1. spacer 1.6|464229|33|AYPR01000020|CRT,PILER-CR matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 6, identity: 0.818
tctcccagcataccaaaccgctggcgaccatca CRISPR spacer
cgtcccagcaaaccaacccgctggcgaccaacg Protospacer
. ******** ***** ************* *.
2. spacer 1.6|464229|33|AYPR01000020|CRT,PILER-CR matches to NZ_CP013578 (Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence) position: , mismatch: 6, identity: 0.818
tctcccagcataccaaaccgctggcgaccatca CRISPR spacer
cgtcccagcaaaccaacccgctggcgaccaacg Protospacer
. ******** ***** ************* *.
3. spacer 1.6|464229|33|AYPR01000020|CRT,PILER-CR matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 6, identity: 0.818
tctcccagcataccaaaccgctggcgaccatca CRISPR spacer
cgtcccagcaaaccaacccgctggcgaccaacg Protospacer
. ******** ***** ************* *.
4. spacer 1.6|464229|33|AYPR01000020|CRT,PILER-CR matches to NZ_CP013572 (Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence) position: , mismatch: 6, identity: 0.818
tctcccagcataccaaaccgctggcgaccatca CRISPR spacer
cgtcccagcaaaccaacccgctggcgaccaacg Protospacer
. ******** ***** ************* *.
5. spacer 1.2|464226|36|AYPR01000020|CRISPRCasFinder matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 7, identity: 0.806
ggctctcccagcataccaaaccgctggcgaccatca CRISPR spacer
ggacgtcccagcaaaccaacccgctggcgaccaacg Protospacer
** . ******** ***** ************* *.
6. spacer 1.2|464226|36|AYPR01000020|CRISPRCasFinder matches to NZ_CP013578 (Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence) position: , mismatch: 7, identity: 0.806
ggctctcccagcataccaaaccgctggcgaccatca CRISPR spacer
ggacgtcccagcaaaccaacccgctggcgaccaacg Protospacer
** . ******** ***** ************* *.
7. spacer 1.2|464226|36|AYPR01000020|CRISPRCasFinder matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 7, identity: 0.806
ggctctcccagcataccaaaccgctggcgaccatca CRISPR spacer
ggacgtcccagcaaaccaacccgctggcgaccaacg Protospacer
** . ******** ***** ************* *.
8. spacer 1.2|464226|36|AYPR01000020|CRISPRCasFinder matches to NZ_CP013572 (Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence) position: , mismatch: 7, identity: 0.806
ggctctcccagcataccaaaccgctggcgaccatca CRISPR spacer
ggacgtcccagcaaaccaacccgctggcgaccaacg Protospacer
** . ******** ***** ************* *.
9. spacer 1.6|464229|33|AYPR01000020|CRT,PILER-CR matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 7, identity: 0.788
tctcccagcataccaaaccgctggcgaccatca CRISPR spacer
cgtcccagcaaaccaacccgctggcgaccaatg Protospacer
. ******** ***** ************* ..
10. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP021084 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI3, complete sequence) position: , mismatch: 7, identity: 0.774
acaggagagaccgatgaaaatcaacggcttc---- CRISPR spacer
ccaggagagaccgatgaaaaaca----cctcgtgg Protospacer
******************* ** *.**
11. spacer 1.2|464226|36|AYPR01000020|CRISPRCasFinder matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 8, identity: 0.778
ggctctcccagcataccaaaccgctggcgaccatca CRISPR spacer
ggacgtcccagcaaaccaacccgctggcgaccaatg Protospacer
** . ******** ***** ************* ..
12. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP025949 (Escherichia coli strain SCEC020023 plasmid pCTXM55_020023, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
13. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_KX928752 (Klebsiella pneumoniae strain CRKP-59-KPC plasmid pCRKP-59-KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
14. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP025626 (Escherichia coli strain SCEC020007 plasmid pNDM5_020007, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
15. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP028541 (Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
16. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_KT282968 (Escherichia coli strain EC012 plasmid pEC012, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
17. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_KT879914 (Escherichia coli strain HNEC55 plasmid pHNEC55, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
18. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_KP893385 (Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
19. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_KT185451 (Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
20. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_KT725788 (Klebsiella pneumoniae strain ST147 plasmid pCC1410-1, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
21. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_KT725789 (Klebsiella pneumoniae strain ST147 plasmid pCC1409-1, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
22. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_KR653209 (Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
23. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_KR259134 (Enterobacter cloacae strain ECL3786 plasmid pECL3786, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
24. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_KT002541 (Escherichia coli strain HeB7 plasmid pHeBE7, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
25. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_KR259130 (Escherichia coli strain EC3157 plasmid pEC3157, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
26. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_KR078259 (Escherichia coli strain YD472 plasmid pYHCC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
27. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_KR259131 (Escherichia coli strain EC3587 plasmid pEC3587, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
28. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP048368 (Escherichia coli strain 163 plasmid pC-F-164_A-OXA140, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
29. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_AP023191 (Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
30. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP040124 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
31. spacer 1.7|464299|31|AYPR01000020|CRT matches to NC_020278 (Escherichia coli strain 3A11 plasmid pHN3A11, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
32. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP042601 (Escherichia coli strain NCYU-29-69 plasmid pNCYU-29-69-2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
33. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP026131 (Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
34. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP045264 (Klebsiella pneumoniae strain 16HN-263 plasmid p16HN-263_KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
35. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP049351 (Escherichia coli strain 3R plasmid p3R-3, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
36. spacer 1.7|464299|31|AYPR01000020|CRT matches to KY130431 (Klebsiella pneumoniae plasmid pABC143C-NDM, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
37. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MK878892 (Escherichia coli strain J53 plasmid pMG333, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
38. spacer 1.7|464299|31|AYPR01000020|CRT matches to NC_025106 (Escherichia coli strain NMI5428/11 plasmid pMC-NDM, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
39. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP033962 (Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
40. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP041930 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374C, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
41. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP020510 (Escherichia coli strain 165 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
42. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_KJ020575 (Escherichia coli strain FP460 plasmid pHNFP460-1, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
43. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP033956 (Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
44. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP025470 (Klebsiella pneumoniae strain JS187 plasmid p187-4, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
45. spacer 1.7|464299|31|AYPR01000020|CRT matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
46. spacer 1.7|464299|31|AYPR01000020|CRT matches to MN007141 (Escherichia coli strain 91 plasmid p91_NDM5, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
47. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP027038 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncAC2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
48. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP036301 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
49. spacer 1.7|464299|31|AYPR01000020|CRT matches to MT066418 (Klebsiella pneumoniae strain ST11 plasmid p158590-KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
50. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP054942 (Escherichia coli strain MS6192 plasmid pMS6192B, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
51. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP025952 (Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
52. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP020515 (Escherichia coli strain 219 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
53. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP019260 (Escherichia coli strain 13C1065T plasmid p13C1065T-1, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
54. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP036372 (Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
55. spacer 1.7|464299|31|AYPR01000020|CRT matches to MK312244 (Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
56. spacer 1.7|464299|31|AYPR01000020|CRT matches to MK312245 (Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
57. spacer 1.7|464299|31|AYPR01000020|CRT matches to MK312246 (Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
58. spacer 1.7|464299|31|AYPR01000020|CRT matches to MK312246 (Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
59. spacer 1.7|464299|31|AYPR01000020|CRT matches to MK312248 (Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
60. spacer 1.7|464299|31|AYPR01000020|CRT matches to MK312249 (Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
61. spacer 1.7|464299|31|AYPR01000020|CRT matches to MN061455 (Escherichia coli strain EC-15-3 plasmid pEC-15-3-NDM-1, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
62. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP027055 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncAC2) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
63. spacer 1.7|464299|31|AYPR01000020|CRT matches to MN641485 (Escherichia coli strain SDCRK18-7 plasmid pNDM-SDCRK18-7, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
64. spacer 1.7|464299|31|AYPR01000020|CRT matches to MK312241 (Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
65. spacer 1.7|464299|31|AYPR01000020|CRT matches to MK312242 (Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
66. spacer 1.7|464299|31|AYPR01000020|CRT matches to CP052444 (Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-1, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
67. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP028796 (Klebsiella pneumoniae strain WCHKP040035 plasmid pKPC2_040035, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
68. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP041375 (Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
69. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP034324 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
70. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP040547 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
71. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP032242 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
72. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP039820 (Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
73. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP034254 (Escherichia coli strain IVRI Kol CP4 plasmid p1ESCUMpO83_CORR) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
74. spacer 1.7|464299|31|AYPR01000020|CRT matches to KY463220 (Escherichia coli plasmid pNDM5-IBAC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
75. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP044259 (Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
76. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP024836 (Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
77. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP026201 (Escherichia coli strain ECONIH6 plasmid pNDM-d2e9, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
78. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP039810 (Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
79. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP031802 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
80. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP034761 (Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
81. spacer 1.7|464299|31|AYPR01000020|CRT matches to CP038003 (Klebsiella pneumoniae strain SCKP020009 plasmid pKPC2_020009, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
82. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP028996 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
83. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP033404 (Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
84. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP040034 (Klebsiella pneumoniae strain KPC160117 plasmid pIncC-L117, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
85. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP027043 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncAC2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
86. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_AP018147 (Escherichia coli strain M217 isolate M217 plasmid pM217_FII, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
87. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP033159 (Escherichia coli strain CM IVRI KOL-1 plasmid p1ESCUMpO83_CORR) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
88. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP048372 (Escherichia coli strain 164 plasmid pC-F-163_A, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
89. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP041182 (Salmonella enterica subsp. enterica serovar Indiana strain SJTUF13520v2 isolate food plasmid p13520, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
90. spacer 1.7|464299|31|AYPR01000020|CRT matches to NC_019095 (Escherichia coli plasmid pXZ, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
91. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP040807 (Escherichia fergusonii strain EFCF056 plasmid pEF02, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
92. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP046117 (Enterobacter cloacae strain CBG15936 plasmid pTEM-CBG, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
93. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP017086 (Proteus mirabilis strain T18 plasmid pT18, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
94. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP036180 (Escherichia coli strain WCHEC025970 plasmid p1_025970, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
95. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP036306 (Klebsiella pneumoniae strain WCHKP020098 plasmid pKPC2_020098, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
96. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP041180 (Salmonella enterica subsp. enterica serovar Indiana strain SJTUF87912v2 isolate food plasmid p87912, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
97. spacer 1.7|464299|31|AYPR01000020|CRT matches to CP028790 (Klebsiella pneumoniae strain WCHKP020030 plasmid pKPC2_020030, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
98. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP024840 (Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
99. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP022157 (Escherichia coli strain ABWA45 plasmid pABWA45_3, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
100. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP047194 (Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
101. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP032166 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
102. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP023895 (Escherichia coli strain FDAARGOS_433 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
103. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP025458 (Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
104. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP034417 (Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
105. spacer 1.7|464299|31|AYPR01000020|CRT matches to MF918372 (Klebsiella pneumoniae plasmid p1512-KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
106. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP050367 (Klebsiella pneumoniae strain 47733 plasmid p47733_NDM_5, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
107. spacer 1.7|464299|31|AYPR01000020|CRT matches to NC_019073 (Escherichia coli plasmid pHN7A8, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
108. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP029381 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
109. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP017084 (Proteus mirabilis strain T21 plasmid pT212, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
110. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP026141 (Klebsiella pneumoniae strain F127 plasmid pF127_1, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
111. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP040029 (Klebsiella pneumoniae strain KPC160121 plasmid pIncC-L121, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
112. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP031122 (Providencia sp. WCHPHu000369 strain WCHPr000369 plasmid pIMP69_000369, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
113. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP047407 (Escherichia coli strain MS6193 plasmid pMS6193B, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
114. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP040541 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
115. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP026584 (Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
116. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP047161 (Klebsiella pneumoniae strain KP19-2029 plasmid pKP19-2029-KPC2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
117. spacer 1.7|464299|31|AYPR01000020|CRT matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
118. spacer 1.7|464299|31|AYPR01000020|CRT matches to MN822125 (Escherichia coli strain 14E509 plasmid p14E509-2FII, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
119. spacer 1.7|464299|31|AYPR01000020|CRT matches to MN865122 (Escherichia coli strain SCNJ06 plasmid prmtB_SCNJ06, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
120. spacer 1.7|464299|31|AYPR01000020|CRT matches to MN842292 (Klebsiella pneumoniae strain 12085 plasmid p12085-KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
121. spacer 1.7|464299|31|AYPR01000020|CRT matches to MN842293 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
122. spacer 1.7|464299|31|AYPR01000020|CRT matches to MN842295 (Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
123. spacer 1.7|464299|31|AYPR01000020|CRT matches to MN823988 (Escherichia coli strain 14406 plasmid p14406-FII, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
124. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP052879 (Escherichia coli strain C21 plasmid pC21-2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
125. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP043383 (Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid pNDM1_045001, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
126. spacer 1.7|464299|31|AYPR01000020|CRT matches to MF353156 (Escherichia coli plasmid pLZ135-NDM, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
127. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP012197 (Escherichia coli strain ECwhn14 plasmid pECwhn14, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
128. spacer 1.7|464299|31|AYPR01000020|CRT matches to AP023220 (Escherichia coli M505 plasmid pM505-NDM5 DNA, complete genome) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
129. spacer 1.7|464299|31|AYPR01000020|CRT matches to AP023236 (Escherichia coli YJ6 plasmid pYJ6-NDM5 DNA, complete genome) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
130. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP027067 (Klebsiella pneumoniae strain WCHKP8F4 plasmid pKPC2_095084, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
131. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP026579 (Escherichia coli strain WCHEC005237 plasmid pRmtB1_005237, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
132. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP034125 (Klebsiella pneumoniae strain BJCFK909 plasmid p2b2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
133. spacer 1.7|464299|31|AYPR01000020|CRT matches to MN419308 (Klebsiella pneumoniae strain 12478 plasmid p12478-rmtB, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
134. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_AP023198 (Escherichia coli strain TUM18780 plasmid pMTY18780-1_lncHI2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
135. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP050735 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 plasmid pST90-1, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
136. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP054782 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
137. spacer 1.7|464299|31|AYPR01000020|CRT matches to NC_016839 (Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS3, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
138. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP054764 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
139. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP038455 (Escherichia coli strain EC-129 plasmid pEC129_2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
140. spacer 1.7|464299|31|AYPR01000020|CRT matches to CP028547 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid pKPC2_020143, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
141. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP043936 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-4, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
142. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_AP018833 (Escherichia coli strain M309 plasmid pM309-NDM5, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
143. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP054728 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
144. spacer 1.7|464299|31|AYPR01000020|CRT matches to NC_010558 (Escherichia coli plasmid pIP1206, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
145. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP050770 (Salmonella enterica subsp. enterica serovar Indiana strain SI108 plasmid pSI108-1, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
146. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP054722 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
147. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_AP018137 (Escherichia coli strain M105 isolate M105 plasmid pM105_mF, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
148. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_AP018136 (Escherichia coli strain M105 isolate M105 plasmid pM105_FII, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
149. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_AP018138 (Escherichia coli strain M107 isolate M107 plasmid pM107_FII, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
150. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_AP018144 (Escherichia coli strain M214 isolate M214 plasmid pM214_FII, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
151. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_AP018139 (Escherichia coli strain M109 isolate M109 plasmid pM109_FII, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
152. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP023942 (Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed2) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
153. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP026589 (Klebsiella pneumoniae strain NUHL30457 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
154. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP027695 (Klebsiella pneumoniae strain KP30835 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
155. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP041439 (Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
156. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MK878893 (Escherichia coli strain J53 plasmid pMG335, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
157. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MK433206 (Klebsiella pneumoniae strain K15 plasmid pK15-FOS, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
158. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MN702385 (Escherichia coli strain LWY24J plasmid pLWY24J-3, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
159. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP045839 (Citrobacter sp. H12-3-2 plasmid pH12-2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
160. spacer 1.7|464299|31|AYPR01000020|CRT matches to MN262643 (Escherichia coli strain EC009 plasmid pEC009.2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
161. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP053082 (Escherichia coli strain HB37 plasmid pHB37-2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
162. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MH316135 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-16 plasmid pGDD25-16, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
163. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MH316136 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-21 plasmid pGDD25-21, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
164. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MH255829 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-CTX-TEM, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
165. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MH316133 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-3 plasmid pGDD25-3, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
166. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MH316134 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-5 plasmid pGDD25-5, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
167. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MH213345 (Escherichia coli strain EC1188 plasmid pEC1188-NDM16, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
168. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MH917284 (Klebsiella pneumoniae strain 397108 plasmid p397108-Ct2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
169. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_KY748189 (Escherichia coli strain EC007 plasmid pEC007, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
170. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_KY865323 (Escherichia coli strain SY286M plasmid pECM13, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
171. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MH329656 (Escherichia coli strain 92944 plasmid p92944-CTXM, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
172. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MH263653 (Klebsiella pneumoniae strain QL24 plasmid pKPC-QL24, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
173. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MK079574 (Escherichia coli strain TS62CTX plasmid pHNTS62, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
174. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MH161192 (Klebsiella pneumoniae strain SCKLB138 plasmid pSCKLB138-1, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
175. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MK036888 (Klebsiella pneumoniae strain 911021 plasmid p911021-KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
176. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MK036886 (Klebsiella pneumoniae strain 283149 plasmid p283149-KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
177. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MN197360 (Escherichia coli strain 5P plasmid pVSI_NDM_5, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
178. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MN218686 (Escherichia coli strain 5M plasmid pISV_IncFII_NDM-5, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
179. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MF133495 (Klebsiella pneumoniae strain 675920 plasmid p675920-1, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
180. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MF168403 (Klebsiella pneumoniae strain 12139 plasmid p12139-KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
181. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MG197488 (Escherichia coli strain 04NHB3 plasmid pHN04NHB3, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
182. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MF168404 (Klebsiella pneumoniae strain 20049 plasmid p20049-KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
183. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MF156713 (Escherichia coli strain 06028078 plasmid p28078-NDM, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
184. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MG197497 (Escherichia coli strain HNC02 plasmid pHNHNC02, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
185. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MF168402 (Klebsiella pneumoniae strain 1068 plasmid p1068-KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
186. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MG197496 (Escherichia coli strain AHC33 plasmid pHNAH33, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
187. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MG197498 (Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
188. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MG197503 (Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
189. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MG197495 (Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
190. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MG197499 (Escherichia coli strain HZMPC32 plasmid pHNMPC32, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
191. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MF156695 (Klebsiella pneumoniae strain 1642 plasmid p1642-1, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
192. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MF168405 (Klebsiella pneumoniae strain 64917 plasmid p64917-KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
193. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MG014720 (Escherichia coli strain A74 plasmid pA74T, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
194. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MF168406 (Klebsiella pneumoniae strain 283747 plasmid p283747-KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
195. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MG825381 (Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
196. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MF589339 (Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
197. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_KY748188 (Escherichia coli strain EC006 plasmid pEC006, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
198. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MG764548 (Escherichia coli strain 11011 plasmid p11011-fosA, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
199. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_KY748190 (Escherichia coli strain EC008 plasmid pEC008, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
200. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MG197490 (Escherichia coli strain FKD271 plasmid pHNFKD271, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
201. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MG197502 (Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
202. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MF344574 (Enterobacter hormaechei strain T5282 plasmid pT5282-Ct2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
203. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MG515250 (Escherichia coli strain 16-50 plasmid pNDM-EC16-50, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
204. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MG591701 (Escherichia coli strain EC36 plasmid pEC36-2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
205. spacer 1.7|464299|31|AYPR01000020|CRT matches to LN897474 (Klebsiella pneumoniae p397Kp plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
206. spacer 1.7|464299|31|AYPR01000020|CRT matches to LN897475 (Klebsiella pneumoniae p477Kp plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
207. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP018455 (Klebsiella pneumoniae strain SWU01 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
208. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP030132 (Klebsiella pneumoniae strain 160111 plasmid pIncAC2_L111, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
209. spacer 1.7|464299|31|AYPR01000020|CRT matches to MN823991 (Escherichia coli strain 140801063 plasmid p801063-FII, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
210. spacer 1.7|464299|31|AYPR01000020|CRT matches to MT109193 (Klebsiella pneumoniae strain 156070 plasmid p156070-KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
211. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP015725 (Salmonella enterica strain C629 plasmid pC629, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
212. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_LC506716 (Klebsiella pneumoniae strain JUNP053 plasmid pJUNP53, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
213. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_LC506719 (Klebsiella pneumoniae strain JUNP254 plasmid pJUNP254, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
214. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_LC506717 (Klebsiella pneumoniae strain JUNP054 plasmid pJUNP054, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
215. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_LC506718 (Klebsiella pneumoniae strain JUNP055 plasmid pJUNP055, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
216. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_LC506720 (Klebsiella pneumoniae strain JUNP268 plasmid pJUNP268, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
217. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MF150084 (Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
218. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_MF150118 (Proteus mirabilis strain A64421 plasmid pPM64421a, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
219. spacer 1.7|464299|31|AYPR01000020|CRT matches to MF554641 (uncultured bacterium clone AA-104 plasmid pFEMG, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
220. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP025463 (Klebsiella pneumoniae strain F44 plasmid p44-2, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
221. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP027200 (Escherichia coli strain WCHEC025943 plasmid p2_025943, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
222. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP031720 (Klebsiella pneumoniae strain SCKP020003 plasmid pKPC2_020003, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
223. spacer 1.7|464299|31|AYPR01000020|CRT matches to MT090958 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_vir, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
224. spacer 1.7|464299|31|AYPR01000020|CRT matches to MT108205 (Klebsiella pneumoniae strain 71221 plasmid p71221-KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
225. spacer 1.7|464299|31|AYPR01000020|CRT matches to MT108206 (Klebsiella pneumoniae strain A1743 plasmid pA1743-KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
226. spacer 1.7|464299|31|AYPR01000020|CRT matches to MT108208 (Klebsiella pneumoniae strain BJ20 plasmid pBJ20-KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
227. spacer 1.7|464299|31|AYPR01000020|CRT matches to NZ_CP040535 (Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-KPC, complete sequence) position: , mismatch: 8, identity: 0.742
acaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ttaggagacaccgatgaacatcaacgatgcc Protospacer
.****** ********* *******.. .*
228. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP041930 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374C, complete sequence) position: , mismatch: 10, identity: 0.706
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ggtttaggagacaccgatgaacatcaacgatgcc Protospacer
*. .****** ********* *******.. .*
229. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP027038 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncAC2, complete sequence) position: , mismatch: 10, identity: 0.706
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ggtttaggagacaccgatgaacatcaacgatgcc Protospacer
*. .****** ********* *******.. .*
230. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP027055 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncAC2) position: , mismatch: 10, identity: 0.706
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ggtttaggagacaccgatgaacatcaacgatgcc Protospacer
*. .****** ********* *******.. .*
231. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP031802 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ggtttaggagacaccgatgaacatcaacgatgcc Protospacer
*. .****** ********* *******.. .*
232. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP027043 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncAC2, complete sequence) position: , mismatch: 10, identity: 0.706
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ggtttaggagacaccgatgaacatcaacgatgcc Protospacer
*. .****** ********* *******.. .*
233. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP043383 (Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid pNDM1_045001, complete sequence) position: , mismatch: 10, identity: 0.706
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ggtttaggagacaccgatgaacatcaacgatgcc Protospacer
*. .****** ********* *******.. .*
234. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP041930 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374C, complete sequence) position: , mismatch: 10, identity: 0.706
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ggtttaggagacaccgatgaacatcaacgatgcc Protospacer
*. .****** ********* *******.. .*
235. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP027038 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncAC2, complete sequence) position: , mismatch: 10, identity: 0.706
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ggtttaggagacaccgatgaacatcaacgatgcc Protospacer
*. .****** ********* *******.. .*
236. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP027055 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncAC2) position: , mismatch: 10, identity: 0.706
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ggtttaggagacaccgatgaacatcaacgatgcc Protospacer
*. .****** ********* *******.. .*
237. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP031802 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ggtttaggagacaccgatgaacatcaacgatgcc Protospacer
*. .****** ********* *******.. .*
238. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP027043 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncAC2, complete sequence) position: , mismatch: 10, identity: 0.706
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ggtttaggagacaccgatgaacatcaacgatgcc Protospacer
*. .****** ********* *******.. .*
239. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP043383 (Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid pNDM1_045001, complete sequence) position: , mismatch: 10, identity: 0.706
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
ggtttaggagacaccgatgaacatcaacgatgcc Protospacer
*. .****** ********* *******.. .*
240. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP025949 (Escherichia coli strain SCEC020023 plasmid pCTXM55_020023, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
241. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_KX928752 (Klebsiella pneumoniae strain CRKP-59-KPC plasmid pCRKP-59-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
242. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP025626 (Escherichia coli strain SCEC020007 plasmid pNDM5_020007, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
243. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP028541 (Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
244. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_KT282968 (Escherichia coli strain EC012 plasmid pEC012, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
245. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_KT879914 (Escherichia coli strain HNEC55 plasmid pHNEC55, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
246. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_KP893385 (Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
247. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_KT185451 (Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
248. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_KT725788 (Klebsiella pneumoniae strain ST147 plasmid pCC1410-1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
249. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_KT725789 (Klebsiella pneumoniae strain ST147 plasmid pCC1409-1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
250. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_KR653209 (Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
251. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_KR259134 (Enterobacter cloacae strain ECL3786 plasmid pECL3786, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
252. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_KT002541 (Escherichia coli strain HeB7 plasmid pHeBE7, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
253. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_KR259130 (Escherichia coli strain EC3157 plasmid pEC3157, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
254. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_KR078259 (Escherichia coli strain YD472 plasmid pYHCC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
255. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_KR259131 (Escherichia coli strain EC3587 plasmid pEC3587, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
256. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP048368 (Escherichia coli strain 163 plasmid pC-F-164_A-OXA140, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
257. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_AP023191 (Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
258. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP040124 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
259. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NC_020278 (Escherichia coli strain 3A11 plasmid pHN3A11, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
260. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP042601 (Escherichia coli strain NCYU-29-69 plasmid pNCYU-29-69-2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
261. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP026131 (Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
262. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP045264 (Klebsiella pneumoniae strain 16HN-263 plasmid p16HN-263_KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
263. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP049351 (Escherichia coli strain 3R plasmid p3R-3, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
264. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to KY130431 (Klebsiella pneumoniae plasmid pABC143C-NDM, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
265. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MK878892 (Escherichia coli strain J53 plasmid pMG333, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
266. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NC_025106 (Escherichia coli strain NMI5428/11 plasmid pMC-NDM, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
267. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP033962 (Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
268. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP020510 (Escherichia coli strain 165 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
269. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_KJ020575 (Escherichia coli strain FP460 plasmid pHNFP460-1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
270. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP033956 (Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
271. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP025470 (Klebsiella pneumoniae strain JS187 plasmid p187-4, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
272. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
273. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MN007141 (Escherichia coli strain 91 plasmid p91_NDM5, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
274. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP036301 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
275. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MT066418 (Klebsiella pneumoniae strain ST11 plasmid p158590-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
276. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP054942 (Escherichia coli strain MS6192 plasmid pMS6192B, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
277. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP025952 (Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
278. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP020515 (Escherichia coli strain 219 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
279. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP019260 (Escherichia coli strain 13C1065T plasmid p13C1065T-1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
280. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP036372 (Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
281. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MK312244 (Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
282. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MK312245 (Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
283. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MK312246 (Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
284. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MK312246 (Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
285. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MK312248 (Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
286. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MK312249 (Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
287. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MN061455 (Escherichia coli strain EC-15-3 plasmid pEC-15-3-NDM-1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
288. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MN641485 (Escherichia coli strain SDCRK18-7 plasmid pNDM-SDCRK18-7, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
289. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MK312241 (Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
290. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MK312242 (Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
291. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to CP052444 (Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
292. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP028796 (Klebsiella pneumoniae strain WCHKP040035 plasmid pKPC2_040035, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
293. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP041375 (Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
294. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP034324 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
295. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP040547 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
296. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP032242 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
297. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP039820 (Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
298. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP034254 (Escherichia coli strain IVRI Kol CP4 plasmid p1ESCUMpO83_CORR) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
299. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to KY463220 (Escherichia coli plasmid pNDM5-IBAC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
300. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP044259 (Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
301. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP024836 (Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
302. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP026201 (Escherichia coli strain ECONIH6 plasmid pNDM-d2e9, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
303. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP039810 (Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
304. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP034761 (Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
305. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to CP038003 (Klebsiella pneumoniae strain SCKP020009 plasmid pKPC2_020009, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
306. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP028996 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed5, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
307. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP033404 (Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
308. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP040034 (Klebsiella pneumoniae strain KPC160117 plasmid pIncC-L117, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
309. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_AP018147 (Escherichia coli strain M217 isolate M217 plasmid pM217_FII, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
310. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP033159 (Escherichia coli strain CM IVRI KOL-1 plasmid p1ESCUMpO83_CORR) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
311. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP048372 (Escherichia coli strain 164 plasmid pC-F-163_A, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
312. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP041182 (Salmonella enterica subsp. enterica serovar Indiana strain SJTUF13520v2 isolate food plasmid p13520, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
313. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NC_019095 (Escherichia coli plasmid pXZ, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
314. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP040807 (Escherichia fergusonii strain EFCF056 plasmid pEF02, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
315. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP046117 (Enterobacter cloacae strain CBG15936 plasmid pTEM-CBG, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
316. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP017086 (Proteus mirabilis strain T18 plasmid pT18, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
317. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP036180 (Escherichia coli strain WCHEC025970 plasmid p1_025970, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
318. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP036306 (Klebsiella pneumoniae strain WCHKP020098 plasmid pKPC2_020098, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
319. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP041180 (Salmonella enterica subsp. enterica serovar Indiana strain SJTUF87912v2 isolate food plasmid p87912, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
320. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to CP028790 (Klebsiella pneumoniae strain WCHKP020030 plasmid pKPC2_020030, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
321. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP024840 (Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
322. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP022157 (Escherichia coli strain ABWA45 plasmid pABWA45_3, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
323. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP047194 (Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
324. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP032166 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
325. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP023895 (Escherichia coli strain FDAARGOS_433 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
326. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP025458 (Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
327. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP034417 (Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
328. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MF918372 (Klebsiella pneumoniae plasmid p1512-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
329. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP050367 (Klebsiella pneumoniae strain 47733 plasmid p47733_NDM_5, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
330. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NC_019073 (Escherichia coli plasmid pHN7A8, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
331. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP029381 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
332. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP017084 (Proteus mirabilis strain T21 plasmid pT212, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
333. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP026141 (Klebsiella pneumoniae strain F127 plasmid pF127_1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
334. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP040029 (Klebsiella pneumoniae strain KPC160121 plasmid pIncC-L121, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
335. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP031122 (Providencia sp. WCHPHu000369 strain WCHPr000369 plasmid pIMP69_000369, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
336. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP047407 (Escherichia coli strain MS6193 plasmid pMS6193B, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
337. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP040541 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
338. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP026584 (Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
339. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP047161 (Klebsiella pneumoniae strain KP19-2029 plasmid pKP19-2029-KPC2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
340. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
341. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MN822125 (Escherichia coli strain 14E509 plasmid p14E509-2FII, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
342. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MN865122 (Escherichia coli strain SCNJ06 plasmid prmtB_SCNJ06, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
343. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MN842292 (Klebsiella pneumoniae strain 12085 plasmid p12085-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
344. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MN842293 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
345. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MN842295 (Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
346. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MN823988 (Escherichia coli strain 14406 plasmid p14406-FII, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
347. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP052879 (Escherichia coli strain C21 plasmid pC21-2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
348. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MF353156 (Escherichia coli plasmid pLZ135-NDM, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
349. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP012197 (Escherichia coli strain ECwhn14 plasmid pECwhn14, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
350. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to AP023220 (Escherichia coli M505 plasmid pM505-NDM5 DNA, complete genome) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
351. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to AP023236 (Escherichia coli YJ6 plasmid pYJ6-NDM5 DNA, complete genome) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
352. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP027067 (Klebsiella pneumoniae strain WCHKP8F4 plasmid pKPC2_095084, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
353. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP026579 (Escherichia coli strain WCHEC005237 plasmid pRmtB1_005237, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
354. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP034125 (Klebsiella pneumoniae strain BJCFK909 plasmid p2b2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
355. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MN419308 (Klebsiella pneumoniae strain 12478 plasmid p12478-rmtB, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
356. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_AP023198 (Escherichia coli strain TUM18780 plasmid pMTY18780-1_lncHI2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
357. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP050735 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 plasmid pST90-1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
358. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP054782 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
359. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NC_016839 (Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS3, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
360. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP054764 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
361. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP038455 (Escherichia coli strain EC-129 plasmid pEC129_2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
362. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to CP028547 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid pKPC2_020143, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
363. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP043936 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-4, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
364. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_AP018833 (Escherichia coli strain M309 plasmid pM309-NDM5, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
365. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP054728 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
366. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NC_010558 (Escherichia coli plasmid pIP1206, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
367. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP050770 (Salmonella enterica subsp. enterica serovar Indiana strain SI108 plasmid pSI108-1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
368. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP054722 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
369. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_AP018137 (Escherichia coli strain M105 isolate M105 plasmid pM105_mF, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
370. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_AP018136 (Escherichia coli strain M105 isolate M105 plasmid pM105_FII, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
371. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_AP018138 (Escherichia coli strain M107 isolate M107 plasmid pM107_FII, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
372. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_AP018144 (Escherichia coli strain M214 isolate M214 plasmid pM214_FII, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
373. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_AP018139 (Escherichia coli strain M109 isolate M109 plasmid pM109_FII, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
374. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP023942 (Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed2) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
375. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP026589 (Klebsiella pneumoniae strain NUHL30457 plasmid p3, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
376. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP027695 (Klebsiella pneumoniae strain KP30835 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
377. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP041439 (Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
378. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MK878893 (Escherichia coli strain J53 plasmid pMG335, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
379. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MK433206 (Klebsiella pneumoniae strain K15 plasmid pK15-FOS, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
380. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MN702385 (Escherichia coli strain LWY24J plasmid pLWY24J-3, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
381. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP045839 (Citrobacter sp. H12-3-2 plasmid pH12-2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
382. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MN262643 (Escherichia coli strain EC009 plasmid pEC009.2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
383. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP053082 (Escherichia coli strain HB37 plasmid pHB37-2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
384. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MH316135 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-16 plasmid pGDD25-16, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
385. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MH316136 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-21 plasmid pGDD25-21, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
386. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MH255829 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-CTX-TEM, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
387. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MH316133 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-3 plasmid pGDD25-3, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
388. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MH316134 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-5 plasmid pGDD25-5, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
389. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MH213345 (Escherichia coli strain EC1188 plasmid pEC1188-NDM16, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
390. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MH917284 (Klebsiella pneumoniae strain 397108 plasmid p397108-Ct2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
391. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_KY748189 (Escherichia coli strain EC007 plasmid pEC007, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
392. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_KY865323 (Escherichia coli strain SY286M plasmid pECM13, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
393. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MH329656 (Escherichia coli strain 92944 plasmid p92944-CTXM, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
394. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MH263653 (Klebsiella pneumoniae strain QL24 plasmid pKPC-QL24, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
395. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MK079574 (Escherichia coli strain TS62CTX plasmid pHNTS62, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
396. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MH161192 (Klebsiella pneumoniae strain SCKLB138 plasmid pSCKLB138-1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
397. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MK036888 (Klebsiella pneumoniae strain 911021 plasmid p911021-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
398. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MK036886 (Klebsiella pneumoniae strain 283149 plasmid p283149-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
399. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MN197360 (Escherichia coli strain 5P plasmid pVSI_NDM_5, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
400. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MN218686 (Escherichia coli strain 5M plasmid pISV_IncFII_NDM-5, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
401. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MF133495 (Klebsiella pneumoniae strain 675920 plasmid p675920-1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
402. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MF168403 (Klebsiella pneumoniae strain 12139 plasmid p12139-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
403. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MG197488 (Escherichia coli strain 04NHB3 plasmid pHN04NHB3, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
404. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MF168404 (Klebsiella pneumoniae strain 20049 plasmid p20049-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
405. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MF156713 (Escherichia coli strain 06028078 plasmid p28078-NDM, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
406. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MG197497 (Escherichia coli strain HNC02 plasmid pHNHNC02, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
407. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MF168402 (Klebsiella pneumoniae strain 1068 plasmid p1068-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
408. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MG197496 (Escherichia coli strain AHC33 plasmid pHNAH33, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
409. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MG197498 (Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
410. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MG197503 (Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
411. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MG197495 (Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
412. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MG197499 (Escherichia coli strain HZMPC32 plasmid pHNMPC32, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
413. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MF156695 (Klebsiella pneumoniae strain 1642 plasmid p1642-1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
414. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MF168405 (Klebsiella pneumoniae strain 64917 plasmid p64917-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
415. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MG014720 (Escherichia coli strain A74 plasmid pA74T, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
416. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MF168406 (Klebsiella pneumoniae strain 283747 plasmid p283747-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
417. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MG825381 (Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
418. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MF589339 (Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
419. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_KY748188 (Escherichia coli strain EC006 plasmid pEC006, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
420. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MG764548 (Escherichia coli strain 11011 plasmid p11011-fosA, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
421. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_KY748190 (Escherichia coli strain EC008 plasmid pEC008, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
422. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MG197490 (Escherichia coli strain FKD271 plasmid pHNFKD271, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
423. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MG197502 (Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
424. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MF344574 (Enterobacter hormaechei strain T5282 plasmid pT5282-Ct2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
425. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MG515250 (Escherichia coli strain 16-50 plasmid pNDM-EC16-50, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
426. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MG591701 (Escherichia coli strain EC36 plasmid pEC36-2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
427. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to LN897474 (Klebsiella pneumoniae p397Kp plasmid, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
428. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to LN897475 (Klebsiella pneumoniae p477Kp plasmid, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
429. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP018455 (Klebsiella pneumoniae strain SWU01 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
430. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP030132 (Klebsiella pneumoniae strain 160111 plasmid pIncAC2_L111, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
431. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MN823991 (Escherichia coli strain 140801063 plasmid p801063-FII, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
432. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MT109193 (Klebsiella pneumoniae strain 156070 plasmid p156070-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
433. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP015725 (Salmonella enterica strain C629 plasmid pC629, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
434. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_LC506716 (Klebsiella pneumoniae strain JUNP053 plasmid pJUNP53, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
435. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_LC506719 (Klebsiella pneumoniae strain JUNP254 plasmid pJUNP254, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
436. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_LC506717 (Klebsiella pneumoniae strain JUNP054 plasmid pJUNP054, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
437. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_LC506718 (Klebsiella pneumoniae strain JUNP055 plasmid pJUNP055, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
438. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_LC506720 (Klebsiella pneumoniae strain JUNP268 plasmid pJUNP268, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
439. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MF150084 (Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
440. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_MF150118 (Proteus mirabilis strain A64421 plasmid pPM64421a, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
441. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MF554641 (uncultured bacterium clone AA-104 plasmid pFEMG, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
442. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP025463 (Klebsiella pneumoniae strain F44 plasmid p44-2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
443. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP027200 (Escherichia coli strain WCHEC025943 plasmid p2_025943, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
444. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP031720 (Klebsiella pneumoniae strain SCKP020003 plasmid pKPC2_020003, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
445. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MT090958 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_vir, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
446. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MT108205 (Klebsiella pneumoniae strain 71221 plasmid p71221-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
447. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MT108206 (Klebsiella pneumoniae strain A1743 plasmid pA1743-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
448. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to MT108208 (Klebsiella pneumoniae strain BJ20 plasmid pBJ20-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
449. spacer 1.3|464296|34|AYPR01000020|CRISPRCasFinder matches to NZ_CP040535 (Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
450. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP025949 (Escherichia coli strain SCEC020023 plasmid pCTXM55_020023, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
451. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_KX928752 (Klebsiella pneumoniae strain CRKP-59-KPC plasmid pCRKP-59-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
452. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP025626 (Escherichia coli strain SCEC020007 plasmid pNDM5_020007, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
453. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP028541 (Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
454. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_KT282968 (Escherichia coli strain EC012 plasmid pEC012, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
455. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_KT879914 (Escherichia coli strain HNEC55 plasmid pHNEC55, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
456. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_KP893385 (Klebsiella pneumoniae subsp. pneumoniae strain KP1034 plasmid pKP1034, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
457. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_KT185451 (Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
458. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_KT725788 (Klebsiella pneumoniae strain ST147 plasmid pCC1410-1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
459. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_KT725789 (Klebsiella pneumoniae strain ST147 plasmid pCC1409-1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
460. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_KR653209 (Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
461. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_KR259134 (Enterobacter cloacae strain ECL3786 plasmid pECL3786, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
462. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_KT002541 (Escherichia coli strain HeB7 plasmid pHeBE7, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
463. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_KR259130 (Escherichia coli strain EC3157 plasmid pEC3157, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
464. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_KR078259 (Escherichia coli strain YD472 plasmid pYHCC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
465. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_KR259131 (Escherichia coli strain EC3587 plasmid pEC3587, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
466. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP048368 (Escherichia coli strain 163 plasmid pC-F-164_A-OXA140, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
467. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_AP023191 (Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
468. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP040124 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
469. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NC_020278 (Escherichia coli strain 3A11 plasmid pHN3A11, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
470. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP042601 (Escherichia coli strain NCYU-29-69 plasmid pNCYU-29-69-2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
471. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP026131 (Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
472. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP045264 (Klebsiella pneumoniae strain 16HN-263 plasmid p16HN-263_KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
473. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP049351 (Escherichia coli strain 3R plasmid p3R-3, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
474. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to KY130431 (Klebsiella pneumoniae plasmid pABC143C-NDM, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
475. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MK878892 (Escherichia coli strain J53 plasmid pMG333, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
476. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NC_025106 (Escherichia coli strain NMI5428/11 plasmid pMC-NDM, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
477. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP033962 (Klebsiella pneumoniae strain L482 plasmid p3_L382, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
478. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP020510 (Escherichia coli strain 165 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
479. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_KJ020575 (Escherichia coli strain FP460 plasmid pHNFP460-1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
480. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP033956 (Klebsiella pneumoniae strain L39_2 plasmid p3_L39, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
481. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP025470 (Klebsiella pneumoniae strain JS187 plasmid p187-4, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
482. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
483. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MN007141 (Escherichia coli strain 91 plasmid p91_NDM5, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
484. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP036301 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
485. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MT066418 (Klebsiella pneumoniae strain ST11 plasmid p158590-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
486. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP054942 (Escherichia coli strain MS6192 plasmid pMS6192B, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
487. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP025952 (Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
488. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP020515 (Escherichia coli strain 219 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
489. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP019260 (Escherichia coli strain 13C1065T plasmid p13C1065T-1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
490. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP036372 (Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
491. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MK312244 (Klebsiella pneumoniae strain K199 plasmid pK199_KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
492. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MK312245 (Klebsiella pneumoniae strain K204 plasmid pK204_KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
493. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MK312246 (Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
494. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MK312246 (Klebsiella pneumoniae strain K230 plasmid pK230_KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
495. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MK312248 (Klebsiella pneumoniae strain K235 plasmid pK235_KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
496. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MK312249 (Klebsiella pneumoniae strain K239 plasmid pK239_KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
497. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MN061455 (Escherichia coli strain EC-15-3 plasmid pEC-15-3-NDM-1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
498. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MN641485 (Escherichia coli strain SDCRK18-7 plasmid pNDM-SDCRK18-7, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
499. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MK312241 (Klebsiella pneumoniae strain K187 plasmid pK187_KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
500. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MK312242 (Klebsiella pneumoniae strain K195 plasmid pK195_KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
501. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to CP052444 (Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
502. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP028796 (Klebsiella pneumoniae strain WCHKP040035 plasmid pKPC2_040035, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
503. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP041375 (Klebsiella pneumoniae strain KP58 plasmid pKP58-2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
504. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP034324 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
505. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP040547 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
506. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP032242 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
507. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP039820 (Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
508. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP034254 (Escherichia coli strain IVRI Kol CP4 plasmid p1ESCUMpO83_CORR) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
509. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to KY463220 (Escherichia coli plasmid pNDM5-IBAC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
510. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP044259 (Klebsiella pneumoniae strain KP65 plasmid pKPC-2-KP65, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
511. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP024836 (Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
512. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP026201 (Escherichia coli strain ECONIH6 plasmid pNDM-d2e9, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
513. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP039810 (Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
514. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP034761 (Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
515. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to CP038003 (Klebsiella pneumoniae strain SCKP020009 plasmid pKPC2_020009, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
516. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP028996 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed5, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
517. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP033404 (Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
518. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP040034 (Klebsiella pneumoniae strain KPC160117 plasmid pIncC-L117, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
519. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_AP018147 (Escherichia coli strain M217 isolate M217 plasmid pM217_FII, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
520. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP033159 (Escherichia coli strain CM IVRI KOL-1 plasmid p1ESCUMpO83_CORR) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
521. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP048372 (Escherichia coli strain 164 plasmid pC-F-163_A, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
522. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP041182 (Salmonella enterica subsp. enterica serovar Indiana strain SJTUF13520v2 isolate food plasmid p13520, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
523. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NC_019095 (Escherichia coli plasmid pXZ, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
524. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP040807 (Escherichia fergusonii strain EFCF056 plasmid pEF02, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
525. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP046117 (Enterobacter cloacae strain CBG15936 plasmid pTEM-CBG, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
526. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP017086 (Proteus mirabilis strain T18 plasmid pT18, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
527. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP036180 (Escherichia coli strain WCHEC025970 plasmid p1_025970, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
528. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP036306 (Klebsiella pneumoniae strain WCHKP020098 plasmid pKPC2_020098, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
529. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP041180 (Salmonella enterica subsp. enterica serovar Indiana strain SJTUF87912v2 isolate food plasmid p87912, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
530. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to CP028790 (Klebsiella pneumoniae strain WCHKP020030 plasmid pKPC2_020030, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
531. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP024840 (Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
532. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP022157 (Escherichia coli strain ABWA45 plasmid pABWA45_3, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
533. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP047194 (Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
534. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP032166 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed3, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
535. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP023895 (Escherichia coli strain FDAARGOS_433 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
536. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP025458 (Klebsiella pneumoniae strain KP69 plasmid p69-2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
537. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP034417 (Klebsiella pneumoniae strain C789 plasmid pKPC-CR-hvKP-C789, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
538. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MF918372 (Klebsiella pneumoniae plasmid p1512-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
539. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP050367 (Klebsiella pneumoniae strain 47733 plasmid p47733_NDM_5, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
540. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NC_019073 (Escherichia coli plasmid pHN7A8, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
541. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP029381 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
542. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP017084 (Proteus mirabilis strain T21 plasmid pT212, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
543. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP026141 (Klebsiella pneumoniae strain F127 plasmid pF127_1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
544. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP040029 (Klebsiella pneumoniae strain KPC160121 plasmid pIncC-L121, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
545. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP031122 (Providencia sp. WCHPHu000369 strain WCHPr000369 plasmid pIMP69_000369, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
546. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP047407 (Escherichia coli strain MS6193 plasmid pMS6193B, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
547. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP040541 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
548. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP026584 (Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
549. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP047161 (Klebsiella pneumoniae strain KP19-2029 plasmid pKP19-2029-KPC2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
550. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
551. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MN822125 (Escherichia coli strain 14E509 plasmid p14E509-2FII, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
552. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MN865122 (Escherichia coli strain SCNJ06 plasmid prmtB_SCNJ06, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
553. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MN842292 (Klebsiella pneumoniae strain 12085 plasmid p12085-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
554. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MN842293 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
555. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MN842295 (Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
556. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MN823988 (Escherichia coli strain 14406 plasmid p14406-FII, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
557. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP052879 (Escherichia coli strain C21 plasmid pC21-2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
558. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MF353156 (Escherichia coli plasmid pLZ135-NDM, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
559. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP012197 (Escherichia coli strain ECwhn14 plasmid pECwhn14, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
560. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to AP023220 (Escherichia coli M505 plasmid pM505-NDM5 DNA, complete genome) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
561. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to AP023236 (Escherichia coli YJ6 plasmid pYJ6-NDM5 DNA, complete genome) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
562. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP027067 (Klebsiella pneumoniae strain WCHKP8F4 plasmid pKPC2_095084, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
563. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP026579 (Escherichia coli strain WCHEC005237 plasmid pRmtB1_005237, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
564. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP034125 (Klebsiella pneumoniae strain BJCFK909 plasmid p2b2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
565. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MN419308 (Klebsiella pneumoniae strain 12478 plasmid p12478-rmtB, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
566. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_AP023198 (Escherichia coli strain TUM18780 plasmid pMTY18780-1_lncHI2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
567. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP050735 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 plasmid pST90-1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
568. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP054782 (Klebsiella pneumoniae strain KP20194a plasmid pKP20194a-p2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
569. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NC_016839 (Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS3, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
570. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP054764 (Klebsiella pneumoniae strain KP20194b2 plasmid pKP20194b2-p2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
571. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP038455 (Escherichia coli strain EC-129 plasmid pEC129_2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
572. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to CP028547 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid pKPC2_020143, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
573. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP043936 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-4, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
574. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_AP018833 (Escherichia coli strain M309 plasmid pM309-NDM5, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
575. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP054728 (Klebsiella pneumoniae strain KP20194e plasmid pKP20194e-p2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
576. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NC_010558 (Escherichia coli plasmid pIP1206, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
577. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP050770 (Salmonella enterica subsp. enterica serovar Indiana strain SI108 plasmid pSI108-1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
578. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP054722 (Klebsiella pneumoniae strain KP20194f plasmid pKP20194f-p2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
579. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_AP018137 (Escherichia coli strain M105 isolate M105 plasmid pM105_mF, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
580. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_AP018136 (Escherichia coli strain M105 isolate M105 plasmid pM105_FII, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
581. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_AP018138 (Escherichia coli strain M107 isolate M107 plasmid pM107_FII, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
582. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_AP018144 (Escherichia coli strain M214 isolate M214 plasmid pM214_FII, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
583. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_AP018139 (Escherichia coli strain M109 isolate M109 plasmid pM109_FII, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
584. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP023942 (Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed2) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
585. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP026589 (Klebsiella pneumoniae strain NUHL30457 plasmid p3, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
586. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP027695 (Klebsiella pneumoniae strain KP30835 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
587. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP041439 (Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
588. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MK878893 (Escherichia coli strain J53 plasmid pMG335, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
589. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MK433206 (Klebsiella pneumoniae strain K15 plasmid pK15-FOS, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
590. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MN702385 (Escherichia coli strain LWY24J plasmid pLWY24J-3, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
591. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP045839 (Citrobacter sp. H12-3-2 plasmid pH12-2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
592. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MN262643 (Escherichia coli strain EC009 plasmid pEC009.2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
593. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP053082 (Escherichia coli strain HB37 plasmid pHB37-2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
594. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MH316135 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-16 plasmid pGDD25-16, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
595. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MH316136 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-21 plasmid pGDD25-21, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
596. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MH255829 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-CTX-TEM, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
597. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MH316133 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-3 plasmid pGDD25-3, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
598. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MH316134 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-5 plasmid pGDD25-5, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
599. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MH213345 (Escherichia coli strain EC1188 plasmid pEC1188-NDM16, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
600. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MH917284 (Klebsiella pneumoniae strain 397108 plasmid p397108-Ct2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
601. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_KY748189 (Escherichia coli strain EC007 plasmid pEC007, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
602. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_KY865323 (Escherichia coli strain SY286M plasmid pECM13, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
603. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MH329656 (Escherichia coli strain 92944 plasmid p92944-CTXM, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
604. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MH263653 (Klebsiella pneumoniae strain QL24 plasmid pKPC-QL24, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
605. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MK079574 (Escherichia coli strain TS62CTX plasmid pHNTS62, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
606. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MH161192 (Klebsiella pneumoniae strain SCKLB138 plasmid pSCKLB138-1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
607. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MK036888 (Klebsiella pneumoniae strain 911021 plasmid p911021-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
608. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MK036886 (Klebsiella pneumoniae strain 283149 plasmid p283149-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
609. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MN197360 (Escherichia coli strain 5P plasmid pVSI_NDM_5, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
610. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MN218686 (Escherichia coli strain 5M plasmid pISV_IncFII_NDM-5, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
611. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MF133495 (Klebsiella pneumoniae strain 675920 plasmid p675920-1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
612. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MF168403 (Klebsiella pneumoniae strain 12139 plasmid p12139-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
613. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MG197488 (Escherichia coli strain 04NHB3 plasmid pHN04NHB3, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
614. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MF168404 (Klebsiella pneumoniae strain 20049 plasmid p20049-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
615. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MF156713 (Escherichia coli strain 06028078 plasmid p28078-NDM, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
616. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MG197497 (Escherichia coli strain HNC02 plasmid pHNHNC02, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
617. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MF168402 (Klebsiella pneumoniae strain 1068 plasmid p1068-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
618. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MG197496 (Escherichia coli strain AHC33 plasmid pHNAH33, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
619. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MG197498 (Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
620. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MG197503 (Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
621. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MG197495 (Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
622. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MG197499 (Escherichia coli strain HZMPC32 plasmid pHNMPC32, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
623. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MF156695 (Klebsiella pneumoniae strain 1642 plasmid p1642-1, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
624. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MF168405 (Klebsiella pneumoniae strain 64917 plasmid p64917-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
625. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MG014720 (Escherichia coli strain A74 plasmid pA74T, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
626. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MF168406 (Klebsiella pneumoniae strain 283747 plasmid p283747-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
627. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MG825381 (Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
628. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MF589339 (Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
629. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_KY748188 (Escherichia coli strain EC006 plasmid pEC006, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
630. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MG764548 (Escherichia coli strain 11011 plasmid p11011-fosA, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
631. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_KY748190 (Escherichia coli strain EC008 plasmid pEC008, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
632. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MG197490 (Escherichia coli strain FKD271 plasmid pHNFKD271, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
633. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MG197502 (Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
634. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MF344574 (Enterobacter hormaechei strain T5282 plasmid pT5282-Ct2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
635. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MG515250 (Escherichia coli strain 16-50 plasmid pNDM-EC16-50, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
636. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MG591701 (Escherichia coli strain EC36 plasmid pEC36-2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
637. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to LN897474 (Klebsiella pneumoniae p397Kp plasmid, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
638. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to LN897475 (Klebsiella pneumoniae p477Kp plasmid, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
639. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP018455 (Klebsiella pneumoniae strain SWU01 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
640. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP030132 (Klebsiella pneumoniae strain 160111 plasmid pIncAC2_L111, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
641. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MN823991 (Escherichia coli strain 140801063 plasmid p801063-FII, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
642. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MT109193 (Klebsiella pneumoniae strain 156070 plasmid p156070-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
643. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP015725 (Salmonella enterica strain C629 plasmid pC629, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
644. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_LC506716 (Klebsiella pneumoniae strain JUNP053 plasmid pJUNP53, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
645. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_LC506719 (Klebsiella pneumoniae strain JUNP254 plasmid pJUNP254, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
646. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_LC506717 (Klebsiella pneumoniae strain JUNP054 plasmid pJUNP054, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
647. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_LC506718 (Klebsiella pneumoniae strain JUNP055 plasmid pJUNP055, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
648. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_LC506720 (Klebsiella pneumoniae strain JUNP268 plasmid pJUNP268, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
649. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MF150084 (Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
650. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_MF150118 (Proteus mirabilis strain A64421 plasmid pPM64421a, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
651. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MF554641 (uncultured bacterium clone AA-104 plasmid pFEMG, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
652. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP025463 (Klebsiella pneumoniae strain F44 plasmid p44-2, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
653. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP027200 (Escherichia coli strain WCHEC025943 plasmid p2_025943, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
654. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP031720 (Klebsiella pneumoniae strain SCKP020003 plasmid pKPC2_020003, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
655. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MT090958 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_vir, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
656. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MT108205 (Klebsiella pneumoniae strain 71221 plasmid p71221-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
657. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MT108206 (Klebsiella pneumoniae strain A1743 plasmid pA1743-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
658. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to MT108208 (Klebsiella pneumoniae strain BJ20 plasmid pBJ20-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*
659. spacer 1.9|464299|34|AYPR01000020|PILER-CR matches to NZ_CP040535 (Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-KPC, complete sequence) position: , mismatch: 11, identity: 0.676
tgcacaggagagaccgatgaaaatcaacggcttc CRISPR spacer
gatttaggagacaccgatgaacatcaacgatgcc Protospacer
.. .****** ********* *******.. .*