Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_KK020676 Pseudomonas stutzeri KOS6 scaffold2, whole genome shotgun sequence 6 crisprs cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3,DEDDh,csa3,DinG 1 13 5 2
NZ_KK020678 Pseudomonas stutzeri KOS6 scaffold4, whole genome shotgun sequence 0 crisprs cas3,DinG,csa3 0 0 1 0
NZ_KK020679 Pseudomonas stutzeri KOS6 scaffold5, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_KK020675 Pseudomonas stutzeri KOS6 scaffold1, whole genome shotgun sequence 0 crisprs cas3 0 0 1 0
NZ_KK020677 Pseudomonas stutzeri KOS6 scaffold3, whole genome shotgun sequence 0 crisprs WYL,DEDDh,RT 0 0 2 0

Results visualization

1. NZ_KK020676
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_KK020676_1 209016-209262 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_KK020676_2 423094-423671 TypeI-E I-E
9 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_KK020676_3 424206-424968 TypeI-E I-E
12 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_KK020676_4 434713-434802 TypeI-E I-E
1 spacers
cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_KK020676_5 2366396-2366522 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_KK020676_6 2439974-2440146 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_KK020676_1 1.2|209187|47|NZ_KK020676|PILER-CR 209187-209233 47 NZ_KK020676.1 210025-210071 0 1.0

1. spacer 1.2|209187|47|NZ_KK020676|PILER-CR matches to position: 210025-210071, mismatch: 0, identity: 1.0

gtgctgtggggccaactcgttcgccgacttcaaacctcgaaagctcg	CRISPR spacer
gtgctgtggggccaactcgttcgccgacttcaaacctcgaaagctcg	Protospacer
***********************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_KK020676_3 3.11|424846|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424846-424877 32 AP014684 Pseudomonas phage PS-1 DNA, complete sequence 24341-24372 1 0.969
NZ_KK020676_3 3.11|424846|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424846-424877 32 MF417879 Uncultured Caudovirales phage clone 3S_11, partial genome 19460-19491 2 0.938
NZ_KK020676_3 3.7|424601|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424601-424632 32 MH576962 Streptomyces phage Satis, complete genome 99955-99986 5 0.844
NZ_KK020676_3 3.7|424601|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424601-424632 32 MK620894 Streptomyces phage Kradal, complete genome 99959-99990 5 0.844
NZ_KK020676_2 2.1|423123|30|NZ_KK020676|CRT 423123-423152 30 NZ_CP049157 Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence 993886-993915 6 0.8
NZ_KK020676_2 2.1|423123|30|NZ_KK020676|CRT 423123-423152 30 NZ_CP049317 Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence 650527-650556 6 0.8
NZ_KK020676_2 2.3|423243|32|NZ_KK020676|CRT,CRISPRCasFinder 423243-423274 32 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 701926-701957 6 0.812
NZ_KK020676_2 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder 423304-423335 32 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 547299-547330 6 0.812
NZ_KK020676_2 2.1|423123|30|NZ_KK020676|CRT 423123-423152 30 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 334328-334357 7 0.767
NZ_KK020676_2 2.1|423123|30|NZ_KK020676|CRT 423123-423152 30 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 352327-352356 7 0.767
NZ_KK020676_2 2.1|423123|30|NZ_KK020676|CRT 423123-423152 30 NZ_CP025188 Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence 209129-209158 7 0.767
NZ_KK020676_2 2.3|423243|32|NZ_KK020676|CRT,CRISPRCasFinder 423243-423274 32 NZ_CP019319 Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-7, complete sequence 38670-38701 7 0.781
NZ_KK020676_2 2.3|423243|32|NZ_KK020676|CRT,CRISPRCasFinder 423243-423274 32 NZ_CP018784 Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence 179216-179247 7 0.781
NZ_KK020676_2 2.3|423243|32|NZ_KK020676|CRT,CRISPRCasFinder 423243-423274 32 CP053333 Salmonella enterica subsp. diarizonae serovar 47:k:z35 strain 2009K1094 plasmid unnamed1, complete sequence 160260-160291 7 0.781
NZ_KK020676_2 2.10|423243|33|NZ_KK020676|PILER-CR 423243-423275 33 NZ_CP019319 Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-7, complete sequence 38669-38701 7 0.788
NZ_KK020676_3 3.3|424357|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424357-424388 32 NC_015377 Burkholderia gladioli BSR3 plasmid bgla_2p, complete sequence 28091-28122 7 0.781
NZ_KK020676_3 3.3|424357|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424357-424388 32 NZ_CP029777 Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence 232422-232453 7 0.781
NZ_KK020676_3 3.3|424357|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424357-424388 32 NZ_CP033429 Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence 89804-89835 7 0.781
NZ_KK020676_3 3.5|424479|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424479-424510 32 MF477236 Nocardia phage NTR1, complete genome 40695-40726 7 0.781
NZ_KK020676_3 3.5|424479|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424479-424510 32 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 74684-74715 7 0.781
NZ_KK020676_3 3.5|424479|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424479-424510 32 NZ_CP045120 Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence 161546-161577 7 0.781
NZ_KK020676_3 3.11|424846|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424846-424877 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1599860-1599891 7 0.781
NZ_KK020676_3 3.11|424846|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424846-424877 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 213401-213432 7 0.781
NZ_KK020676_3 3.11|424846|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424846-424877 32 NZ_CP023738 Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence 150989-151020 7 0.781
NZ_KK020676_3 3.11|424846|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424846-424877 32 GQ303259 Mycobacterium phage Colbert, complete genome 40097-40128 7 0.781
NZ_KK020676_2 2.1|423123|30|NZ_KK020676|CRT 423123-423152 30 NZ_CP054032 Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence 899054-899083 8 0.733
NZ_KK020676_2 2.3|423243|32|NZ_KK020676|CRT,CRISPRCasFinder 423243-423274 32 NZ_CP021236 Pontibacter actiniarum strain DSM 19842 plasmid unnamed, complete sequence 179721-179752 8 0.75
NZ_KK020676_2 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder 423304-423335 32 NC_015170 Deinococcus proteolyticus MRP plasmid pDEIPR03, complete sequence 127747-127778 8 0.75
NZ_KK020676_2 2.6|423426|32|NZ_KK020676|CRT,CRISPRCasFinder 423426-423457 32 NZ_CP045339 Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence 13812-13843 8 0.75
NZ_KK020676_2 2.13|423426|33|NZ_KK020676|PILER-CR 423426-423458 33 NZ_CP045339 Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence 13811-13843 8 0.758
NZ_KK020676_3 3.1|424235|32|NZ_KK020676|CRT 424235-424266 32 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 179220-179251 8 0.75
NZ_KK020676_3 3.1|424235|32|NZ_KK020676|CRT 424235-424266 32 NZ_CP015032 Burkholderia cenocepacia strain 842 plasmid pBcn842-1, complete sequence 15957-15988 8 0.75
NZ_KK020676_3 3.1|424235|32|NZ_KK020676|CRT 424235-424266 32 NZ_CP028965 Burkholderia sp. IDO3 plasmid p1, complete sequence 43635-43666 8 0.75
NZ_KK020676_3 3.1|424235|32|NZ_KK020676|CRT 424235-424266 32 MK931444 Klebsiella phage Skenny, complete genome 8725-8756 8 0.75
NZ_KK020676_3 3.3|424357|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424357-424388 32 NZ_LT703510 Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 6 18579-18610 8 0.75
NZ_KK020676_3 3.3|424357|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424357-424388 32 NZ_CP015275 Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 3, complete sequence 22736-22767 8 0.75
NZ_KK020676_3 3.3|424357|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424357-424388 32 NZ_CP019222 Mycobacterium chimaera strain CDC 2015-22-71 plasmid pDHQP20152271_3, complete sequence 16100-16131 8 0.75
NZ_KK020676_3 3.3|424357|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424357-424388 32 NZ_CP045966 Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_03, complete sequence 17049-17080 8 0.75
NZ_KK020676_3 3.3|424357|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424357-424388 32 NZ_CP016082 Streptomyces sp. SAT1 plasmid unnamed2, complete sequence 19524-19555 8 0.75
NZ_KK020676_3 3.3|424357|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424357-424388 32 NZ_CP013515 Rhizobium sp. N1314 plasmid pRspN1314d, complete sequence 289767-289798 8 0.75
NZ_KK020676_3 3.3|424357|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424357-424388 32 NC_011984 Agrobacterium vitis S4 plasmid pAtS4c, complete sequence 96911-96942 8 0.75
NZ_KK020676_3 3.3|424357|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424357-424388 32 NZ_CP013605 Rhizobium sp. N731 plasmid pRspN731d, complete sequence 289761-289792 8 0.75
NZ_KK020676_3 3.5|424479|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424479-424510 32 NZ_CP052758 Cellulosimicrobium sp. BI34T plasmid pCPRO01, complete sequence 140690-140721 8 0.75
NZ_KK020676_3 3.5|424479|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424479-424510 32 NC_016907 Gordonia polyisoprenivorans VH2 plasmid p174, complete sequence 77042-77073 8 0.75
NZ_KK020676_3 3.7|424601|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424601-424632 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 126713-126744 8 0.75
NZ_KK020676_3 3.7|424601|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424601-424632 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1686404-1686435 8 0.75
NZ_KK020676_3 3.11|424846|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424846-424877 32 NZ_CP017303 Rhodococcus sp. YL-1 plasmid pYLL1 sequence 48049-48080 8 0.75
NZ_KK020676_2 2.1|423123|30|NZ_KK020676|CRT 423123-423152 30 NZ_CP016291 Rhizobium leguminosarum strain Vaf10 plasmid unnamed6, complete sequence 224610-224639 9 0.7
NZ_KK020676_2 2.1|423123|30|NZ_KK020676|CRT 423123-423152 30 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 366669-366698 9 0.7
NZ_KK020676_2 2.1|423123|30|NZ_KK020676|CRT 423123-423152 30 NZ_CP022568 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence 162840-162869 9 0.7
NZ_KK020676_2 2.2|423182|32|NZ_KK020676|CRT,CRISPRCasFinder 423182-423213 32 JX681814 Burkholderia phage phiX216, complete genome 34255-34286 9 0.719
NZ_KK020676_2 2.2|423182|32|NZ_KK020676|CRT,CRISPRCasFinder 423182-423213 32 DQ087285 Burkholderia pseudomallei phage phi52237, complete genome 9899-9930 9 0.719
NZ_KK020676_2 2.2|423182|32|NZ_KK020676|CRT,CRISPRCasFinder 423182-423213 32 NC_007145 Burkholderia prophage phi52237, complete genome 9899-9930 9 0.719
NZ_KK020676_2 2.2|423182|32|NZ_KK020676|CRT,CRISPRCasFinder 423182-423213 32 CP008753 Burkholderia phage BEK, complete genome 28160-28191 9 0.719
NZ_KK020676_2 2.3|423243|32|NZ_KK020676|CRT,CRISPRCasFinder 423243-423274 32 NZ_CP014127 Pantoea vagans strain FDAARGOS_160 plasmid unnamed2, complete sequence 409663-409694 9 0.719
NZ_KK020676_2 2.3|423243|32|NZ_KK020676|CRT,CRISPRCasFinder 423243-423274 32 NC_014258 Pantoea vagans C9-1 plasmid pPag3, complete sequence 198156-198187 9 0.719
NZ_KK020676_2 2.3|423243|32|NZ_KK020676|CRT,CRISPRCasFinder 423243-423274 32 NZ_CP014308 Burkholderia sp. PAMC 26561 plasmid unnamed1, complete sequence 519820-519851 9 0.719
NZ_KK020676_2 2.3|423243|32|NZ_KK020676|CRT,CRISPRCasFinder 423243-423274 32 NZ_CP014309 Burkholderia sp. PAMC 26561 plasmid unnamed2, complete sequence 315274-315305 9 0.719
NZ_KK020676_2 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder 423304-423335 32 NZ_CP013381 Burkholderia sp. Bp5365 strain MSMB43 plasmid pMSMB43, complete sequence 2863-2894 9 0.719
NZ_KK020676_2 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder 423304-423335 32 NZ_CP009547 Burkholderia sp. 2002721687 plasmid pBTU, complete sequence 114995-115026 9 0.719
NZ_KK020676_2 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder 423304-423335 32 NZ_CP010421 Azotobacter chroococcum NCIMB 8003 plasmid pAcX50f, complete sequence 66511-66542 9 0.719
NZ_KK020676_2 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder 423304-423335 32 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 433919-433950 9 0.719
NZ_KK020676_2 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder 423304-423335 32 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 45127-45158 9 0.719
NZ_KK020676_2 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder 423304-423335 32 NZ_CP028976 Cronobacter sakazakii strain GZcsf-1 plasmid pGW2, complete sequence 39949-39980 9 0.719
NZ_KK020676_2 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder 423304-423335 32 NZ_CP011048 Cronobacter sakazakii strain ATCC 29544 plasmid CSK29544_1p, complete sequence 63348-63379 9 0.719
NZ_KK020676_2 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder 423304-423335 32 MT270409 Phaeobacter phage MD18, complete genome 38467-38498 9 0.719
NZ_KK020676_2 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder 423304-423335 32 KR053199 Gordonia phage GMA4, complete genome 40624-40655 9 0.719
NZ_KK020676_2 2.11|423304|33|NZ_KK020676|PILER-CR 423304-423336 33 NC_015170 Deinococcus proteolyticus MRP plasmid pDEIPR03, complete sequence 127746-127778 9 0.727
NZ_KK020676_2 2.11|423304|33|NZ_KK020676|PILER-CR 423304-423336 33 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 433918-433950 9 0.727
NZ_KK020676_3 3.1|424235|32|NZ_KK020676|CRT 424235-424266 32 KY575286 UNVERIFIED: Klebsiella phage SH-Kp 160016, complete genome 13768-13799 9 0.719
NZ_KK020676_3 3.1|424235|32|NZ_KK020676|CRT 424235-424266 32 MH633486 Klebsiella phage NJS3, complete genome 8725-8756 9 0.719
NZ_KK020676_3 3.1|424235|32|NZ_KK020676|CRT 424235-424266 32 NC_049845 Klebsiella phage PhiKpNIH-2, complete genome 9065-9096 9 0.719
NZ_KK020676_3 3.1|424235|32|NZ_KK020676|CRT 424235-424266 32 MK618657 Klebsiella phage Sanco, complete genome 8266-8297 9 0.719
NZ_KK020676_3 3.1|424235|32|NZ_KK020676|CRT 424235-424266 32 NC_049842 Klebsiella phage vB_KpnS_15-38_KLPPOU149, complete genome 21003-21034 9 0.719
NZ_KK020676_3 3.1|424235|32|NZ_KK020676|CRT 424235-424266 32 MF415412 Klebsiella phage KPN N141, complete genome 21014-21045 9 0.719
NZ_KK020676_3 3.1|424235|32|NZ_KK020676|CRT 424235-424266 32 MF612072 Klebsiella phage MezzoGao, complete genome 44326-44357 9 0.719
NZ_KK020676_3 3.1|424235|32|NZ_KK020676|CRT 424235-424266 32 MT894005 Klebsiella phage MMBB, complete genome 18265-18296 9 0.719
NZ_KK020676_3 3.1|424235|32|NZ_KK020676|CRT 424235-424266 32 MK931445 Klebsiella phage Shelby, complete genome 8918-8949 9 0.719
NZ_KK020676_3 3.1|424235|32|NZ_KK020676|CRT 424235-424266 32 JF501022 Klebsiella phage KP36, complete genome 9912-9943 9 0.719
NZ_KK020676_3 3.1|424235|32|NZ_KK020676|CRT 424235-424266 32 KP658157 Klebsiella phage 1513, complete genome 17711-17742 9 0.719
NZ_KK020676_3 3.1|424235|32|NZ_KK020676|CRT 424235-424266 32 NC_049848 Klebsiella phage KP1801, complete genome 47936-47967 9 0.719
NZ_KK020676_3 3.1|424235|32|NZ_KK020676|CRT 424235-424266 32 MH633484 Klebsiella phage TAH8, complete genome 8919-8950 9 0.719
NZ_KK020676_3 3.1|424235|32|NZ_KK020676|CRT 424235-424266 32 MK931442 Klebsiella phage Sin4, complete genome 8728-8759 9 0.719
NZ_KK020676_3 3.1|424235|32|NZ_KK020676|CRT 424235-424266 32 NC_048043 Klebsiella phage NJS2, complete genome 9516-9547 9 0.719
NZ_KK020676_3 3.1|424235|32|NZ_KK020676|CRT 424235-424266 32 MK931443 Klebsiella phage Sweeny, complete genome 9231-9262 9 0.719
NZ_KK020676_3 3.1|424235|32|NZ_KK020676|CRT 424235-424266 32 NC_049838 Klebsiella phage KL, complete genome 6781-6812 9 0.719
NZ_KK020676_3 3.1|424235|32|NZ_KK020676|CRT 424235-424266 32 NC_049838 Klebsiella phage KL, complete genome 17586-17617 9 0.719
NZ_KK020676_3 3.1|424235|32|NZ_KK020676|CRT 424235-424266 32 MH844531 Klebsiella phage GH-K3, complete genome 40636-40667 9 0.719
NZ_KK020676_3 3.1|424235|32|NZ_KK020676|CRT 424235-424266 32 NC_048044 Klebsiella phage NJR15, complete genome 8757-8788 9 0.719
NZ_KK020676_3 3.1|424235|32|NZ_KK020676|CRT 424235-424266 32 MG894052 Klebsiella phage JY917, complete genome 37158-37189 9 0.719
NZ_KK020676_3 3.1|424235|32|NZ_KK020676|CRT 424235-424266 32 NC_048126 Klebsiella phage TSK1, complete genome 6655-6686 9 0.719
NZ_KK020676_3 3.1|424235|32|NZ_KK020676|CRT 424235-424266 32 NC_028774 Klebsiella phage Sushi, complete genome 631-662 9 0.719
NZ_KK020676_3 3.1|424235|32|NZ_KK020676|CRT 424235-424266 32 NC_049844 Klebsiella phage 13, complete genome 23104-23135 9 0.719
NZ_KK020676_3 3.3|424357|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424357-424388 32 EF579802 Microbacterium phage Min1, complete genome 24868-24899 9 0.719
NZ_KK020676_3 3.5|424479|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424479-424510 32 NZ_CP012183 Pseudonocardia sp. EC080610-09 plasmid pBCI2-2, complete sequence 114632-114663 9 0.719
NZ_KK020676_3 3.11|424846|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424846-424877 32 LR606148 Rhizobium sp. Q54 genome assembly, plasmid: 5 16896-16927 9 0.719
NZ_KK020676_3 3.11|424846|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424846-424877 32 NZ_CP018080 Sulfitobacter sp. AM1-D1 plasmid unnamed4, complete sequence 118722-118753 9 0.719
NZ_KK020676_2 2.2|423182|32|NZ_KK020676|CRT,CRISPRCasFinder 423182-423213 32 NZ_LT703507 Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 3 85238-85269 10 0.688
NZ_KK020676_2 2.2|423182|32|NZ_KK020676|CRT,CRISPRCasFinder 423182-423213 32 NZ_CP015280 Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence 22868-22899 10 0.688
NZ_KK020676_2 2.2|423182|32|NZ_KK020676|CRT,CRISPRCasFinder 423182-423213 32 NZ_CP015273 Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 1, complete sequence 77463-77494 10 0.688
NZ_KK020676_2 2.2|423182|32|NZ_KK020676|CRT,CRISPRCasFinder 423182-423213 32 NZ_CP023153 Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_2, complete sequence 10505-10536 10 0.688
NZ_KK020676_2 2.2|423182|32|NZ_KK020676|CRT,CRISPRCasFinder 423182-423213 32 NC_020275 Mycobacterium intracellulare subsp. yongonense 05-1390 plasmid pMyong1, complete sequence 62566-62597 10 0.688
NZ_KK020676_2 2.2|423182|32|NZ_KK020676|CRT,CRISPRCasFinder 423182-423213 32 NZ_CP029333 Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109a, complete sequence 126213-126244 10 0.688
NZ_KK020676_2 2.2|423182|32|NZ_KK020676|CRT,CRISPRCasFinder 423182-423213 32 NZ_CP019224 Mycobacterium chimaera strain CDC 2015-22-71 plasmid pDHQP20152271_1, complete sequence 54030-54061 10 0.688
NZ_KK020676_2 2.2|423182|32|NZ_KK020676|CRT,CRISPRCasFinder 423182-423213 32 NZ_CP045964 Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_01, complete sequence 68706-68737 10 0.688
NZ_KK020676_2 2.2|423182|32|NZ_KK020676|CRT,CRISPRCasFinder 423182-423213 32 NC_022654 Mycobacterium kansasii ATCC 12478 plasmid pMK12478, complete sequence 69246-69277 10 0.688
NZ_KK020676_2 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder 423304-423335 32 NC_019740 Microcoleus sp. PCC 7113 plasmid pMIC7113.03, complete sequence 30818-30849 10 0.688
NZ_KK020676_2 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder 423304-423335 32 NC_019740 Microcoleus sp. PCC 7113 plasmid pMIC7113.03, complete sequence 55434-55465 10 0.688
NZ_KK020676_2 2.11|423304|33|NZ_KK020676|PILER-CR 423304-423336 33 NZ_CP013381 Burkholderia sp. Bp5365 strain MSMB43 plasmid pMSMB43, complete sequence 2862-2894 10 0.697
NZ_KK020676_2 2.11|423304|33|NZ_KK020676|PILER-CR 423304-423336 33 NZ_CP009547 Burkholderia sp. 2002721687 plasmid pBTU, complete sequence 114995-115027 10 0.697
NZ_KK020676_2 2.11|423304|33|NZ_KK020676|PILER-CR 423304-423336 33 NZ_CP010421 Azotobacter chroococcum NCIMB 8003 plasmid pAcX50f, complete sequence 66511-66543 10 0.697
NZ_KK020676_3 3.1|424235|32|NZ_KK020676|CRT 424235-424266 32 NZ_CP025505 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence 45428-45459 10 0.688
NZ_KK020676_3 3.3|424357|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424357-424388 32 NZ_CP011297 Rhodococcus erythropolis strain BG43 plasmid pRLLBG43, complete sequence 200729-200760 10 0.688
NZ_KK020676_3 3.5|424479|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424479-424510 32 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 561376-561407 10 0.688
NZ_KK020676_3 3.5|424479|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424479-424510 32 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 549064-549095 10 0.688
NZ_KK020676_3 3.5|424479|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder 424479-424510 32 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 578118-578149 10 0.688
NZ_KK020676_2 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder 423304-423335 32 NZ_CP031079 Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence 382069-382100 11 0.656
NZ_KK020676_2 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder 423304-423335 32 KU160673 Arthrobacter phage Wilde, complete genome 12333-12364 11 0.656
NZ_KK020676_2 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder 423304-423335 32 KU160669 Arthrobacter phage Tank, complete genome 12405-12436 11 0.656
NZ_KK020676_2 2.11|423304|33|NZ_KK020676|PILER-CR 423304-423336 33 NC_019740 Microcoleus sp. PCC 7113 plasmid pMIC7113.03, complete sequence 30817-30849 11 0.667
NZ_KK020676_2 2.11|423304|33|NZ_KK020676|PILER-CR 423304-423336 33 NC_019740 Microcoleus sp. PCC 7113 plasmid pMIC7113.03, complete sequence 55433-55465 11 0.667

1. spacer 3.11|424846|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to AP014684 (Pseudomonas phage PS-1 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

gcctcaaacgcaccggtgacgatctcgcgcgc	CRISPR spacer
gcctcaaacgcaccagtgacgatctcgcgcgc	Protospacer
**************.*****************

2. spacer 3.11|424846|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to MF417879 (Uncultured Caudovirales phage clone 3S_11, partial genome) position: , mismatch: 2, identity: 0.938

gcctcaaacgcaccggtgacgatctcgcgcgc	CRISPR spacer
gcctcaaacgcaccagtgacgatctcgcgtgc	Protospacer
**************.**************.**

3. spacer 3.7|424601|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to MH576962 (Streptomyces phage Satis, complete genome) position: , mismatch: 5, identity: 0.844

gacagcgcctacgaagtcgccgtgcagaacgg	CRISPR spacer
gactcggcgtacgaagtcgccgtggagaacgg	Protospacer
***   ** *************** *******

4. spacer 3.7|424601|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to MK620894 (Streptomyces phage Kradal, complete genome) position: , mismatch: 5, identity: 0.844

gacagcgcctacgaagtcgccgtgcagaacgg	CRISPR spacer
gactcggcgtacgaagtcgccgtggagaacgg	Protospacer
***   ** *************** *******

5. spacer 2.1|423123|30|NZ_KK020676|CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 6, identity: 0.8

---atggtataggccgccaggcgcttgccgtcg	CRISPR spacer
cgaaggata---gccgccatgcgcttgccgtcg	Protospacer
   * *.**   ******* *************

6. spacer 2.1|423123|30|NZ_KK020676|CRT matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 6, identity: 0.8

---atggtataggccgccaggcgcttgccgtcg	CRISPR spacer
cgaaggata---gccgccatgcgcttgccgtcg	Protospacer
   * *.**   ******* *************

7. spacer 2.3|423243|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812

---ccagccagttgctggcgagcatggtgccgacc	CRISPR spacer
agtccagc---ttgctggagagcatggcgccgacg	Protospacer
   *****   ******* ********.****** 

8. spacer 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 6, identity: 0.812

cttgagc---cgcacgaactgttcgccgcccaggg	CRISPR spacer
---aagcgcgcgcacgaacggttcgccgcccagcg	Protospacer
   .***   ********* ************* *

9. spacer 2.1|423123|30|NZ_KK020676|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767

atggtataggccgccaggcgcttgccgtcg	CRISPR spacer
cgcgctttggccgccaggcgattgccgtcg	Protospacer
   *. * ************ *********

10. spacer 2.1|423123|30|NZ_KK020676|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767

atggtataggccgccaggcgcttgccgtcg	CRISPR spacer
cgcgctttggccgccaggcgattgccgtcg	Protospacer
   *. * ************ *********

11. spacer 2.1|423123|30|NZ_KK020676|CRT matches to NZ_CP025188 (Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence) position: , mismatch: 7, identity: 0.767

atggtataggccgccaggcgcttgccgtcg	CRISPR spacer
accgtatcggccgccaggagcttgcccatg	Protospacer
*. **** ********** *******  .*

12. spacer 2.3|423243|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NZ_CP019319 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-7, complete sequence) position: , mismatch: 7, identity: 0.781

ccagccagttgctggcgagcatggtgccgacc	CRISPR spacer
cgaaatagttgctggcgaacatggtgccgagg	Protospacer
* *. .************.***********  

13. spacer 2.3|423243|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 7, identity: 0.781

--ccagccagttgctggcgagcatggtgccgacc	CRISPR spacer
gggcggcc--ttgctggcgaggatggggccgacg	Protospacer
   *.***  *********** **** ****** 

14. spacer 2.3|423243|32|NZ_KK020676|CRT,CRISPRCasFinder matches to CP053333 (Salmonella enterica subsp. diarizonae serovar 47:k:z35 strain 2009K1094 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ccagccagttgctggcgagcatggtgccgacc	CRISPR spacer
gcagccagttgctgaccagcatggccacgaac	Protospacer
 *************.* *******.  *** *

15. spacer 2.10|423243|33|NZ_KK020676|PILER-CR matches to NZ_CP019319 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-7, complete sequence) position: , mismatch: 7, identity: 0.788

ccagccagttgctggcgagcatggtgccgaccc	CRISPR spacer
cgaaatagttgctggcgaacatggtgccgaggc	Protospacer
* *. .************.***********  *

16. spacer 3.3|424357|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to NC_015377 (Burkholderia gladioli BSR3 plasmid bgla_2p, complete sequence) position: , mismatch: 7, identity: 0.781

ccaagacggcgctgaagtcgtcgc-cctgcaag	CRISPR spacer
ccagcacggcgctgaagtcgtcgtagctgctg-	Protospacer
***. ******************.  **** . 

17. spacer 3.3|424357|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781

ccaagacggcgctgaagtcgtcgccctgcaag	CRISPR spacer
cctggcaggtgctgaagtcgtcgacctgcatg	Protospacer
** .*  **.************* ****** *

18. spacer 3.3|424357|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033429 (Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

ccaagacggcgctgaagtcgtcgc-cctgcaag	CRISPR spacer
ccagcacggcgctgaagtcgtcgtagctgccg-	Protospacer
***. ******************.  **** . 

19. spacer 3.5|424479|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to MF477236 (Nocardia phage NTR1, complete genome) position: , mismatch: 7, identity: 0.781

ctgatagccggtgtcggtgccggccatctcgc	CRISPR spacer
gtcgaagccggtgtcggtgtcggccgtctcga	Protospacer
 * . **************.*****.***** 

20. spacer 3.5|424479|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 7, identity: 0.781

ctgatagccggtgtcggtgccggccatctcgc	CRISPR spacer
ccgggtggcggtgtcggtgccggccagctcga	Protospacer
*.*.  * ****************** **** 

21. spacer 3.5|424479|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ctgat--agccggtgtcggtgccggccatctcgc	CRISPR spacer
--gatcaggccggtgtcggcgccggccgtcttgg	Protospacer
  ***  .***********.*******.***.* 

22. spacer 3.11|424846|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.781

---gcctcaaacgcaccggtgacgatctcgcgcgc	CRISPR spacer
tggggct---gcgcaccggtgacgaactcgcccgc	Protospacer
   * **   .************** ***** ***

23. spacer 3.11|424846|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.781

---gcctcaaacgcaccggtgacgatctcgcgcgc	CRISPR spacer
tggggct---gcgcaccggtgacgaactcgcccgc	Protospacer
   * **   .************** ***** ***

24. spacer 3.11|424846|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023738 (Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence) position: , mismatch: 7, identity: 0.781

gcctcaaacgcaccggtgacgatctcgcgcgc	CRISPR spacer
gactgcgtcgcgccggtggcgatctcgcgcgc	Protospacer
* **  . ***.******.*************

25. spacer 3.11|424846|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to GQ303259 (Mycobacterium phage Colbert, complete genome) position: , mismatch: 7, identity: 0.781

gcctcaaacgcaccggtgacgatctcgcgcgc	CRISPR spacer
acctcgtcggcaccggcgacgatctcacgcgc	Protospacer
.****.   *******.*********.*****

26. spacer 2.1|423123|30|NZ_KK020676|CRT matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 8, identity: 0.733

atggtataggccgccaggcgcttgccgtcg	CRISPR spacer
tcgcggaaggccgccaggtgcttgtcgtcg	Protospacer
 .*  . ***********.*****.*****

27. spacer 2.3|423243|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NZ_CP021236 (Pontibacter actiniarum strain DSM 19842 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

ccagccagttgctggcgagcatggtgccgacc	CRISPR spacer
cccttgagttgctggtgagcatgatgccggct	Protospacer
**  . *********.*******.*****.*.

28. spacer 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NC_015170 (Deinococcus proteolyticus MRP plasmid pDEIPR03, complete sequence) position: , mismatch: 8, identity: 0.75

cttgagccgcacgaactgttcgccgcccaggg	CRISPR spacer
cagcagcagcacgaactcttcgccgccccagc	Protospacer
*   *** ********* ********** .* 

29. spacer 2.6|423426|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NZ_CP045339 (Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence) position: , mismatch: 8, identity: 0.75

ttacttcatcaaaaaaactcatgcttattccc	CRISPR spacer
ttaaggtggcaaaaatactcatgcttattacc	Protospacer
***   .. ****** ************* **

30. spacer 2.13|423426|33|NZ_KK020676|PILER-CR matches to NZ_CP045339 (Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence) position: , mismatch: 8, identity: 0.758

ttacttcatcaaaaaaactcatgcttattcccc	CRISPR spacer
ttaaggtggcaaaaatactcatgcttattaccc	Protospacer
***   .. ****** ************* ***

31. spacer 3.1|424235|32|NZ_KK020676|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 8, identity: 0.75

gtgggacaacctgtcgccagccgagcgcgcgg	CRISPR spacer
gttccgcgacctgtcgcccgcagagcgcgcgc	Protospacer
**   .*.********** ** ********* 

32. spacer 3.1|424235|32|NZ_KK020676|CRT matches to NZ_CP015032 (Burkholderia cenocepacia strain 842 plasmid pBcn842-1, complete sequence) position: , mismatch: 8, identity: 0.75

gtgggacaacctgtcgccagccgagcgcgcgg	CRISPR spacer
gttccgcgacctgtcgcccgcagagcgcgcgc	Protospacer
**   .*.********** ** ********* 

33. spacer 3.1|424235|32|NZ_KK020676|CRT matches to NZ_CP028965 (Burkholderia sp. IDO3 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

gtgggacaacctgtcgccagccgagcgcgcgg	CRISPR spacer
gttccgcgacctgtcgcccgcagagcgcgcgc	Protospacer
**   .*.********** ** ********* 

34. spacer 3.1|424235|32|NZ_KK020676|CRT matches to MK931444 (Klebsiella phage Skenny, complete genome) position: , mismatch: 8, identity: 0.75

gtgggacaacctgtcgccagccgagcgcgcgg	CRISPR spacer
ttgggaagacctgtcgccagccgataaggtgg	Protospacer
 ***** .****************  . *.**

35. spacer 3.3|424357|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT703510 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 6) position: , mismatch: 8, identity: 0.75

ccaagacggcgctgaagtcgtcgccctgcaag	CRISPR spacer
cggtgacggcgcagaagtcgtcgcgctgcgca	Protospacer
* . ******** *********** ****. .

36. spacer 3.3|424357|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015275 (Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 3, complete sequence) position: , mismatch: 8, identity: 0.75

ccaagacggcgctgaagtcgtcgccctgcaag	CRISPR spacer
cggtgacggcgcagaagtcgtcgcgctgcgca	Protospacer
* . ******** *********** ****. .

37. spacer 3.3|424357|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019222 (Mycobacterium chimaera strain CDC 2015-22-71 plasmid pDHQP20152271_3, complete sequence) position: , mismatch: 8, identity: 0.75

ccaagacggcgctgaagtcgtcgccctgcaag	CRISPR spacer
cggtgacggcgcagaagtcgtcgcgctgcgca	Protospacer
* . ******** *********** ****. .

38. spacer 3.3|424357|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP045966 (Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_03, complete sequence) position: , mismatch: 8, identity: 0.75

ccaagacggcgctgaagtcgtcgccctgcaag	CRISPR spacer
cggtgacggcgcagaagtcgtcgcgctgcgca	Protospacer
* . ******** *********** ****. .

39. spacer 3.3|424357|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

ccaagacggcgctgaagtcgtcgccctgcaag	CRISPR spacer
tgccgccggcgctgaagtcgccgcccagcacg	Protospacer
.   * **************.***** *** *

40. spacer 3.3|424357|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013515 (Rhizobium sp. N1314 plasmid pRspN1314d, complete sequence) position: , mismatch: 8, identity: 0.75

ccaagacggcgctgaagtcgtcgccctgcaag	CRISPR spacer
cgaagacggcgatgaagccgtcgccccggcgc	Protospacer
* ********* *****.********.*  . 

41. spacer 3.3|424357|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to NC_011984 (Agrobacterium vitis S4 plasmid pAtS4c, complete sequence) position: , mismatch: 8, identity: 0.75

ccaagacggcgctgaagtcgtcgccctgcaag	CRISPR spacer
ggaaatcggcgatgaactcgtcgccctgcaca	Protospacer
  **. ***** **** ************* .

42. spacer 3.3|424357|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013605 (Rhizobium sp. N731 plasmid pRspN731d, complete sequence) position: , mismatch: 8, identity: 0.75

ccaagacggcgctgaagtcgtcgccctgcaag	CRISPR spacer
cgaagacggcgatgaagccgtcgccccggcgc	Protospacer
* ********* *****.********.*  . 

43. spacer 3.5|424479|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP052758 (Cellulosimicrobium sp. BI34T plasmid pCPRO01, complete sequence) position: , mismatch: 8, identity: 0.75

ctgatagccggtgtcggtgccggccatctcgc	CRISPR spacer
gtcggtgtcggtgtcggtgtcggccagctcgc	Protospacer
 * .  *.***********.****** *****

44. spacer 3.5|424479|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to NC_016907 (Gordonia polyisoprenivorans VH2 plasmid p174, complete sequence) position: , mismatch: 8, identity: 0.75

ctgatagccggtgtcggtgccggccatctcgc	CRISPR spacer
cagatagccggtgtaggtgccgtccgggccac	Protospacer
* ************ ******* **.  .*.*

45. spacer 3.7|424601|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.75

gacagcgcctacgaagtcgccgtgcagaacgg	CRISPR spacer
aacgaggtgtacgacgtcgccgtgcaggacgg	Protospacer
.**.. *. ***** ************.****

46. spacer 3.7|424601|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.75

gacagcgcctacgaagtcgccgtgcagaacgg	CRISPR spacer
aacgaggtgtacgacgtcgccgtgcaggacgg	Protospacer
.**.. *. ***** ************.****

47. spacer 3.11|424846|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017303 (Rhodococcus sp. YL-1 plasmid pYLL1 sequence) position: , mismatch: 8, identity: 0.75

gcctcaaacgcaccggtgacgatctcgcgcgc	CRISPR spacer
acttcaaacgcaccgttgatgatctcttcggc	Protospacer
.*.************ ***.****** .  **

48. spacer 2.1|423123|30|NZ_KK020676|CRT matches to NZ_CP016291 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.7

atggtataggccgccaggcgcttgccgtcg	CRISPR spacer
gaacccgaggtcgtcaggcgcttgccgtcg	Protospacer
. . .  ***.**.****************

49. spacer 2.1|423123|30|NZ_KK020676|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.7

atggtataggccgccaggcgcttgccgtcg	CRISPR spacer
agatcggcagccggcaggcgcttgccgtcg	Protospacer
* . ..  .**** ****************

50. spacer 2.1|423123|30|NZ_KK020676|CRT matches to NZ_CP022568 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence) position: , mismatch: 9, identity: 0.7

atggtataggccgccaggcgcttgccgtcg	CRISPR spacer
gaacccgaggtcgtcaggcgcttgccgtcg	Protospacer
. . .  ***.**.****************

51. spacer 2.2|423182|32|NZ_KK020676|CRT,CRISPRCasFinder matches to JX681814 (Burkholderia phage phiX216, complete genome) position: , mismatch: 9, identity: 0.719

atccggcggcgctgcgtgaatcgaacctcggt	CRISPR spacer
tggcgacggggctgcgtgaatcgaacgtgcga	Protospacer
   **.*** **************** *  * 

52. spacer 2.2|423182|32|NZ_KK020676|CRT,CRISPRCasFinder matches to DQ087285 (Burkholderia pseudomallei phage phi52237, complete genome) position: , mismatch: 9, identity: 0.719

atccggcggcgctgcgtgaatcgaacctcggt	CRISPR spacer
tggcgacggggctgcgtgaatcgaacgtgcga	Protospacer
   **.*** **************** *  * 

53. spacer 2.2|423182|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NC_007145 (Burkholderia prophage phi52237, complete genome) position: , mismatch: 9, identity: 0.719

atccggcggcgctgcgtgaatcgaacctcggt	CRISPR spacer
tggcgacggggctgcgtgaatcgaacgtgcga	Protospacer
   **.*** **************** *  * 

54. spacer 2.2|423182|32|NZ_KK020676|CRT,CRISPRCasFinder matches to CP008753 (Burkholderia phage BEK, complete genome) position: , mismatch: 9, identity: 0.719

atccggcggcgctgcgtgaatcgaacctcggt	CRISPR spacer
tggcgacggggctgcgtgaatcgaacgtgcga	Protospacer
   **.*** **************** *  * 

55. spacer 2.3|423243|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NZ_CP014127 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

ccagccagttgctggcgagcatggtgccgacc	CRISPR spacer
tcgcggcggtgctgccgagcgtggtgccgacc	Protospacer
.*.    * ***** *****.***********

56. spacer 2.3|423243|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NC_014258 (Pantoea vagans C9-1 plasmid pPag3, complete sequence) position: , mismatch: 9, identity: 0.719

ccagccagttgctggcgagcatggtgccgacc	CRISPR spacer
tcgcggcggtgctgccgagcgtggtgccgacc	Protospacer
.*.    * ***** *****.***********

57. spacer 2.3|423243|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NZ_CP014308 (Burkholderia sp. PAMC 26561 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ccagccagttgctggcgagcatggtgccgacc	CRISPR spacer
tcgaccagttgctgccgagcacggtgcaaggc	Protospacer
.*..********** ******.***** .. *

58. spacer 2.3|423243|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NZ_CP014309 (Burkholderia sp. PAMC 26561 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

ccagccagttgctggcgagcatggtgccgacc	CRISPR spacer
tcgaccagttgctgccgagcacggtgcaaggc	Protospacer
.*..********** ******.***** .. *

59. spacer 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NZ_CP013381 (Burkholderia sp. Bp5365 strain MSMB43 plasmid pMSMB43, complete sequence) position: , mismatch: 9, identity: 0.719

cttgagccgcacgaactgttcgccgcccaggg	CRISPR spacer
gacgagccgcacgaacggatcgccgcccgcct	Protospacer
  .************* * *********.   

60. spacer 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NZ_CP009547 (Burkholderia sp. 2002721687 plasmid pBTU, complete sequence) position: , mismatch: 9, identity: 0.719

cttgagccgcacgaactgttcgccgcccaggg	CRISPR spacer
gacgagccgcacgaacggatcgccgcccgcct	Protospacer
  .************* * *********.   

61. spacer 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NZ_CP010421 (Azotobacter chroococcum NCIMB 8003 plasmid pAcX50f, complete sequence) position: , mismatch: 9, identity: 0.719

cttgagccgcacgaactgttcgccgcccaggg	CRISPR spacer
tctccgctgcacgaactgttcgccgaccaact	Protospacer
..*  **.***************** ***.  

62. spacer 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.719

cttgagccgcacgaactgttcgccgcccaggg	CRISPR spacer
cgcgagccgctcgaacggttcgccgccttcca	Protospacer
* .******* ***** **********.   .

63. spacer 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 9, identity: 0.719

cttgagccgcacgaactgttcgccgcccaggg	CRISPR spacer
agaaagccgcacgaactgaccgccgccgtgga	Protospacer
   .************** .*******  **.

64. spacer 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NZ_CP028976 (Cronobacter sakazakii strain GZcsf-1 plasmid pGW2, complete sequence) position: , mismatch: 9, identity: 0.719

cttgagccgcacgaactgttcgccgcccaggg	CRISPR spacer
gggaagccgcacgaacggttcgccaccactgg	Protospacer
   .************ *******.**   **

65. spacer 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NZ_CP011048 (Cronobacter sakazakii strain ATCC 29544 plasmid CSK29544_1p, complete sequence) position: , mismatch: 9, identity: 0.719

cttgagccgcacgaactgttcgccgcccaggg	CRISPR spacer
gggaagccgcacgaacggttcgccaccactgg	Protospacer
   .************ *******.**   **

66. spacer 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder matches to MT270409 (Phaeobacter phage MD18, complete genome) position: , mismatch: 9, identity: 0.719

cttgagccgcacgaactgttcgccgcccaggg	CRISPR spacer
tgcggggcgcacgaacagctcgccgcccagct	Protospacer
. .*.* ********* *.***********  

67. spacer 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder matches to KR053199 (Gordonia phage GMA4, complete genome) position: , mismatch: 9, identity: 0.719

cttgagccgcacgaactgttcgccgcccaggg	CRISPR spacer
caccagacgcacgaactgttcgtcgcctacct	Protospacer
* . ** ***************.****.*   

68. spacer 2.11|423304|33|NZ_KK020676|PILER-CR matches to NC_015170 (Deinococcus proteolyticus MRP plasmid pDEIPR03, complete sequence) position: , mismatch: 9, identity: 0.727

cttgagccgcacgaactgttcgccgcccagggc	CRISPR spacer
cagcagcagcacgaactcttcgccgccccagcg	Protospacer
*   *** ********* ********** .*  

69. spacer 2.11|423304|33|NZ_KK020676|PILER-CR matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.727

cttgagccgcacgaactgttcgccgcccagggc	CRISPR spacer
cgcgagccgctcgaacggttcgccgccttccac	Protospacer
* .******* ***** **********.   .*

70. spacer 3.1|424235|32|NZ_KK020676|CRT matches to KY575286 (UNVERIFIED: Klebsiella phage SH-Kp 160016, complete genome) position: , mismatch: 9, identity: 0.719

gtgggacaacctgtcgccagccgagcgcgcgg	CRISPR spacer
ttgggaagacctgtcgccagccgataagctgg	Protospacer
 ***** .****************  .  .**

71. spacer 3.1|424235|32|NZ_KK020676|CRT matches to MH633486 (Klebsiella phage NJS3, complete genome) position: , mismatch: 9, identity: 0.719

gtgggacaacctgtcgccagccgagcgcgcgg	CRISPR spacer
ttgggaagacctgtcgccagccgataagctgg	Protospacer
 ***** .****************  .  .**

72. spacer 3.1|424235|32|NZ_KK020676|CRT matches to NC_049845 (Klebsiella phage PhiKpNIH-2, complete genome) position: , mismatch: 9, identity: 0.719

gtgggacaacctgtcgccagccgagcgcgcgg	CRISPR spacer
ttgggaagacctgtcgccagccgataagctgg	Protospacer
 ***** .****************  .  .**

73. spacer 3.1|424235|32|NZ_KK020676|CRT matches to MK618657 (Klebsiella phage Sanco, complete genome) position: , mismatch: 9, identity: 0.719

gtgggacaacctgtcgccagccgagcgcgcgg	CRISPR spacer
ttgggaagacctgtcgccagccgataagctgg	Protospacer
 ***** .****************  .  .**

74. spacer 3.1|424235|32|NZ_KK020676|CRT matches to NC_049842 (Klebsiella phage vB_KpnS_15-38_KLPPOU149, complete genome) position: , mismatch: 9, identity: 0.719

gtgggacaacctgtcgccagccgagcgcgcgg	CRISPR spacer
ttgggaagacctgtcgccagccgataagctgg	Protospacer
 ***** .****************  .  .**

75. spacer 3.1|424235|32|NZ_KK020676|CRT matches to MF415412 (Klebsiella phage KPN N141, complete genome) position: , mismatch: 9, identity: 0.719

gtgggacaacctgtcgccagccgagcgcgcgg	CRISPR spacer
ttgggaagacctgtcgccagccgataagctgg	Protospacer
 ***** .****************  .  .**

76. spacer 3.1|424235|32|NZ_KK020676|CRT matches to MF612072 (Klebsiella phage MezzoGao, complete genome) position: , mismatch: 9, identity: 0.719

gtgggacaacctgtcgccagccgagcgcgcgg	CRISPR spacer
ttgggaagacctgtcgccagccgataagctgg	Protospacer
 ***** .****************  .  .**

77. spacer 3.1|424235|32|NZ_KK020676|CRT matches to MT894005 (Klebsiella phage MMBB, complete genome) position: , mismatch: 9, identity: 0.719

gtgggacaacctgtcgccagccgagcgcgcgg	CRISPR spacer
ttgggaagacctgtcgccagccgataagctgg	Protospacer
 ***** .****************  .  .**

78. spacer 3.1|424235|32|NZ_KK020676|CRT matches to MK931445 (Klebsiella phage Shelby, complete genome) position: , mismatch: 9, identity: 0.719

gtgggacaacctgtcgccagccgagcgcgcgg	CRISPR spacer
ttgggaagacctgtcgccagccgataagctgg	Protospacer
 ***** .****************  .  .**

79. spacer 3.1|424235|32|NZ_KK020676|CRT matches to JF501022 (Klebsiella phage KP36, complete genome) position: , mismatch: 9, identity: 0.719

gtgggacaacctgtcgccagccgagcgcgcgg	CRISPR spacer
ttgggaagacctgtcgccagccgataagctgg	Protospacer
 ***** .****************  .  .**

80. spacer 3.1|424235|32|NZ_KK020676|CRT matches to KP658157 (Klebsiella phage 1513, complete genome) position: , mismatch: 9, identity: 0.719

gtgggacaacctgtcgccagccgagcgcgcgg	CRISPR spacer
ttgggaagacctgtcgccagccgataagctgg	Protospacer
 ***** .****************  .  .**

81. spacer 3.1|424235|32|NZ_KK020676|CRT matches to NC_049848 (Klebsiella phage KP1801, complete genome) position: , mismatch: 9, identity: 0.719

gtgggacaacctgtcgccagccgagcgcgcgg	CRISPR spacer
ttgggaagacctgtcgccagccgataagctgg	Protospacer
 ***** .****************  .  .**

82. spacer 3.1|424235|32|NZ_KK020676|CRT matches to MH633484 (Klebsiella phage TAH8, complete genome) position: , mismatch: 9, identity: 0.719

gtgggacaacctgtcgccagccgagcgcgcgg	CRISPR spacer
ttgggaagacctgtcgccagccgataagctgg	Protospacer
 ***** .****************  .  .**

83. spacer 3.1|424235|32|NZ_KK020676|CRT matches to MK931442 (Klebsiella phage Sin4, complete genome) position: , mismatch: 9, identity: 0.719

gtgggacaacctgtcgccagccgagcgcgcgg	CRISPR spacer
ttgggaagacctgtcgccagccgataagctgg	Protospacer
 ***** .****************  .  .**

84. spacer 3.1|424235|32|NZ_KK020676|CRT matches to NC_048043 (Klebsiella phage NJS2, complete genome) position: , mismatch: 9, identity: 0.719

gtgggacaacctgtcgccagccgagcgcgcgg	CRISPR spacer
ttgggaagacctgtcgccagccgataagctgg	Protospacer
 ***** .****************  .  .**

85. spacer 3.1|424235|32|NZ_KK020676|CRT matches to MK931443 (Klebsiella phage Sweeny, complete genome) position: , mismatch: 9, identity: 0.719

gtgggacaacctgtcgccagccgagcgcgcgg	CRISPR spacer
ttgggaagacctgtcgccagccgataagctgg	Protospacer
 ***** .****************  .  .**

86. spacer 3.1|424235|32|NZ_KK020676|CRT matches to NC_049838 (Klebsiella phage KL, complete genome) position: , mismatch: 9, identity: 0.719

gtgggacaacctgtcgccagccgagcgcgcgg	CRISPR spacer
ttgggaagacctgtcgccagccgataagctgg	Protospacer
 ***** .****************  .  .**

87. spacer 3.1|424235|32|NZ_KK020676|CRT matches to NC_049838 (Klebsiella phage KL, complete genome) position: , mismatch: 9, identity: 0.719

gtgggacaacctgtcgccagccgagcgcgcgg	CRISPR spacer
ttgggaagacctgtcgccagccgataagctgg	Protospacer
 ***** .****************  .  .**

88. spacer 3.1|424235|32|NZ_KK020676|CRT matches to MH844531 (Klebsiella phage GH-K3, complete genome) position: , mismatch: 9, identity: 0.719

gtgggacaacctgtcgccagccgagcgcgcgg	CRISPR spacer
ttgggaagacctgtcgccagccgataagctgg	Protospacer
 ***** .****************  .  .**

89. spacer 3.1|424235|32|NZ_KK020676|CRT matches to NC_048044 (Klebsiella phage NJR15, complete genome) position: , mismatch: 9, identity: 0.719

gtgggacaacctgtcgccagccgagcgcgcgg	CRISPR spacer
ttgggaagacctgtcgccagccgataagctgg	Protospacer
 ***** .****************  .  .**

90. spacer 3.1|424235|32|NZ_KK020676|CRT matches to MG894052 (Klebsiella phage JY917, complete genome) position: , mismatch: 9, identity: 0.719

gtgggacaacctgtcgccagccgagcgcgcgg	CRISPR spacer
ttgggaagacctgtcgccagccgataagctgg	Protospacer
 ***** .****************  .  .**

91. spacer 3.1|424235|32|NZ_KK020676|CRT matches to NC_048126 (Klebsiella phage TSK1, complete genome) position: , mismatch: 9, identity: 0.719

gtgggacaacctgtcgccagccgagcgcgcgg	CRISPR spacer
ttgggaagacctgtcgccagccgataagctgg	Protospacer
 ***** .****************  .  .**

92. spacer 3.1|424235|32|NZ_KK020676|CRT matches to NC_028774 (Klebsiella phage Sushi, complete genome) position: , mismatch: 9, identity: 0.719

gtgggacaacctgtcgccagccgagcgcgcgg	CRISPR spacer
ttgggaagacctgtcgccagccgataagctgg	Protospacer
 ***** .****************  .  .**

93. spacer 3.1|424235|32|NZ_KK020676|CRT matches to NC_049844 (Klebsiella phage 13, complete genome) position: , mismatch: 9, identity: 0.719

gtgggacaacctgtcgccagccgagcgcgcgg	CRISPR spacer
ttgggaagacctgtcgccagccgataagctgg	Protospacer
 ***** .****************  .  .**

94. spacer 3.3|424357|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to EF579802 (Microbacterium phage Min1, complete genome) position: , mismatch: 9, identity: 0.719

ccaagacggcgctgaagtcgtcgccctgcaag	CRISPR spacer
cgccaacggcgctgaggtcgttgccctgcgca	Protospacer
*   .**********.*****.*******. .

95. spacer 3.5|424479|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP012183 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-2, complete sequence) position: , mismatch: 9, identity: 0.719

ctgatagccggtgtcggtgccggccatctcgc	CRISPR spacer
gttcccgtcggtgtcggtgcaggccatcgcgg	Protospacer
 *  . *.************ ******* ** 

96. spacer 3.11|424846|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to LR606148 (Rhizobium sp. Q54 genome assembly, plasmid: 5) position: , mismatch: 9, identity: 0.719

gcctcaaacgcaccggtgacgatctcgcgcgc	CRISPR spacer
agccttctcgcaccgatgacgatcacgcgcgc	Protospacer
. *..   *******.******** *******

97. spacer 3.11|424846|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018080 (Sulfitobacter sp. AM1-D1 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

gcctcaaacgcaccggtgacgatctcgcgcgc	CRISPR spacer
gtcgatggcgcaccgtagacgatctcgcgcgt	Protospacer
*.*   ..*******  **************.

98. spacer 2.2|423182|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NZ_LT703507 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 3) position: , mismatch: 10, identity: 0.688

atccggcggcgctgcgtgaatcgaacctcggt	CRISPR spacer
cctcggcgacactgcgtgaatcgaacacctcc	Protospacer
 ..*****.*.*************** .*  .

99. spacer 2.2|423182|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NZ_CP015280 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence) position: , mismatch: 10, identity: 0.688

atccggcggcgctgcgtgaatcgaacctcggt	CRISPR spacer
cctcggcgacactgcgtgaatcgaacacctcc	Protospacer
 ..*****.*.*************** .*  .

100. spacer 2.2|423182|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NZ_CP015273 (Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 1, complete sequence) position: , mismatch: 10, identity: 0.688

atccggcggcgctgcgtgaatcgaacctcggt	CRISPR spacer
cctcggcgacactgcgtgaatcgaacacctcc	Protospacer
 ..*****.*.*************** .*  .

101. spacer 2.2|423182|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NZ_CP023153 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_2, complete sequence) position: , mismatch: 10, identity: 0.688

atccggcggcgctgcgtgaatcgaacctcggt	CRISPR spacer
cctcggcgacactgcgtgaatcgaacacctcc	Protospacer
 ..*****.*.*************** .*  .

102. spacer 2.2|423182|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NC_020275 (Mycobacterium intracellulare subsp. yongonense 05-1390 plasmid pMyong1, complete sequence) position: , mismatch: 10, identity: 0.688

atccggcggcgctgcgtgaatcgaacctcggt	CRISPR spacer
cctcggcgacactgcgtgaatcgaacacctcc	Protospacer
 ..*****.*.*************** .*  .

103. spacer 2.2|423182|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NZ_CP029333 (Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109a, complete sequence) position: , mismatch: 10, identity: 0.688

atccggcggcgctgcgtgaatcgaacctcggt	CRISPR spacer
cctcggcgacactgcgtgaatcgaacacctcc	Protospacer
 ..*****.*.*************** .*  .

104. spacer 2.2|423182|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NZ_CP019224 (Mycobacterium chimaera strain CDC 2015-22-71 plasmid pDHQP20152271_1, complete sequence) position: , mismatch: 10, identity: 0.688

atccggcggcgctgcgtgaatcgaacctcggt	CRISPR spacer
cctcggcgacactgcgtgaatcgaacacctcc	Protospacer
 ..*****.*.*************** .*  .

105. spacer 2.2|423182|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NZ_CP045964 (Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_01, complete sequence) position: , mismatch: 10, identity: 0.688

atccggcggcgctgcgtgaatcgaacctcggt	CRISPR spacer
cctcggcgacactgcgtgaatcgaacacctcc	Protospacer
 ..*****.*.*************** .*  .

106. spacer 2.2|423182|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NC_022654 (Mycobacterium kansasii ATCC 12478 plasmid pMK12478, complete sequence) position: , mismatch: 10, identity: 0.688

atccggcggcgctgcgtgaatcgaacctcggt	CRISPR spacer
cctcggcgacactgcgtgaatcgaacacctcc	Protospacer
 ..*****.*.*************** .*  .

107. spacer 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NC_019740 (Microcoleus sp. PCC 7113 plasmid pMIC7113.03, complete sequence) position: , mismatch: 10, identity: 0.688

cttgagccgcacgaactgttcgccgcccaggg	CRISPR spacer
acaccaccgcacaaactgttcgccgtccagca	Protospacer
 .   .******.************.**** .

108. spacer 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NC_019740 (Microcoleus sp. PCC 7113 plasmid pMIC7113.03, complete sequence) position: , mismatch: 10, identity: 0.688

cttgagccgcacgaactgttcgccgcccaggg	CRISPR spacer
acaccaccgcacaaactgttcgccgtccagca	Protospacer
 .   .******.************.**** .

109. spacer 2.11|423304|33|NZ_KK020676|PILER-CR matches to NZ_CP013381 (Burkholderia sp. Bp5365 strain MSMB43 plasmid pMSMB43, complete sequence) position: , mismatch: 10, identity: 0.697

cttgagccgcacgaactgttcgccgcccagggc	CRISPR spacer
gacgagccgcacgaacggatcgccgcccgcctg	Protospacer
  .************* * *********.    

110. spacer 2.11|423304|33|NZ_KK020676|PILER-CR matches to NZ_CP009547 (Burkholderia sp. 2002721687 plasmid pBTU, complete sequence) position: , mismatch: 10, identity: 0.697

cttgagccgcacgaactgttcgccgcccagggc	CRISPR spacer
gacgagccgcacgaacggatcgccgcccgcctg	Protospacer
  .************* * *********.    

111. spacer 2.11|423304|33|NZ_KK020676|PILER-CR matches to NZ_CP010421 (Azotobacter chroococcum NCIMB 8003 plasmid pAcX50f, complete sequence) position: , mismatch: 10, identity: 0.697

cttgagccgcacgaactgttcgccgcccagggc	CRISPR spacer
tctccgctgcacgaactgttcgccgaccaactg	Protospacer
..*  **.***************** ***.   

112. spacer 3.1|424235|32|NZ_KK020676|CRT matches to NZ_CP025505 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence) position: , mismatch: 10, identity: 0.688

gtgggacaacctgtcgccagccgagcgcgcgg	CRISPR spacer
gccggagaaccggtcgccagccgagccttttc	Protospacer
*. *** **** ************** . .  

113. spacer 3.3|424357|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011297 (Rhodococcus erythropolis strain BG43 plasmid pRLLBG43, complete sequence) position: , mismatch: 10, identity: 0.688

ccaagacggcgctgaagtcgtcgccctgcaag	CRISPR spacer
ggagcacggcgcggcagtcgtcgccctgacca	Protospacer
  *. ******* * *************   .

114. spacer 3.5|424479|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 10, identity: 0.688

ctgatagccggtgtcggtgccggccatctcgc	CRISPR spacer
catcctgccggcgtcggtgccggcaatcttcg	Protospacer
*   . *****.************ ****.  

115. spacer 3.5|424479|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 10, identity: 0.688

ctgatagccggtgtcggtgccggccatctcgc	CRISPR spacer
catcctgccggcgtcggtgccggcaatcttcg	Protospacer
*   . *****.************ ****.  

116. spacer 3.5|424479|32|NZ_KK020676|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 10, identity: 0.688

ctgatagccggtgtcggtgccggccatctcgc	CRISPR spacer
catcctgccggcgtcggtgccggcaatcttcg	Protospacer
*   . *****.************ ****.  

117. spacer 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 11, identity: 0.656

cttgagccgcacgaactgttcgccgcccaggg	CRISPR spacer
tgcatcgtgcacgaacagttcaccgcccagga	Protospacer
. ..   .******** ****.*********.

118. spacer 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder matches to KU160673 (Arthrobacter phage Wilde, complete genome) position: , mismatch: 11, identity: 0.656

cttgagccgcacgaactgttcgccgcccaggg	CRISPR spacer
gaccagctgcacgagctgttcgccgcctctct	Protospacer
  . ***.******.************.    

119. spacer 2.4|423304|32|NZ_KK020676|CRT,CRISPRCasFinder matches to KU160669 (Arthrobacter phage Tank, complete genome) position: , mismatch: 11, identity: 0.656

cttgagccgcacgaactgttcgccgcccaggg	CRISPR spacer
gaccagctgcacgagctgttcgccgcctctct	Protospacer
  . ***.******.************.    

120. spacer 2.11|423304|33|NZ_KK020676|PILER-CR matches to NC_019740 (Microcoleus sp. PCC 7113 plasmid pMIC7113.03, complete sequence) position: , mismatch: 11, identity: 0.667

cttgagccgcacgaactgttcgccgcccagggc	CRISPR spacer
acaccaccgcacaaactgttcgccgtccagcat	Protospacer
 .   .******.************.**** ..

121. spacer 2.11|423304|33|NZ_KK020676|PILER-CR matches to NC_019740 (Microcoleus sp. PCC 7113 plasmid pMIC7113.03, complete sequence) position: , mismatch: 11, identity: 0.667

cttgagccgcacgaactgttcgccgcccagggc	CRISPR spacer
acaccaccgcacaaactgttcgccgtccagcat	Protospacer
 .   .******.************.**** ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 276498 : 325300 41 Wolbachia_phage(14.29%) tRNA,integrase,protease attL 316469:316485|attR 327074:327090
DBSCAN-SWA_2 958518 : 973350 6 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_3 1396676 : 1458820 51 Pseudomonas_phage(33.33%) transposase,integrase,protease attL 1401844:1401890|attR 1413394:1413440
DBSCAN-SWA_4 1939383 : 1989276 80 Pseudomonas_phage(57.14%) terminase,capsid NA
DBSCAN-SWA_5 2333153 : 2387416 71 uncultured_Caudovirales_phage(75.0%) holin,plate,integrase,tail,terminase,portal,capsid,head attL 2330731:2330749|attR 2370701:2370719
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_KK020676.1|WP_031323581.1|2346626_2347061_-|hypothetical-protein 2346626_2347061_- 144 aa aa AcrIC6 NA NZ_KK020676.1_2346423_2346627_- 2333153-2387416 NA
NZ_KK020676.1|WP_003294373.1|2347110_2347395_-|hypothetical-protein 2347110_2347395_- 94 aa aa AcrIC7 NA NZ_KK020676.1_2346423_2346627_- 2333153-2387416 NA
2. NZ_KK020678
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 283034 : 295601 13 Bacillus_phage(33.33%) tRNA,integrase,transposase attL 282041:282055|attR 294125:294139
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_KK020675
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 783885 : 789964 9 Lake_Baikal_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_KK020677
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 134051 : 143274 10 Bacillus_phage(42.86%) NA NA
DBSCAN-SWA_2 261526 : 269345 10 Thermobifida_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage