTCCAGATACCAGCATCTGTCATACCATCAATGATTGCTTTTACTGTCGGATATAGATTAGGTGGGTCTAATTTAGATTTGGTAGGGCTGTAAATTGTAACTGTAACCTCACAAGGATTTGAGGGGCTAAACGCAGCCCTCTTTTTATCCTTGTGTTTCATAGTGTTCCAATAAGCAAATGCTCTGATACGCTTAGTAACTTTAGCTTTATCTGTCTGATGCTGCCTGTCGTTACTGTTAATAACCATATTGAGGGCTTTTAGCTTAGTATTCCTCGGTAAAGAAAACTCAAACTTCATTCAATACCCCTGATTTGATTTTTAGCCTCTCCAAGCATCTTTGCTGTGTATTCAATTCCAGCAATAAAGAAATCATGTCCCATTTTTTCAATACCATTTGGCATTTCATCAAACTCTTTACGCATCATTTCAGTAGCAATATTAAGTGCTTTTTCCACAAAATCAACACCTTTTATCATCTCTTTTTTCTTGCGCTCAATGCGTTTTTTCTTTTGGCGTTTATTCATTATCGGTCACTCCTTTGTCTTTGCGATACCAGCGATGCTATCTTTATAAAAAACTGCTGATTTTCTTTCTTGTGATGAGACCCCAAAATATGTAAAAGAAATATTCAGAGCATTGGCCTTATAATCTTCAACATCTTTAAAATATGCTGTGTTTCCGTTTTTAAAATAGATTACAACATTCATCTAGCTACCTCCCTGTATCAAATAATCTGGTGCAACATCTCCAACCTTTAGGCTGTCGTATTGTTCTTTGGTAACAAGAAACTTACCGTATGCACCAACTGTAACTGTATAATGCCCATCAACGATTGCTTTTTCTGTAACAGTACCAACAATGGAGCCATCCGCACTGTCCACATCATAGATGATAACCGGTTTTCGTGCCTCCAGTTCATCAACTTGTTTTTGTAACTTATAGATAGCACTCATGCTAATTGCAAAAGTCAAAACTAGCATTACCATTAAGAATTTTATGGCATCTTTCATAAATTACCTCTCATCTGTACCATCCTTTATCCATGCCGCAACACACAAAATGTATAATGCTGCTACTCCTAATTCTGCATTTTTCGATAAAATCCAAAATGCAAATATAAGTAATACACATCCCATTACTTACCACCTAACTTATCAGCTATCTTGCTAATTGCTTTTGCAATCTGTTCTTTTAATTCAGGGTCTTTGATGTCCTCAATACCGTTAGCATCCCCTGTTTTTAGATTTACAGCAATTGTTCCAATGATTGTATCTACATCTTCATCATTCTCATTTTCAGCGTCATCATTAAATATTTCTTCGGCGCTCTTTCCATCCAAGATGTCCATCAAATCATGGCTAATATTGTGCATAACGTTAGCTGACTTAAATTTATCAATATCATTTGTCAAAAAACAGTACAACATTGTTTCTTTACTTACGCTATGTATTTTATCAGCAAACTCTTTCAAGTTCTCTACGATGGTTTCAGCTGATACTGTGTTTTTAGTTTCTTTAGTCATTGTTTGTTTCCTCCAAATTTTAAGCTAATACTGTGATGTGTTCTTGGTCTGCTAGTTGCTCTTTCAGATAGGCTGCAATGTTTCCTACTGCATCAGCTACCCAACGCTTGCCATCTGCCTCAAATAATGCCATCTGGGCTTGCTTGTCAATTCTAAAAACAAACAGGCTTGCTGGTTGTTCAACCTCTCCAAAGGTGCGATATGGGCGTAATAGAACTGGATTAGGCGCTTTGCCCTTAGCAAGACTTGCTACTCCAGTTTTAACAGTTGCAACTTGAGATACACCATTGTCCTCAATTTCTGCCCCATTTTCAATTTTCAATGCGCTAGCAAACTCTAGCAGAGCGCTACGGTCATTATCATCAATAAAGTTTGACTGCAACATGATATTAAATTGCTCTGATGATAGAAAACGCCCAAAAGATAGATCGGGAATGCGTGCTTTAACAGCAACAAGTAATGTGCGGTGCTCTAACTCATCGTTTTCAGACCAAACACAAACTTCATCATTTTTCTCAACTGCCACAATCAAACGTTGGTTTTTTAAGCTGTTGAGGTCAGTTTTTAGATAATCAACAAGACTTGTCAATGTTGATAATTCAAGAGTCCTTGGATAACGTTTAGGGGCAAGCTCTTTGAGATTGAATTTATTAGCATCGAAATATTCTGTGCCATCCTCAGCGGTAAGGATTTCCAATCCATGCTCGTTTAGTTCTACTGCATACTGCAAAGCTGCTTTAAGATTTTCTGTTGTCATATTAGTTACCTACTTTCTTTTTGTTGAAATCAATAATATCTGGTTTTTCTACTGCTTGCTGTTGCTCAATTTCTGCTACTGGTTGCCCAATATCTGTAAGGATTTCTCCGTTTTCATCAAAATACATTTGCCCAGGTACTGTGCTTTTTAGTTCATTTGCATGTACAAATCCTGTATCATAATCACGACCAACAAGGATAGTTGTCGCTACCGCATTTTGAGGCGCAAGTTTTGACTTAACATCCATTATGGTATCAACTACTGTTCGCTCCTCGTTGGATGACATTGTAAGAGTGATGGTTACTTTACGTTTGGCTTTTGCCTCTGTGTTTAGGTCAAGGATATTGTCAAAGACTTTCTCAAGCTCTTTATCTAGTTTTTCCTGTAAACCTCCATCTGCAATATGGGTCAAATCTAACCCAATTAGTTTTTTGTCCATGTTGACCTCCTTATTTCAAAAGACTTTGTAACTGCTGCAAGCGTTGTTGCTTTTCTAGTAACTGTTCATAAATTTCAGCCCTCACAAGGATATAACCAGTTAGGTCTTGCCCAGTGAGATTATCATCAACAAATAGCTCAAGTTGTTCTGAATGGTTATCAGCTTTGATGCCGTTATCTTGCACTGTGTGGTCAATGTCCTTTTTCCTCTTTGTAAAAGTGTTTTCAACCACCACAATATCTGTTTCATCACTTAAAAATGAGGATACTTGAGTTTTTAGAGCATCTGCAAAAGCATCAATCTCTTCAATTGTTGGAGTTGTAACATTTCTCTCAATGTCACTTACTCGATTTTGACTTATCCCTACCATTGGGGCAAGGTCATACTGTGTCAACCCAGCATCTTTCCGTAAAGCACGCATTTTAGCGCCATCAAATACTTTCATCTAAAAACCTCCACATTATCTCGATACCAATTACTCTTTATCACATGCTGGGCAATTTTGATTTGAGTATTATGGTCTTGGTAATATAAGACTTGTTCTTTTGATTTTTTGATTAGGTGGTTAGCCCATAAAACTGTAATTGCCAACCACGTTGTGCTAAGTAGTACAAGTGTAATAAGTAATAACTGAAATTGTGTCATGGTTGTTGTTCCTTTTCAAATTGGTTTAGTACGGTCTGAAATATCTCTAAAAGTAATTTTTGAGGTATGTTTGACCTCTCGTTGTATGATTTTGAGAATTTACCCCATTCAACCTCAGCTGGATTTATCTCATTATTGAGATTTAGAAAAAGGTTGCTTGCAAACTTGGTTGGCTTTTGCAATGGGTAATCATAATTGTTGTATCGTGTCGGGTTTTTGTGAGGTAAATGAAAGCCTATGATTTGCTCTATATATTTCCACAATCGACCTGTGGCTGGATTTTCAATAATCCAATACTTAGGCTTATACCTTTTTATGATTTCAATGGTATTAAAGGCACAAAGCTCACCATTAACTCTTTTCATAAATTGCCTATCATATTGGTAGTTTTGGTAAGCCTCCTCATAATCTTTGTTTGCTCGGATGGTAAACATACTAGGTGGTATTTGTGGTTCAAATAAGCTATCTGATAAATCTTCCTGTTTCCAACAAGCATTACCATTTGCCATTGCACTAGCATTTGACCAGCTTTCGCAAGGTGGACTAGCAATAATCAAATCTGGTTTTGGTAGCTCATCAAGCGTATCAAATAACTTGTTATCCCCAAATAGTCGCGAGTAATCAGCAAGATTGAGGGGGATAAAATGATTGTTCTTGTTTTCAATGTCTATTCCTATCGGATATACTTCAATCTTCGCCCCCCCCCGAACTATTAAGCGTGTTGATAGCTTTAGTGTATGAGCCATTACCACTATCAAACAGCGCCCATACTATCATTTTCTGCACACTATCACCCTCTCATCTTATTTCTGATGGTGAAAGGGTGTCTAGATGGTGCATTATCAAAAGCATCTAGAAATTCTTGATTGATTTTTCGGATATTGAAAGGCTCGTAAGCATGAAAATAACATCCATGATTGTCAAGTTCACCCTCAACACCAGTTGCCCAACTTAAAAATATTGCCTGTTTGCAAGTAGGGCATGTGATGCCTTTTCTATATGATGCTGTTTTCAAAACCTTACAAAACCCACAATATGGACATTGTAAATCAACTTTTACTTTGTTCATCTCAAATCTCCAATCCTAGAAAGGTAAATCATCGTCGGAAATATCCATAGGATTTGTAGTTTGTCCTTGGAAAAATGATTGTTGGTTGCTACGGCTAAAATCTGGTGTTTGTTGTTGATTTCCAAATGGAGACTGATAACCTTGGTTGTTTCCGTTTTGGAAATTGTTGCCTTGATTTTGGTAATTGCCTTGTTGATTTTGTTGACTATTGCGACTTTCCAACAATTGAAAACTACTTGCAATAACCTCTGTCACATACACGCGCTGTCCTTGTTGATTGTCATAGTAGCGTGTTTGAATGTTGCCTGTAATACCAATCAATGCGCCTTTCTTAGCCCAATTAGCAAGATTTTCTGCCGCTTGTCTCCAAATAACACAATTAATAAAATCAGCCTCACGCTCTCCATTTTCATTTTTGAATGGGCGATTTACTGCAAGGGTAAAAGTGGCAACTGCAACATTTGATGGTGTATATCTTAATTCAGCATCTCTAGTCAGTCGCCCTACTAAAATAACGTTATTTATCATCCTGCACCTCCTCTACCTCTTCTATTTTTATTTTTTTCCGCTCAATATCTGGACTAATAGCTTTTTCACCACAAAGTAGATTGATAATATCAGGAACAAAATCAACAACCGCTTGCCATTGATTTTCGCTTTCAACAATAAGACCAACATCTACTCCTCTATACTTGCCACTAACATAAAACTTAGGCATCTTTACCCTCCTATAAATCACTGTCTTTCACAAACACACCATCCACCATCTTTCCTGTACGGTCTTTAATTTCATTCCAAGCTGTCTCAAAGCATTGTTCCTTTGTGAAGTCGTAATACTTTGATATGAAATGTAACTTTAATACAATTTCTCGTATAATCAAGTTTGATTTGATTCCATGAGTTCTATTTGTTCTATTTAGAATTGCTGTCGATAGCTTTCCTATTAAACCTCCAGTTATTAAGCTCAATACTTCAATTTCTAACGTTTTTGGATGATGTATTGTAAGGCTGTCTGCTGTTAAAAATATTTCTCTAGCATCGAGATTAAGTTGCTGACAGAGTATCGTCAATACAACCATCACATCGCCGATACTATCTTTTATCAATGTAGTATTGTTTTTGGCAATACCAGCGTTTAACTCTCCAAATTCTTCAAATAGTTTCAACATCTGTTTTCTTGCATCAGACTTATCAAGACCTTTTGCAGATGACCATTTTTGGACATTCCCAATCAATTCACTAAAAGACATTGAATGTACCTCCTGCTAATTCATCTTGTGTCTTACCGTTGAAAAGCGTTTCTGTTGTTACCCCGTGCTGGTCAAAGAGGGCTTTGAAAAATTTAGCTTGTGGTATTCCACATGGAAAAGTTACACGGAAATCGAAAGTTGCTGGCTCGCTAGGTTCAAATTTAGGTACTTCCTGCGGTTTTTCTTGTGCTGAGGGTACATTCACCACAGCCACTTCCTCTGATGGCTCATTTTCGATGATTTCGCCCGTTTCTACATCAATAGCCTTGATGTTTGCATTGGCTTGTTCTTTTGCAAGTCGTTCAATATCTGCTTGACGGTCAGCATCTGCTTTAGCTTGCGCCTCTTGTTGCTCTTTGCGTAAAGCAATGGCATCACGGTCTGTTTTCATGATTTTAAGGACATCAACAAGTGATTTACCATCTTCAAGGTGTCTGATATATCCATCTGCTGGCAAATCGTACTCTTGAGCTTGTTCCTCGATAGCTTGTTTATTAGCTTTGTATTCTTCCAGCTTGTCAAATTCAGCAAGTACCAGTGCATCCATTTCATCAAGAGTTGTTTTCTTGAGTTCAAATTTACCTGTTTTGAAATACTTTTTAAGGCTGTACTCATCGTATTTGCTTTCAAATAGTGATTTTTCTAGCCCTGCCACCATACATTTATCTTCAAAGGTTGCACGGACAATATCAACACGCATCATGCGTTCATGCTCATCAATGGCATTTAACCCTGTTGTCATTTCAGCTGTGACAGCATCGATAGGCTCAATGACCTTTTCTTTCATCCACCGTTCAAACTCGGTAAGAGGCTTGTTAATCTCACGCTTAATGTCTTTGCGTTTATTGTCCAGCCCCTCTTTTAGCTTGTTAAAGCGGGTACGTTCTTCATAGACCGCTTTATAATTTTCAACGGTTACCTCTTGCCCACTATATTGAGCAACAGCGGCTGCTACTTGTGCCTCAATTGCCTCACGGTCAATATTGATTACCGCCGGTTGGAAATCTACCTTGATTTCTGTCAAGGCACTATTTGATATATCTTTTGCCATGTTTTTTCCCCTAATCTACATAGATTTTGATTTTGTTACCTTGTGTTGAATGCCCGAAACATAAATTGCCATCATCACAAACCAAAGCTAATTCTTTTGTTGTCAAATTAGGTACATTCTTATAAATCTCATACAAAGAATGCCCATAGCCACCGCCAGCACTACCATATACAACATCAACAGTTGCTTGGTCTTGTTCGCTCATTTTGTCGTAAGCCCATTTCTCCATGATAGCGTACTTATCTTTTAACTCTTTTAGAGCCGCTAAGTTGGACTGTCGTTTTTGACTTTCGTTTTCTGTAAATGCCCATGGTGAATAAATTGTATTTTCTGTCATGTAGTTTCTCCTATCTATAAGTTATTAAAATCGTTCTGCGGTTGTTTATACTTATCTACTTGTGACTTAATATGATGTACAACCGTATTAAAGTGTTCAACTGGTACTTGGTGGAAGTTTGTAATCCAATAGTGATTCAAATAGCCTTGTTCTACTTCATCAAATGGCTTATTTAGTGACTGTGCCAATGACCGTATCCAGCCGACAATCTCGGTGTACTGCTCATTGGTAATGTACTGGGCTTGTTCTTGCTGTTGGGGCTGGTTAGCCTGTCCTTGTTGGCTGCCCTGTGGTGCTTGTTGATTTTCGTCTGCTGGGTACTCATCAACATCTTTCTCGCCAATGGCAAACAGACCTTGCAAGGCATATTTCCTGGCGTATGAGCTGACCGCTCCTGTCCATTGTGGCTCTTGCATTTGCTTAATCTGCCCCTTTTGAGTATTAAACACTGGTACTGGGCTAAGTTCAGCAAATGCTGTTGAGCTGTATTGCTCATTGGTCTCATCGTTTAAGGCGGTAGCAACTGCTTTGATAAACACCTTGCCTGCAAGCTCAATCAGTTCATCTTTGACAATGACAGCCCAATCACTTTTAAGCTCTTTGAAAGCTGTATAGATGTCTTCTGCATTCCTGAAAGCGTACTTGACATCTTTTGACTTCTTCTTTACAAGTTGCATCTGTCTTTGTAATTCAGAAAATGTTAGTTCCGCCATAAACTAGTCCTCAATTTCTTCTAGTTTTTCCACAAAATCAACATATGCTTTATAAAAATCGCCAGACTTCTCGCTATCACGGTATGCTTTCTCAATCAATTCTTGACCTGTACCGTAGAAACAGCCAACTTTCCACATTTTGTTGGATTTTGTGTAAGTAAAGTGACGACCGCTTGACCAATGATTTTTAAAAACAATAATATCACCTAGCTCCGATACTTCGGCATTGCCCCATACTTTGGCATCGCCCGATACTTCGGCATTGCCCGATACTTTGGCATCGCCCCATACTTTGGCATTGCCCGATACTTTGGCATTGCCCGATACTTTGGCATCGCCCGATACTTCGGCATTGCCCCATACCCAGGCATTGCCCGATACTTTGGCATTGCCCGATACTTTGGCATTGTCCCATACCCAGGCATTGTCATAATGGCTTAAATTTTCCTCTTTTTGGATATATCCGCCTAAATCCCCCACCTCAACACTGCCAAAGCTAATCAAGGCACGAATACGAAATAATTTCCAGCCCCAAAAGCTGATTGTATCGTCTAGGACAAGTTCATATTTTTTTGTCATTTTGATTTCCTCCTGTGGATAACTATTTTGTCTTTTTATTTTTATTTACTATTAGCTTGTTGTTAATTAGTCATTATTGACTGTTAGTGCCGTAAGGCTTAGATTGTTTAATATTAGTAATTGTTATATAGTTAGTATTTATTAGTGGTGGGTTTTCCAACTTTTGGTTTTTCCATAAAATGGATTTTCAGTAAAAAGGGTTTTCCAACTTTTGGTTTTTCCATAAAATGGATTTTCAGTAAAAAGGGGTCTTACTCTTTTTCAGTTGTGGATAACTCTTTTTCTAACCTATCCTTGATATACTCAAAATAGCTATCTGTGATAGGGGTATCTTGAGCAAATACGAAAGTTTGTACACCGTGTTTCCCATCACTTTTTTTAACAACTCGTATATAACCTGTATTCTGTAACTCTCGGTATGCTTTTCTGTGAGCATCCCTACCGTTGGTTGACCTTTTTTCAAGTTCGCCAACATAGATACGCCAGTCTGATTTATTGGTTAGTATAGTCGCAAGTAATCCTTTTGCCTGCAAGCTCAACCTATCATCTTGCAAAAAAGCATTGTTCATTGAGGTATAATTGTCATGCGTATTCTTGAAAGATGTACTGCATTATCTGTTACCCTCCCGTCTATCCTCATTTATTTTTCTAAAGATTTCATACACGGGGTTATCATCTGGGATGACATACCCTGTAATATCATCCAATTCTGTACCGTCTGCCATTACATGGCTTACGGTATAATGCTGTTGAGCCATGCCTCATCCTTTCTAGCTTTTGCCAAAATTTCCAGAGTATCAACAACTGTAAGACCGACTAAGCTATTTATCAAAACCTCGCTTAATTGGTAGTACTTACGCTGCCAATTACTCACCAATAATTGTTGTGTGCTATCTAATTCTTTCATTCTGTGGTATAATTTAAGTAGTTATTTTTTTAACAAGTACCTCATTTGGATTGCCGTCCAGGGGTGCTTTTTTTGTATAGCCACTATATCCTCCTTTCTTGAGTTTAAGTTACTTGAACTTTTCTTGTAAAAAAATATTTTGGTATATCCTCTACCGCAAGTTCAAGCAACTTGATAGCTTTTTCAATTTCATCATCTTTCCAGCTGACCTTTCCGTTTAGTTTTAAGGAAATTGAGCGTTCAGACAATCCCATTGCGACAGCAAAGTTGGACTGTGTTACAAACTTTTCAACAATTCTGCCAGAAAGTTTTGAGAAATCTTTGACCATGCCTGTCTCCTTTCTTTTGTTTGGTTCAAACTTCTTGAACAACTACATTTTACACCTTTACATTTTCAATGTCAACAGAAAAATTCAATTTTTTTGAACTTTTTTATTGAACTTTTGTTCAAGGCAGGTTATAATATAGTAAGAAATACTATTAGGAGGTGGGTTTTATTTGCGAAATAGTACACCGTCAATAAGACTTAAAGAAATAATGTCTGAAAGAGGGTTAAAACAAGTTGATATTTTGGAAATGTCTCGACCTTATCAGAAAAAAACTGGTATCAAATTAGGAAAGAGTGCATTATCACAATATGTTAGTGGAAAGTCACGCCCAGATGATGATAAATTGTATTTGTTATCTCTTACCCTAGGGGTTAGCGAGGCATGGATAATGGGCTATGATATTCCCCAAACTCGCTTACCAGATGGGGAGCGTGTTTCTGCTAATAACCTTGATATAGTACCTATCTATGACAAATTGGAGAAATCAAGAAAGACAATTGTTTATGATTTTGCCGTTGAACAACTAGCAGAGCAAGAGAACAAGGTTGTATCAATCTTTTCTAAGCGACATGACGAGGATGACTATATCAATGATTATGTGCAAGGGATTGTTGCAGCTGGGCATGGTACTTTTCAAGAGGACAATCTCAATATGGAGGTTAAGCTACTTGCTGAAAAAGTGCCAGATAAGTACGATACTATTGCCCAAGTTGTCGGTGATAGTATGCAACCAATGATAGAAAATAATGACTTACTCTTTATTGAGGTCACCAGTTCGGTTGACATGAATAGCATTGGTATCTTTCAGATAAACGGCAAGAACTTTGTTAAGAAGCTCAAGCGTGACTACGGGGGCAGTTGGTATCTCCAAAGTCTCAATGATAGCTATGAGGAAATCTATTTAACAGAGGATGATGACATCCGCACAATCGGTGAGGTTGTGGGAATTTACAGAGAAGATTAAGGAGTTATGCGATATGAAAAAGAAAAATAAATTTAAGCTGTATTTTGGTATTTTCTGTGTCTTGGCATTCTTTGGCTGGGTAATGCAACTATTAGGGCTTGCACCTAAGACAGAAACACCTACCGTGCCATCCGTAACCGTTGAAACCTCCAGCAGCTCAAAAGAGGAGAAGACAGAGCAATCAAGCACAACTGAAACCAGTAGCTCTACCCAAGAAATCAAGAATGATGGTCCAGAGTACGACAAGGCAGCAAATGCTGAATTTGCCAACCACTTCCTGACCGAATTAAACAACATGCTTAGTGAAACTGGTATACAAGTCAATGTTGAATACTATGACAAAGGTCTAGTATATGTCTACCTACCACAAGATGCTAAGTATCTGTCAACTGTTGAAATACAAGAAATAGCCGATACCATCCTTGGTGCTAAAGAAAAGATTTTTACAGATTGGGCTATTGATAACGGCTTTGACCTTGGTTTTACCAACTCACCTACTCTGCATTTGAAAGCAGAGGATGGAACTACCTTAGCAGAAGAAAACAACTTCAATGAGACTATGACTGTCAAGGTCAAAAACTAA |
Streptococcus phage phiNJ2, complete genome | Streptococcus_phage(100.0%) |
Homologous phage analysis in the prophage regionPhage_Proteins_Besthit: Streptococcus_phage(100.0%) The bacterium proteins that are colored denote the protein is present at specific phage-related keywords (such as 'capsid', 'head', 'integrase', 'plate', 'tail', 'fiber', 'coat', 'transposase', 'portal', 'terminase', 'protease' or 'lysin' and 'tRNA')
Hit_Phage_ID:NC_019418.1 Hit_Phage_Def:Streptococcus phage phiNJ2, complete genome |
Column name | Description |
---|---|
Region | Detection method + the number assigned to the region, e.g. DBSCAN-SWA_1 |
Region Position | The start and end positions of the region on the bacterial chromosome |
Best matching Phage (blastn) | The phage genome with the longest aligned length with the predicted prophage region based on BLASTN searching (default:e-value=1e-10) BLASTN searching: Blastn the nucleotide sequence of the prophage region with our Virus database (10230 phage complete genomes collected from NCBI), phage_ncbi_refseq_def_info.txt |
Best matching Phage(blastp) | The phage taxonomy with the most homologous proteins with the predicted prophage region based on BLASTP searching (default:e-value=1e-7) BLASTP searching: Blastp the protein sequences of the prophage region with our Uniprot protein database (3,531,913 phage proteins collected from UniProt),uniprot_reference_phage_and_virus_TrEMBL_taxonomy_table.txt |
Prophage annotation | Click the detail button to show detail annotation of the prophage region, including Identified phage-like proteins and tRNA sites, and BLASTN matching result of the best hitting phage genome |