Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LNVK01000021 Xanthomonas translucens strain CS2 flattened_line_40, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_LNVK01000125 Xanthomonas translucens strain CS2 flattened_line_246, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000140 Xanthomonas translucens strain CS2 flattened_line_276, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000111 Xanthomonas translucens strain CS2 flattened_line_219, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000085 Xanthomonas translucens strain CS2 flattened_line_168, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000116 Xanthomonas translucens strain CS2 flattened_line_229, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000019 Xanthomonas translucens strain CS2 flattened_line_36, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000015 Xanthomonas translucens strain CS2 flattened_line_28, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000022 Xanthomonas translucens strain CS2 flattened_line_41, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_LNVK01000046 Xanthomonas translucens strain CS2 flattened_line_88, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000091 Xanthomonas translucens strain CS2 flattened_line_180, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000106 Xanthomonas translucens strain CS2 flattened_line_210, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000146 Xanthomonas translucens strain CS2 flattened_line_288, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000052 Xanthomonas translucens strain CS2 flattened_line_100, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000066 Xanthomonas translucens strain CS2 flattened_line_128, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000095 Xanthomonas translucens strain CS2 flattened_line_188, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000107 Xanthomonas translucens strain CS2 flattened_line_211, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000014 Xanthomonas translucens strain CS2 flattened_line_26, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000099 Xanthomonas translucens strain CS2 flattened_line_196, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000054 Xanthomonas translucens strain CS2 flattened_line_104, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_LNVK01000049 Xanthomonas translucens strain CS2 flattened_line_94, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000008 Xanthomonas translucens strain CS2 flattened_line_14, whole genome shotgun sequence 0 crisprs DEDDh 0 0 1 2
NZ_LNVK01000035 Xanthomonas translucens strain CS2 flattened_line_66, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000109 Xanthomonas translucens strain CS2 flattened_line_215, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000044 Xanthomonas translucens strain CS2 flattened_line_84, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_LNVK01000101 Xanthomonas translucens strain CS2 flattened_line_200, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000100 Xanthomonas translucens strain CS2 flattened_line_198, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000081 Xanthomonas translucens strain CS2 flattened_line_158, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000029 Xanthomonas translucens strain CS2 flattened_line_54, whole genome shotgun sequence 3 crisprs NA 0 54 0 0
NZ_LNVK01000033 Xanthomonas translucens strain CS2 flattened_line_62, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000126 Xanthomonas translucens strain CS2 flattened_line_248, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000113 Xanthomonas translucens strain CS2 flattened_line_223, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000143 Xanthomonas translucens strain CS2 flattened_line_282, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000130 Xanthomonas translucens strain CS2 flattened_line_256, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000002 Xanthomonas translucens strain CS2 flattened_line_2, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000104 Xanthomonas translucens strain CS2 flattened_line_206, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000039 Xanthomonas translucens strain CS2 flattened_line_74, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_LNVK01000141 Xanthomonas translucens strain CS2 flattened_line_278, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000007 Xanthomonas translucens strain CS2 flattened_line_12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000060 Xanthomonas translucens strain CS2 flattened_line_116, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000050 Xanthomonas translucens strain CS2 flattened_line_96, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000093 Xanthomonas translucens strain CS2 flattened_line_184, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000040 Xanthomonas translucens strain CS2 flattened_line_76, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000062 Xanthomonas translucens strain CS2 flattened_line_120, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000041 Xanthomonas translucens strain CS2 flattened_line_78, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000010 Xanthomonas translucens strain CS2 flattened_line_18, whole genome shotgun sequence 1 crisprs cas3,cas5,cas8c,cas7,cas4,cas1,cas2 9 46 0 0
NZ_LNVK01000036 Xanthomonas translucens strain CS2 flattened_line_68, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000149 Xanthomonas translucens strain CS2 flattened_line_294, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000030 Xanthomonas translucens strain CS2 flattened_line_56, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_LNVK01000056 Xanthomonas translucens strain CS2 flattened_line_108, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000074 Xanthomonas translucens strain CS2 flattened_line_144, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000132 Xanthomonas translucens strain CS2 flattened_line_260, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000131 Xanthomonas translucens strain CS2 flattened_line_258, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000121 Xanthomonas translucens strain CS2 flattened_line_238, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000136 Xanthomonas translucens strain CS2 flattened_line_268, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000032 Xanthomonas translucens strain CS2 flattened_line_60, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000073 Xanthomonas translucens strain CS2 flattened_line_142, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000137 Xanthomonas translucens strain CS2 flattened_line_270, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000038 Xanthomonas translucens strain CS2 flattened_line_72, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000047 Xanthomonas translucens strain CS2 flattened_line_90, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000084 Xanthomonas translucens strain CS2 flattened_line_166, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000082 Xanthomonas translucens strain CS2 flattened_line_160, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000068 Xanthomonas translucens strain CS2 flattened_line_132, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000048 Xanthomonas translucens strain CS2 flattened_line_92, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000011 Xanthomonas translucens strain CS2 flattened_line_20, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000142 Xanthomonas translucens strain CS2 flattened_line_280, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000087 Xanthomonas translucens strain CS2 flattened_line_172, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000096 Xanthomonas translucens strain CS2 flattened_line_190, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000057 Xanthomonas translucens strain CS2 flattened_line_110, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000067 Xanthomonas translucens strain CS2 flattened_line_130, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000129 Xanthomonas translucens strain CS2 flattened_line_254, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000145 Xanthomonas translucens strain CS2 flattened_line_286, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000058 Xanthomonas translucens strain CS2 flattened_line_112, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000063 Xanthomonas translucens strain CS2 flattened_line_122, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000069 Xanthomonas translucens strain CS2 flattened_line_134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000037 Xanthomonas translucens strain CS2 flattened_line_70, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000042 Xanthomonas translucens strain CS2 flattened_line_80, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000055 Xanthomonas translucens strain CS2 flattened_line_106, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000119 Xanthomonas translucens strain CS2 flattened_line_234, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000004 Xanthomonas translucens strain CS2 flattened_line_6, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_LNVK01000092 Xanthomonas translucens strain CS2 flattened_line_182, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000018 Xanthomonas translucens strain CS2 flattened_line_34, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000026 Xanthomonas translucens strain CS2 flattened_line_48, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000139 Xanthomonas translucens strain CS2 flattened_line_274, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000051 Xanthomonas translucens strain CS2 flattened_line_98, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000045 Xanthomonas translucens strain CS2 flattened_line_86, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000027 Xanthomonas translucens strain CS2 flattened_line_50, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000144 Xanthomonas translucens strain CS2 flattened_line_284, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000110 Xanthomonas translucens strain CS2 flattened_line_217, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000065 Xanthomonas translucens strain CS2 flattened_line_126, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000012 Xanthomonas translucens strain CS2 flattened_line_22, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_LNVK01000094 Xanthomonas translucens strain CS2 flattened_line_186, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000031 Xanthomonas translucens strain CS2 flattened_line_58, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000003 Xanthomonas translucens strain CS2 flattened_line_4, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000102 Xanthomonas translucens strain CS2 flattened_line_202, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000064 Xanthomonas translucens strain CS2 flattened_line_124, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_LNVK01000023 Xanthomonas translucens strain CS2 flattened_line_43, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000115 Xanthomonas translucens strain CS2 flattened_line_227, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000147 Xanthomonas translucens strain CS2 flattened_line_290, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000001 Xanthomonas translucens strain CS2 flattened_line_0, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000013 Xanthomonas translucens strain CS2 flattened_line_24, whole genome shotgun sequence 0 crisprs DEDDh,csa3 0 0 0 0
NZ_LNVK01000078 Xanthomonas translucens strain CS2 flattened_line_152, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000016 Xanthomonas translucens strain CS2 flattened_line_30, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_LNVK01000090 Xanthomonas translucens strain CS2 flattened_line_178, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000148 Xanthomonas translucens strain CS2 flattened_line_292, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000053 Xanthomonas translucens strain CS2 flattened_line_102, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000025 Xanthomonas translucens strain CS2 flattened_line_47, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000072 Xanthomonas translucens strain CS2 flattened_line_140, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000117 Xanthomonas translucens strain CS2 flattened_line_231, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000070 Xanthomonas translucens strain CS2 flattened_line_136, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000017 Xanthomonas translucens strain CS2 flattened_line_32, whole genome shotgun sequence 1 crisprs NA 0 0 1 0
NZ_LNVK01000079 Xanthomonas translucens strain CS2 flattened_line_154, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000005 Xanthomonas translucens strain CS2 flattened_line_8, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_LNVK01000086 Xanthomonas translucens strain CS2 flattened_line_170, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000071 Xanthomonas translucens strain CS2 flattened_line_138, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000075 Xanthomonas translucens strain CS2 flattened_line_146, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000114 Xanthomonas translucens strain CS2 flattened_line_225, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000024 Xanthomonas translucens strain CS2 flattened_line_45, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_LNVK01000133 Xanthomonas translucens strain CS2 flattened_line_262, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000112 Xanthomonas translucens strain CS2 flattened_line_221, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000124 Xanthomonas translucens strain CS2 flattened_line_244, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000138 Xanthomonas translucens strain CS2 flattened_line_272, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000076 Xanthomonas translucens strain CS2 flattened_line_148, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000061 Xanthomonas translucens strain CS2 flattened_line_118, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000089 Xanthomonas translucens strain CS2 flattened_line_176, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000151 Xanthomonas translucens strain CS2 flattened_line_298, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000127 Xanthomonas translucens strain CS2 flattened_line_250, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000150 Xanthomonas translucens strain CS2 flattened_line_296, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000105 Xanthomonas translucens strain CS2 flattened_line_208, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000135 Xanthomonas translucens strain CS2 flattened_line_266, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000103 Xanthomonas translucens strain CS2 flattened_line_204, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000006 Xanthomonas translucens strain CS2 flattened_line_10, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000120 Xanthomonas translucens strain CS2 flattened_line_236, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000059 Xanthomonas translucens strain CS2 flattened_line_114, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000134 Xanthomonas translucens strain CS2 flattened_line_264, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000088 Xanthomonas translucens strain CS2 flattened_line_174, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000123 Xanthomonas translucens strain CS2 flattened_line_242, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000122 Xanthomonas translucens strain CS2 flattened_line_240, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000034 Xanthomonas translucens strain CS2 flattened_line_64, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000020 Xanthomonas translucens strain CS2 flattened_line_38, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000028 Xanthomonas translucens strain CS2 flattened_line_52, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000108 Xanthomonas translucens strain CS2 flattened_line_213, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000080 Xanthomonas translucens strain CS2 flattened_line_156, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000077 Xanthomonas translucens strain CS2 flattened_line_150, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000118 Xanthomonas translucens strain CS2 flattened_line_232, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000128 Xanthomonas translucens strain CS2 flattened_line_252, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000009 Xanthomonas translucens strain CS2 flattened_line_16, whole genome shotgun sequence 0 crisprs Cas9_archaeal,cas3 0 0 0 0
NZ_LNVK01000043 Xanthomonas translucens strain CS2 flattened_line_82, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000083 Xanthomonas translucens strain CS2 flattened_line_162, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000097 Xanthomonas translucens strain CS2 flattened_line_192, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVK01000098 Xanthomonas translucens strain CS2 flattened_line_194, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_LNVK01000004
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2240 : 63010 48 Erysipelothrix_phage(16.67%) tRNA,plate,protease NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_LNVK01000008
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 61132 : 91494 40 Siphoviridae_environmental_samples(34.78%) terminase,tail,integrase attL 67205:67224|attR 93040:93059

Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_LNVK01000008.1|WP_058195519.1|89642_89927_-|hypothetical-protein 89642_89927_- 94 aa aa AcrIC10 NA NA 61132-91494 yes
NZ_LNVK01000008.1|WP_058195493.1|62845_63358_+|hypothetical-protein 62845_63358_+ 170 aa aa NA NA NA 61132-91494 yes
3. NZ_LNVK01000029
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNVK01000029_1 9023-11828 Orphan NA
58 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNVK01000029_2 12184-12279 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNVK01000029_3 12376-12806 Orphan NA
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LNVK01000029_1 1.7|9333|26|NZ_LNVK01000029|CRT 9333-9358 26 NZ_AP018921 Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence 47099-47124 2 0.923
NZ_LNVK01000029_1 1.7|9333|26|NZ_LNVK01000029|CRT 9333-9358 26 NZ_AP018921 Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence 201045-201070 2 0.923
NZ_LNVK01000029_1 1.7|9333|26|NZ_LNVK01000029|CRT 9333-9358 26 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 487851-487876 3 0.885
NZ_LNVK01000029_1 1.7|9333|26|NZ_LNVK01000029|CRT 9333-9358 26 NZ_CP029986 Sphingomonas sp. FARSPH plasmid p01, complete sequence 10880-10905 3 0.885
NZ_LNVK01000029_1 1.7|9333|26|NZ_LNVK01000029|CRT 9333-9358 26 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 823175-823200 3 0.885
NZ_LNVK01000029_1 1.7|9333|26|NZ_LNVK01000029|CRT 9333-9358 26 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 782223-782248 3 0.885
NZ_LNVK01000029_1 1.8|9381|26|NZ_LNVK01000029|CRT 9381-9406 26 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 520146-520171 3 0.885
NZ_LNVK01000029_1 1.8|9381|26|NZ_LNVK01000029|CRT 9381-9406 26 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 17268-17293 3 0.885
NZ_LNVK01000029_1 1.8|9381|26|NZ_LNVK01000029|CRT 9381-9406 26 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 533379-533404 3 0.885
NZ_LNVK01000029_1 1.8|9381|26|NZ_LNVK01000029|CRT 9381-9406 26 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 222780-222805 3 0.885
NZ_LNVK01000029_1 1.16|9765|26|NZ_LNVK01000029|CRT 9765-9790 26 NZ_CP029986 Sphingomonas sp. FARSPH plasmid p01, complete sequence 10880-10905 3 0.885
NZ_LNVK01000029_1 1.16|9765|26|NZ_LNVK01000029|CRT 9765-9790 26 NZ_AP018921 Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence 47099-47124 3 0.885
NZ_LNVK01000029_1 1.16|9765|26|NZ_LNVK01000029|CRT 9765-9790 26 NZ_AP018921 Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence 201045-201070 3 0.885
NZ_LNVK01000029_1 1.17|9813|26|NZ_LNVK01000029|CRT 9813-9838 26 NZ_CP010682 Phaeobacter piscinae strain P14 plasmid pP14_a, complete sequence 206583-206608 3 0.885
NZ_LNVK01000029_1 1.17|9813|26|NZ_LNVK01000029|CRT 9813-9838 26 NZ_CP010644 Phaeobacter piscinae strain P36 plasmid pP36_a, complete sequence 206685-206710 3 0.885
NZ_LNVK01000029_1 1.25|10197|26|NZ_LNVK01000029|CRT 10197-10222 26 NC_009427 Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence 260284-260309 3 0.885
NZ_LNVK01000029_1 1.25|10197|26|NZ_LNVK01000029|CRT 10197-10222 26 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 107729-107754 3 0.885
NZ_LNVK01000029_1 1.25|10197|26|NZ_LNVK01000029|CRT 10197-10222 26 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 501213-501238 3 0.885
NZ_LNVK01000029_1 1.27|10293|26|NZ_LNVK01000029|CRT 10293-10318 26 MN694784 Marine virus AFVG_250M786, complete genome 29983-30008 3 0.885
NZ_LNVK01000029_1 1.28|10341|26|NZ_LNVK01000029|CRT 10341-10366 26 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 408821-408846 3 0.885
NZ_LNVK01000029_1 1.30|10437|26|NZ_LNVK01000029|CRT 10437-10462 26 MN694784 Marine virus AFVG_250M786, complete genome 29983-30008 3 0.885
NZ_LNVK01000029_1 1.31|10485|26|NZ_LNVK01000029|CRT 10485-10510 26 NZ_CP025508 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence 370642-370667 3 0.885
NZ_LNVK01000029_1 1.31|10485|26|NZ_LNVK01000029|CRT 10485-10510 26 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 302074-302099 3 0.885
NZ_LNVK01000029_1 1.31|10485|26|NZ_LNVK01000029|CRT 10485-10510 26 NZ_CP022667 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence 267010-267035 3 0.885
NZ_LNVK01000029_1 1.31|10485|26|NZ_LNVK01000029|CRT 10485-10510 26 NZ_CP050087 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence 370629-370654 3 0.885
NZ_LNVK01000029_1 1.34|10629|26|NZ_LNVK01000029|CRT 10629-10654 26 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 408821-408846 3 0.885
NZ_LNVK01000029_1 1.38|10821|26|NZ_LNVK01000029|CRT 10821-10846 26 NZ_CP048816 Caulobacter rhizosphaerae strain KCTC 52515 plasmid unnamed 140314-140339 3 0.885
NZ_LNVK01000029_1 1.40|10917|26|NZ_LNVK01000029|CRT 10917-10942 26 NC_009427 Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence 260284-260309 3 0.885
NZ_LNVK01000029_1 1.40|10917|26|NZ_LNVK01000029|CRT 10917-10942 26 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 107729-107754 3 0.885
NZ_LNVK01000029_1 1.40|10917|26|NZ_LNVK01000029|CRT 10917-10942 26 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 501213-501238 3 0.885
NZ_LNVK01000029_1 1.46|11205|26|NZ_LNVK01000029|CRT 11205-11230 26 CP054922 Streptomyces sp. NA03103 plasmid unnamed2, complete sequence 113352-113377 3 0.885
NZ_LNVK01000029_1 1.49|11349|26|NZ_LNVK01000029|CRT 11349-11374 26 NC_009427 Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence 260284-260309 3 0.885
NZ_LNVK01000029_1 1.49|11349|26|NZ_LNVK01000029|CRT 11349-11374 26 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 107729-107754 3 0.885
NZ_LNVK01000029_1 1.49|11349|26|NZ_LNVK01000029|CRT 11349-11374 26 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 501213-501238 3 0.885
NZ_LNVK01000029_1 1.53|11541|26|NZ_LNVK01000029|CRT 11541-11566 26 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 673011-673036 3 0.885
NZ_LNVK01000029_1 1.55|11637|26|NZ_LNVK01000029|CRT 11637-11662 26 NZ_CP015203 Rhodococcus sp. 008 plasmid pR8L1, complete sequence 546047-546072 3 0.885
NZ_LNVK01000029_1 1.55|11637|26|NZ_LNVK01000029|CRT 11637-11662 26 NZ_CP034156 Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence 342233-342258 3 0.885
NZ_LNVK01000029_3 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder 12615-12639 25 MT889372 Microbacterium phage Avocadoman, complete genome 23120-23144 3 0.88
NZ_LNVK01000029_3 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder 12615-12639 25 MT639649 Microbacterium phage Burritobowl, complete genome 23512-23536 3 0.88
NZ_LNVK01000029_3 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder 12615-12639 25 MN062714 Microbacterium Phage DirtyBubble, complete genome 24364-24388 3 0.88
NZ_LNVK01000029_3 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder 12615-12639 25 MT889389 Microbacterium phage DickRichards, complete genome 23841-23865 3 0.88
NZ_LNVK01000029_3 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder 12615-12639 25 MT024860 Microbacterium phage Stromboli, complete genome 24734-24758 3 0.88
NZ_LNVK01000029_3 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder 12615-12639 25 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 281166-281190 3 0.88
NZ_LNVK01000029_3 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder 12615-12639 25 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 766061-766085 3 0.88
NZ_LNVK01000029_3 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder 12615-12639 25 NC_010997 Rhizobium etli CIAT 652 plasmid pC, complete sequence 194425-194449 3 0.88
NZ_LNVK01000029_3 3.8|12759|25|NZ_LNVK01000029|CRISPRCasFinder 12759-12783 25 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 328038-328062 3 0.88
NZ_LNVK01000029_3 3.8|12759|25|NZ_LNVK01000029|CRISPRCasFinder 12759-12783 25 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1960062-1960086 3 0.88
NZ_LNVK01000029_3 3.8|12759|25|NZ_LNVK01000029|CRISPRCasFinder 12759-12783 25 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1125643-1125667 3 0.88
NZ_LNVK01000029_1 1.3|9141|26|NZ_LNVK01000029|CRT 9141-9166 26 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 387646-387671 4 0.846
NZ_LNVK01000029_1 1.7|9333|26|NZ_LNVK01000029|CRT 9333-9358 26 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1107033-1107058 4 0.846
NZ_LNVK01000029_1 1.7|9333|26|NZ_LNVK01000029|CRT 9333-9358 26 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 154155-154180 4 0.846
NZ_LNVK01000029_1 1.7|9333|26|NZ_LNVK01000029|CRT 9333-9358 26 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 621505-621530 4 0.846
NZ_LNVK01000029_1 1.7|9333|26|NZ_LNVK01000029|CRT 9333-9358 26 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1294328-1294353 4 0.846
NZ_LNVK01000029_1 1.8|9381|26|NZ_LNVK01000029|CRT 9381-9406 26 NZ_CP039640 Azospirillum sp. TSH100 plasmid p1, complete sequence 268728-268753 4 0.846
NZ_LNVK01000029_1 1.10|9477|26|NZ_LNVK01000029|CRT 9477-9502 26 NZ_CP017422 Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence 108324-108349 4 0.846
NZ_LNVK01000029_1 1.13|9621|26|NZ_LNVK01000029|CRT 9621-9646 26 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 823175-823200 4 0.846
NZ_LNVK01000029_1 1.13|9621|26|NZ_LNVK01000029|CRT 9621-9646 26 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 782223-782248 4 0.846
NZ_LNVK01000029_1 1.14|9669|26|NZ_LNVK01000029|CRT 9669-9694 26 NZ_CP013482 Pandoraea apista strain DSM 16535 plasmid pPA35, complete sequence 48902-48927 4 0.846
NZ_LNVK01000029_1 1.15|9717|26|NZ_LNVK01000029|CRT 9717-9742 26 NZ_CP031960 Phaeobacter sp. LSS9 plasmid unnamed4, complete sequence 15787-15812 4 0.846
NZ_LNVK01000029_1 1.15|9717|26|NZ_LNVK01000029|CRT 9717-9742 26 NZ_CP010602 Phaeobacter inhibens strain P83 plasmid pP83_c, complete sequence 108240-108265 4 0.846
NZ_LNVK01000029_1 1.15|9717|26|NZ_LNVK01000029|CRT 9717-9742 26 NZ_CP010769 Phaeobacter piscinae strain P13 plasmid pP13_b, complete sequence 126397-126422 4 0.846
NZ_LNVK01000029_1 1.15|9717|26|NZ_LNVK01000029|CRT 9717-9742 26 NZ_CP010708 Phaeobacter inhibens strain P66 plasmid pP66_c, complete sequence 108237-108262 4 0.846
NZ_LNVK01000029_1 1.15|9717|26|NZ_LNVK01000029|CRT 9717-9742 26 NZ_CP010737 Phaeobacter inhibens strain P72 plasmid pP72_b, complete sequence 176590-176615 4 0.846
NZ_LNVK01000029_1 1.16|9765|26|NZ_LNVK01000029|CRT 9765-9790 26 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 487851-487876 4 0.846
NZ_LNVK01000029_1 1.18|9861|26|NZ_LNVK01000029|CRT 9861-9886 26 NZ_CP036488 Rahnella aquatilis strain MEM40 plasmid pMEM40-1, complete sequence 265342-265367 4 0.846
NZ_LNVK01000029_1 1.18|9861|26|NZ_LNVK01000029|CRT 9861-9886 26 NC_017060 Rahnella aquatilis HX2 plasmid PRA1, complete sequence 337760-337785 4 0.846
NZ_LNVK01000029_1 1.18|9861|26|NZ_LNVK01000029|CRT 9861-9886 26 NC_015062 Rahnella sp. Y9602 plasmid pRAHAQ01, complete sequence 340582-340607 4 0.846
NZ_LNVK01000029_1 1.20|9957|26|NZ_LNVK01000029|CRT 9957-9982 26 MN035618 Leviviridae sp. isolate H1_Rhizo_Litter_1_scaffold_1030_e_381 hypothetical protein (H1RhizoL11030e381_000001) and RNA-dependent RNA polymerase (H1RhizoL11030e381_000002) genes, complete cds 390-415 4 0.846
NZ_LNVK01000029_1 1.23|10101|26|NZ_LNVK01000029|CRT 10101-10126 26 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 1260828-1260853 4 0.846
NZ_LNVK01000029_1 1.25|10197|26|NZ_LNVK01000029|CRT 10197-10222 26 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 325313-325338 4 0.846
NZ_LNVK01000029_1 1.25|10197|26|NZ_LNVK01000029|CRT 10197-10222 26 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 475253-475278 4 0.846
NZ_LNVK01000029_1 1.25|10197|26|NZ_LNVK01000029|CRT 10197-10222 26 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 497431-497456 4 0.846
NZ_LNVK01000029_1 1.25|10197|26|NZ_LNVK01000029|CRT 10197-10222 26 NZ_CP045074 Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence 12931-12956 4 0.846
NZ_LNVK01000029_1 1.25|10197|26|NZ_LNVK01000029|CRT 10197-10222 26 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 783845-783870 4 0.846
NZ_LNVK01000029_1 1.25|10197|26|NZ_LNVK01000029|CRT 10197-10222 26 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 445755-445780 4 0.846
NZ_LNVK01000029_1 1.25|10197|26|NZ_LNVK01000029|CRT 10197-10222 26 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 270965-270990 4 0.846
NZ_LNVK01000029_1 1.27|10293|26|NZ_LNVK01000029|CRT 10293-10318 26 NZ_CP033429 Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence 135039-135064 4 0.846
NZ_LNVK01000029_1 1.28|10341|26|NZ_LNVK01000029|CRT 10341-10366 26 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 487851-487876 4 0.846
NZ_LNVK01000029_1 1.28|10341|26|NZ_LNVK01000029|CRT 10341-10366 26 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 744000-744025 4 0.846
NZ_LNVK01000029_1 1.28|10341|26|NZ_LNVK01000029|CRT 10341-10366 26 NZ_CP017422 Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence 108324-108349 4 0.846
NZ_LNVK01000029_1 1.28|10341|26|NZ_LNVK01000029|CRT 10341-10366 26 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 341354-341379 4 0.846
NZ_LNVK01000029_1 1.29|10389|26|NZ_LNVK01000029|CRT 10389-10414 26 MT114166 Microbacterium phage Nike, complete genome 27400-27425 4 0.846
NZ_LNVK01000029_1 1.29|10389|26|NZ_LNVK01000029|CRT 10389-10414 26 NC_047973 Microbacterium phage Hyperion, complete genome 27181-27206 4 0.846
NZ_LNVK01000029_1 1.29|10389|26|NZ_LNVK01000029|CRT 10389-10414 26 MT657333 Microbacterium phage Casend, complete genome 27308-27333 4 0.846
NZ_LNVK01000029_1 1.29|10389|26|NZ_LNVK01000029|CRT 10389-10414 26 NC_047975 Microbacterium phage Squash, complete genome 27411-27436 4 0.846
NZ_LNVK01000029_1 1.30|10437|26|NZ_LNVK01000029|CRT 10437-10462 26 NZ_CP033429 Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence 135039-135064 4 0.846
NZ_LNVK01000029_1 1.31|10485|26|NZ_LNVK01000029|CRT 10485-10510 26 NZ_CP025014 Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence 386159-386184 4 0.846
NZ_LNVK01000029_1 1.31|10485|26|NZ_LNVK01000029|CRT 10485-10510 26 NZ_CP018230 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence 90478-90503 4 0.846
NZ_LNVK01000029_1 1.31|10485|26|NZ_LNVK01000029|CRT 10485-10510 26 NZ_CP048282 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence 321672-321697 4 0.846
NZ_LNVK01000029_1 1.31|10485|26|NZ_LNVK01000029|CRT 10485-10510 26 NZ_CP054023 Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence 60637-60662 4 0.846
NZ_LNVK01000029_1 1.31|10485|26|NZ_LNVK01000029|CRT 10485-10510 26 NZ_CP054033 Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence 213942-213967 4 0.846
NZ_LNVK01000029_1 1.31|10485|26|NZ_LNVK01000029|CRT 10485-10510 26 NZ_CP022566 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence 495119-495144 4 0.846
NZ_LNVK01000029_1 1.31|10485|26|NZ_LNVK01000029|CRT 10485-10510 26 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 843111-843136 4 0.846
NZ_LNVK01000029_1 1.31|10485|26|NZ_LNVK01000029|CRT 10485-10510 26 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 691120-691145 4 0.846
NZ_LNVK01000029_1 1.31|10485|26|NZ_LNVK01000029|CRT 10485-10510 26 NZ_CP018080 Sulfitobacter sp. AM1-D1 plasmid unnamed4, complete sequence 157091-157116 4 0.846
NZ_LNVK01000029_1 1.32|10533|26|NZ_LNVK01000029|CRT 10533-10558 26 MT114166 Microbacterium phage Nike, complete genome 27400-27425 4 0.846
NZ_LNVK01000029_1 1.32|10533|26|NZ_LNVK01000029|CRT 10533-10558 26 NC_047973 Microbacterium phage Hyperion, complete genome 27181-27206 4 0.846
NZ_LNVK01000029_1 1.32|10533|26|NZ_LNVK01000029|CRT 10533-10558 26 MT657333 Microbacterium phage Casend, complete genome 27308-27333 4 0.846
NZ_LNVK01000029_1 1.32|10533|26|NZ_LNVK01000029|CRT 10533-10558 26 NC_047975 Microbacterium phage Squash, complete genome 27411-27436 4 0.846
NZ_LNVK01000029_1 1.34|10629|26|NZ_LNVK01000029|CRT 10629-10654 26 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 487851-487876 4 0.846
NZ_LNVK01000029_1 1.34|10629|26|NZ_LNVK01000029|CRT 10629-10654 26 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 744000-744025 4 0.846
NZ_LNVK01000029_1 1.34|10629|26|NZ_LNVK01000029|CRT 10629-10654 26 NZ_CP017422 Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence 108324-108349 4 0.846
NZ_LNVK01000029_1 1.34|10629|26|NZ_LNVK01000029|CRT 10629-10654 26 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 341354-341379 4 0.846
NZ_LNVK01000029_1 1.35|10677|26|NZ_LNVK01000029|CRT 10677-10702 26 MT114166 Microbacterium phage Nike, complete genome 27400-27425 4 0.846
NZ_LNVK01000029_1 1.35|10677|26|NZ_LNVK01000029|CRT 10677-10702 26 NC_047973 Microbacterium phage Hyperion, complete genome 27181-27206 4 0.846
NZ_LNVK01000029_1 1.35|10677|26|NZ_LNVK01000029|CRT 10677-10702 26 MT657333 Microbacterium phage Casend, complete genome 27308-27333 4 0.846
NZ_LNVK01000029_1 1.35|10677|26|NZ_LNVK01000029|CRT 10677-10702 26 NC_047975 Microbacterium phage Squash, complete genome 27411-27436 4 0.846
NZ_LNVK01000029_1 1.36|10725|26|NZ_LNVK01000029|CRT 10725-10750 26 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 1148986-1149011 4 0.846
NZ_LNVK01000029_1 1.37|10773|26|NZ_LNVK01000029|CRT 10773-10798 26 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 487851-487876 4 0.846
NZ_LNVK01000029_1 1.37|10773|26|NZ_LNVK01000029|CRT 10773-10798 26 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 379093-379118 4 0.846
NZ_LNVK01000029_1 1.38|10821|26|NZ_LNVK01000029|CRT 10821-10846 26 NZ_AP021845 Azospira sp. I09 plasmid pAZI09, complete sequence 80122-80147 4 0.846
NZ_LNVK01000029_1 1.38|10821|26|NZ_LNVK01000029|CRT 10821-10846 26 NZ_CP044348 Escherichia coli strain P225M plasmid pP225M-2, complete sequence 64172-64197 4 0.846
NZ_LNVK01000029_1 1.38|10821|26|NZ_LNVK01000029|CRT 10821-10846 26 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 774222-774247 4 0.846
NZ_LNVK01000029_1 1.39|10869|26|NZ_LNVK01000029|CRT 10869-10894 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 16802-16827 4 0.846
NZ_LNVK01000029_1 1.39|10869|26|NZ_LNVK01000029|CRT 10869-10894 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 111044-111069 4 0.846
NZ_LNVK01000029_1 1.39|10869|26|NZ_LNVK01000029|CRT 10869-10894 26 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 3898-3923 4 0.846
NZ_LNVK01000029_1 1.40|10917|26|NZ_LNVK01000029|CRT 10917-10942 26 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 325313-325338 4 0.846
NZ_LNVK01000029_1 1.40|10917|26|NZ_LNVK01000029|CRT 10917-10942 26 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 475253-475278 4 0.846
NZ_LNVK01000029_1 1.40|10917|26|NZ_LNVK01000029|CRT 10917-10942 26 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 497431-497456 4 0.846
NZ_LNVK01000029_1 1.40|10917|26|NZ_LNVK01000029|CRT 10917-10942 26 NZ_CP045074 Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence 12931-12956 4 0.846
NZ_LNVK01000029_1 1.40|10917|26|NZ_LNVK01000029|CRT 10917-10942 26 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 783845-783870 4 0.846
NZ_LNVK01000029_1 1.40|10917|26|NZ_LNVK01000029|CRT 10917-10942 26 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 445755-445780 4 0.846
NZ_LNVK01000029_1 1.40|10917|26|NZ_LNVK01000029|CRT 10917-10942 26 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 270965-270990 4 0.846
NZ_LNVK01000029_1 1.41|10965|26|NZ_LNVK01000029|CRT 10965-10990 26 NZ_CP032326 Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence 173114-173139 4 0.846
NZ_LNVK01000029_1 1.41|10965|26|NZ_LNVK01000029|CRT 10965-10990 26 NZ_CP012918 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence 27098-27123 4 0.846
NZ_LNVK01000029_1 1.42|11013|26|NZ_LNVK01000029|CRT 11013-11038 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 16802-16827 4 0.846
NZ_LNVK01000029_1 1.42|11013|26|NZ_LNVK01000029|CRT 11013-11038 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 111044-111069 4 0.846
NZ_LNVK01000029_1 1.42|11013|26|NZ_LNVK01000029|CRT 11013-11038 26 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 34684-34709 4 0.846
NZ_LNVK01000029_1 1.43|11061|26|NZ_LNVK01000029|CRT 11061-11086 26 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 408821-408846 4 0.846
NZ_LNVK01000029_1 1.44|11109|26|NZ_LNVK01000029|CRT 11109-11134 26 NZ_CP044348 Escherichia coli strain P225M plasmid pP225M-2, complete sequence 64172-64197 4 0.846
NZ_LNVK01000029_1 1.45|11157|26|NZ_LNVK01000029|CRT 11157-11182 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 16802-16827 4 0.846
NZ_LNVK01000029_1 1.45|11157|26|NZ_LNVK01000029|CRT 11157-11182 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 111044-111069 4 0.846
NZ_LNVK01000029_1 1.45|11157|26|NZ_LNVK01000029|CRT 11157-11182 26 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 3898-3923 4 0.846
NZ_LNVK01000029_1 1.46|11205|26|NZ_LNVK01000029|CRT 11205-11230 26 NZ_LR594668 Variovorax sp. SRS16 plasmid 3 83523-83548 4 0.846
NZ_LNVK01000029_1 1.46|11205|26|NZ_LNVK01000029|CRT 11205-11230 26 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 112115-112140 4 0.846
NZ_LNVK01000029_1 1.46|11205|26|NZ_LNVK01000029|CRT 11205-11230 26 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 487851-487876 4 0.846
NZ_LNVK01000029_1 1.46|11205|26|NZ_LNVK01000029|CRT 11205-11230 26 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 1130149-1130174 4 0.846
NZ_LNVK01000029_1 1.46|11205|26|NZ_LNVK01000029|CRT 11205-11230 26 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 987306-987331 4 0.846
NZ_LNVK01000029_1 1.47|11253|26|NZ_LNVK01000029|CRT 11253-11278 26 NZ_CP045406 Roseovarius sp. THAF9 plasmid pTHAF9_b, complete sequence 5141-5166 4 0.846
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1555871-1555896 4 0.846
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 618528-618553 4 0.846
NZ_LNVK01000029_1 1.49|11349|26|NZ_LNVK01000029|CRT 11349-11374 26 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 325313-325338 4 0.846
NZ_LNVK01000029_1 1.49|11349|26|NZ_LNVK01000029|CRT 11349-11374 26 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 475253-475278 4 0.846
NZ_LNVK01000029_1 1.49|11349|26|NZ_LNVK01000029|CRT 11349-11374 26 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 497431-497456 4 0.846
NZ_LNVK01000029_1 1.49|11349|26|NZ_LNVK01000029|CRT 11349-11374 26 NZ_CP045074 Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence 12931-12956 4 0.846
NZ_LNVK01000029_1 1.49|11349|26|NZ_LNVK01000029|CRT 11349-11374 26 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 783845-783870 4 0.846
NZ_LNVK01000029_1 1.49|11349|26|NZ_LNVK01000029|CRT 11349-11374 26 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 445755-445780 4 0.846
NZ_LNVK01000029_1 1.49|11349|26|NZ_LNVK01000029|CRT 11349-11374 26 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 270965-270990 4 0.846
NZ_LNVK01000029_1 1.50|11397|26|NZ_LNVK01000029|CRT 11397-11422 26 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 673011-673036 4 0.846
NZ_LNVK01000029_1 1.50|11397|26|NZ_LNVK01000029|CRT 11397-11422 26 NZ_CP032326 Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence 173114-173139 4 0.846
NZ_LNVK01000029_1 1.50|11397|26|NZ_LNVK01000029|CRT 11397-11422 26 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1641960-1641985 4 0.846
NZ_LNVK01000029_1 1.50|11397|26|NZ_LNVK01000029|CRT 11397-11422 26 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1659506-1659531 4 0.846
NZ_LNVK01000029_1 1.50|11397|26|NZ_LNVK01000029|CRT 11397-11422 26 NZ_CP015232 Epibacterium mobile F1926 plasmid unnamed2, complete sequence 140917-140942 4 0.846
NZ_LNVK01000029_1 1.50|11397|26|NZ_LNVK01000029|CRT 11397-11422 26 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 359535-359560 4 0.846
NZ_LNVK01000029_1 1.50|11397|26|NZ_LNVK01000029|CRT 11397-11422 26 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 359522-359547 4 0.846
NZ_LNVK01000029_1 1.50|11397|26|NZ_LNVK01000029|CRT 11397-11422 26 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1624841-1624866 4 0.846
NZ_LNVK01000029_1 1.50|11397|26|NZ_LNVK01000029|CRT 11397-11422 26 NZ_CP012918 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence 27098-27123 4 0.846
NZ_LNVK01000029_1 1.50|11397|26|NZ_LNVK01000029|CRT 11397-11422 26 NZ_LR027555 Epibacterium mobile isolate EPIB1 plasmid 3, complete sequence 61582-61607 4 0.846
NZ_LNVK01000029_1 1.51|11445|26|NZ_LNVK01000029|CRT 11445-11470 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 16802-16827 4 0.846
NZ_LNVK01000029_1 1.51|11445|26|NZ_LNVK01000029|CRT 11445-11470 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 111044-111069 4 0.846
NZ_LNVK01000029_1 1.51|11445|26|NZ_LNVK01000029|CRT 11445-11470 26 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 34684-34709 4 0.846
NZ_LNVK01000029_1 1.53|11541|26|NZ_LNVK01000029|CRT 11541-11566 26 NZ_CP015232 Epibacterium mobile F1926 plasmid unnamed2, complete sequence 140917-140942 4 0.846
NZ_LNVK01000029_1 1.54|11589|26|NZ_LNVK01000029|CRT 11589-11614 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 16802-16827 4 0.846
NZ_LNVK01000029_1 1.54|11589|26|NZ_LNVK01000029|CRT 11589-11614 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 111044-111069 4 0.846
NZ_LNVK01000029_1 1.54|11589|26|NZ_LNVK01000029|CRT 11589-11614 26 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 34684-34709 4 0.846
NZ_LNVK01000029_1 1.55|11637|26|NZ_LNVK01000029|CRT 11637-11662 26 NZ_CP014942 Rhodococcus sp. BH4 plasmid, complete sequence 548034-548059 4 0.846
NZ_LNVK01000029_1 1.55|11637|26|NZ_LNVK01000029|CRT 11637-11662 26 NZ_CP007256 Rhodococcus erythropolis R138 plasmid pCRE138, complete sequence 70971-70996 4 0.846
NZ_LNVK01000029_1 1.55|11637|26|NZ_LNVK01000029|CRT 11637-11662 26 NZ_CP017242 Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence 6332-6357 4 0.846
NZ_LNVK01000029_1 1.57|11733|26|NZ_LNVK01000029|CRT 11733-11758 26 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 436690-436715 4 0.846
NZ_LNVK01000029_1 1.57|11733|26|NZ_LNVK01000029|CRT 11733-11758 26 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 614174-614199 4 0.846
NZ_LNVK01000029_1 1.58|11781|26|NZ_LNVK01000029|CRT 11781-11806 26 NZ_CP023738 Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence 195900-195925 4 0.846
NZ_LNVK01000029_3 3.3|12519|25|NZ_LNVK01000029|CRISPRCasFinder 12519-12543 25 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 351846-351870 4 0.84
NZ_LNVK01000029_3 3.4|12567|25|NZ_LNVK01000029|CRISPRCasFinder 12567-12591 25 MK757446 Mycobacterium phage Candle, complete genome 9162-9186 4 0.84
NZ_LNVK01000029_3 3.4|12567|25|NZ_LNVK01000029|CRISPRCasFinder 12567-12591 25 KY969628 Mycobacterium phage Zenon, complete genome 9164-9188 4 0.84
NZ_LNVK01000029_3 3.4|12567|25|NZ_LNVK01000029|CRISPRCasFinder 12567-12591 25 MH926059 Mycobacterium phage Riparian, complete genome 8620-8644 4 0.84
NZ_LNVK01000029_3 3.4|12567|25|NZ_LNVK01000029|CRISPRCasFinder 12567-12591 25 JF704112 Mycobacterium phage Send513, complete sequence 9162-9186 4 0.84
NZ_LNVK01000029_3 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder 12615-12639 25 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 884327-884351 4 0.84
NZ_LNVK01000029_3 3.6|12663|25|NZ_LNVK01000029|CRISPRCasFinder 12663-12687 25 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 1379972-1379996 4 0.84
NZ_LNVK01000029_3 3.6|12663|25|NZ_LNVK01000029|CRISPRCasFinder 12663-12687 25 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 1379950-1379974 4 0.84
NZ_LNVK01000029_3 3.7|12711|25|NZ_LNVK01000029|CRISPRCasFinder 12711-12735 25 NZ_CP010990 Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence 60660-60684 4 0.84
NZ_LNVK01000029_3 3.8|12759|25|NZ_LNVK01000029|CRISPRCasFinder 12759-12783 25 NZ_CP045549 Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence 19015-19039 4 0.84
NZ_LNVK01000029_1 1.1|9045|26|NZ_LNVK01000029|CRT 9045-9070 26 NZ_CP021373 Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence 14156-14181 5 0.808
NZ_LNVK01000029_1 1.3|9141|26|NZ_LNVK01000029|CRT 9141-9166 26 NZ_CP047178 Rathayibacter sp. VKM Ac-2759 plasmid unnamed2, complete sequence 11775-11800 5 0.808
NZ_LNVK01000029_1 1.4|9189|26|NZ_LNVK01000029|CRT 9189-9214 26 NZ_CP027551 Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence 9301-9326 5 0.808
NZ_LNVK01000029_1 1.4|9189|26|NZ_LNVK01000029|CRT 9189-9214 26 NZ_CP027551 Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence 45532-45557 5 0.808
NZ_LNVK01000029_1 1.4|9189|26|NZ_LNVK01000029|CRT 9189-9214 26 NZ_CP027551 Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence 53542-53567 5 0.808
NZ_LNVK01000029_1 1.4|9189|26|NZ_LNVK01000029|CRT 9189-9214 26 NZ_CP027551 Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence 58047-58072 5 0.808
NZ_LNVK01000029_1 1.4|9189|26|NZ_LNVK01000029|CRT 9189-9214 26 NZ_CP027551 Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence 67068-67093 5 0.808
NZ_LNVK01000029_1 1.5|9237|26|NZ_LNVK01000029|CRT 9237-9262 26 NC_015057 Granulicella tundricola MP5ACTX9 plasmid pACIX901, complete sequence 208837-208862 5 0.808
NZ_LNVK01000029_1 1.7|9333|26|NZ_LNVK01000029|CRT 9333-9358 26 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 112115-112140 5 0.808
NZ_LNVK01000029_1 1.7|9333|26|NZ_LNVK01000029|CRT 9333-9358 26 NZ_CP029209 Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence 294347-294372 5 0.808
NZ_LNVK01000029_1 1.8|9381|26|NZ_LNVK01000029|CRT 9381-9406 26 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 899336-899361 5 0.808
NZ_LNVK01000029_1 1.8|9381|26|NZ_LNVK01000029|CRT 9381-9406 26 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 295595-295620 5 0.808
NZ_LNVK01000029_1 1.8|9381|26|NZ_LNVK01000029|CRT 9381-9406 26 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 501105-501130 5 0.808
NZ_LNVK01000029_1 1.8|9381|26|NZ_LNVK01000029|CRT 9381-9406 26 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 158361-158386 5 0.808
NZ_LNVK01000029_1 1.8|9381|26|NZ_LNVK01000029|CRT 9381-9406 26 MF375456 Xanthomonas phage phi Xc10, complete genome 25609-25634 5 0.808
NZ_LNVK01000029_1 1.8|9381|26|NZ_LNVK01000029|CRT 9381-9406 26 NC_030937 Xanthomonas phage f30-Xaj, complete genome 11639-11664 5 0.808
NZ_LNVK01000029_1 1.8|9381|26|NZ_LNVK01000029|CRT 9381-9406 26 MK903278 Xanthomonas phage Pagan, complete genome 25833-25858 5 0.808
NZ_LNVK01000029_1 1.8|9381|26|NZ_LNVK01000029|CRT 9381-9406 26 NC_030928 Xanthomonas phage f20-Xaj, complete genome 25560-25585 5 0.808
NZ_LNVK01000029_1 1.10|9477|26|NZ_LNVK01000029|CRT 9477-9502 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 67570-67595 5 0.808
NZ_LNVK01000029_1 1.10|9477|26|NZ_LNVK01000029|CRT 9477-9502 26 NZ_CP049116 Pantoea stewartii strain ZJ-FGZX1 plasmid unnamed1, complete sequence 269956-269981 5 0.808
NZ_LNVK01000029_1 1.10|9477|26|NZ_LNVK01000029|CRT 9477-9502 26 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 25845-25870 5 0.808
NZ_LNVK01000029_1 1.12|9573|26|NZ_LNVK01000029|CRT 9573-9598 26 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 595383-595408 5 0.808
NZ_LNVK01000029_1 1.12|9573|26|NZ_LNVK01000029|CRT 9573-9598 26 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 180300-180325 5 0.808
NZ_LNVK01000029_1 1.13|9621|26|NZ_LNVK01000029|CRT 9621-9646 26 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1294328-1294353 5 0.808
NZ_LNVK01000029_1 1.15|9717|26|NZ_LNVK01000029|CRT 9717-9742 26 NZ_LT984809 Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence 134799-134824 5 0.808
NZ_LNVK01000029_1 1.15|9717|26|NZ_LNVK01000029|CRT 9717-9742 26 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 4571-4596 5 0.808
NZ_LNVK01000029_1 1.16|9765|26|NZ_LNVK01000029|CRT 9765-9790 26 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1107033-1107058 5 0.808
NZ_LNVK01000029_1 1.23|10101|26|NZ_LNVK01000029|CRT 10101-10126 26 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4359911-4359936 5 0.808
NZ_LNVK01000029_1 1.25|10197|26|NZ_LNVK01000029|CRT 10197-10222 26 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 513479-513504 5 0.808
NZ_LNVK01000029_1 1.25|10197|26|NZ_LNVK01000029|CRT 10197-10222 26 NC_008308 Sphingomonas sp. KA1 plasmid pCAR3 DNA, complete sequence 118376-118401 5 0.808
NZ_LNVK01000029_1 1.25|10197|26|NZ_LNVK01000029|CRT 10197-10222 26 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 371854-371879 5 0.808
NZ_LNVK01000029_1 1.25|10197|26|NZ_LNVK01000029|CRT 10197-10222 26 NC_015597 Sinorhizobium meliloti AK83 plasmid pSINME01, complete sequence 166575-166600 5 0.808
NZ_LNVK01000029_1 1.25|10197|26|NZ_LNVK01000029|CRT 10197-10222 26 NZ_CP018064 Rhodococcus sp. 2G plasmid p1, complete sequence 323169-323194 5 0.808
NZ_LNVK01000029_1 1.25|10197|26|NZ_LNVK01000029|CRT 10197-10222 26 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 1168608-1168633 5 0.808
NZ_LNVK01000029_1 1.25|10197|26|NZ_LNVK01000029|CRT 10197-10222 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 67570-67595 5 0.808
NZ_LNVK01000029_1 1.25|10197|26|NZ_LNVK01000029|CRT 10197-10222 26 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 1286344-1286369 5 0.808
NZ_LNVK01000029_1 1.25|10197|26|NZ_LNVK01000029|CRT 10197-10222 26 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 249721-249746 5 0.808
NZ_LNVK01000029_1 1.25|10197|26|NZ_LNVK01000029|CRT 10197-10222 26 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 535597-535622 5 0.808
NZ_LNVK01000029_1 1.25|10197|26|NZ_LNVK01000029|CRT 10197-10222 26 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 89825-89850 5 0.808
NZ_LNVK01000029_1 1.25|10197|26|NZ_LNVK01000029|CRT 10197-10222 26 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 175304-175329 5 0.808
NZ_LNVK01000029_1 1.25|10197|26|NZ_LNVK01000029|CRT 10197-10222 26 NZ_CP019483 Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence 1050790-1050815 5 0.808
NZ_LNVK01000029_1 1.25|10197|26|NZ_LNVK01000029|CRT 10197-10222 26 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 25845-25870 5 0.808
NZ_LNVK01000029_1 1.25|10197|26|NZ_LNVK01000029|CRT 10197-10222 26 NZ_CP019486 Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence 1005013-1005038 5 0.808
NZ_LNVK01000029_1 1.25|10197|26|NZ_LNVK01000029|CRT 10197-10222 26 NZ_CP024891 Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence 84391-84416 5 0.808
NZ_LNVK01000029_1 1.28|10341|26|NZ_LNVK01000029|CRT 10341-10366 26 NZ_CP045122 Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence 210197-210222 5 0.808
NZ_LNVK01000029_1 1.28|10341|26|NZ_LNVK01000029|CRT 10341-10366 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 67570-67595 5 0.808
NZ_LNVK01000029_1 1.28|10341|26|NZ_LNVK01000029|CRT 10341-10366 26 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 25845-25870 5 0.808
NZ_LNVK01000029_1 1.28|10341|26|NZ_LNVK01000029|CRT 10341-10366 26 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 45322-45347 5 0.808
NZ_LNVK01000029_1 1.29|10389|26|NZ_LNVK01000029|CRT 10389-10414 26 MN183284 Microbacterium phage Mashley, complete genome 26997-27022 5 0.808
NZ_LNVK01000029_1 1.31|10485|26|NZ_LNVK01000029|CRT 10485-10510 26 NZ_CP045122 Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence 210197-210222 5 0.808
NZ_LNVK01000029_1 1.31|10485|26|NZ_LNVK01000029|CRT 10485-10510 26 NZ_CP016289 Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence 6045-6070 5 0.808
NZ_LNVK01000029_1 1.32|10533|26|NZ_LNVK01000029|CRT 10533-10558 26 MN183284 Microbacterium phage Mashley, complete genome 26997-27022 5 0.808
NZ_LNVK01000029_1 1.34|10629|26|NZ_LNVK01000029|CRT 10629-10654 26 NZ_CP045122 Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence 210197-210222 5 0.808
NZ_LNVK01000029_1 1.34|10629|26|NZ_LNVK01000029|CRT 10629-10654 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 67570-67595 5 0.808
NZ_LNVK01000029_1 1.34|10629|26|NZ_LNVK01000029|CRT 10629-10654 26 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 25845-25870 5 0.808
NZ_LNVK01000029_1 1.34|10629|26|NZ_LNVK01000029|CRT 10629-10654 26 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 45322-45347 5 0.808
NZ_LNVK01000029_1 1.35|10677|26|NZ_LNVK01000029|CRT 10677-10702 26 MN183284 Microbacterium phage Mashley, complete genome 26997-27022 5 0.808
NZ_LNVK01000029_1 1.37|10773|26|NZ_LNVK01000029|CRT 10773-10798 26 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 112115-112140 5 0.808
NZ_LNVK01000029_1 1.38|10821|26|NZ_LNVK01000029|CRT 10821-10846 26 NZ_CP019315 Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-3, complete sequence 11628-11653 5 0.808
NZ_LNVK01000029_1 1.39|10869|26|NZ_LNVK01000029|CRT 10869-10894 26 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 344688-344713 5 0.808
NZ_LNVK01000029_1 1.39|10869|26|NZ_LNVK01000029|CRT 10869-10894 26 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 702721-702746 5 0.808
NZ_LNVK01000029_1 1.40|10917|26|NZ_LNVK01000029|CRT 10917-10942 26 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 513479-513504 5 0.808
NZ_LNVK01000029_1 1.40|10917|26|NZ_LNVK01000029|CRT 10917-10942 26 NC_008308 Sphingomonas sp. KA1 plasmid pCAR3 DNA, complete sequence 118376-118401 5 0.808
NZ_LNVK01000029_1 1.40|10917|26|NZ_LNVK01000029|CRT 10917-10942 26 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 371854-371879 5 0.808
NZ_LNVK01000029_1 1.40|10917|26|NZ_LNVK01000029|CRT 10917-10942 26 NC_015597 Sinorhizobium meliloti AK83 plasmid pSINME01, complete sequence 166575-166600 5 0.808
NZ_LNVK01000029_1 1.40|10917|26|NZ_LNVK01000029|CRT 10917-10942 26 NZ_CP018064 Rhodococcus sp. 2G plasmid p1, complete sequence 323169-323194 5 0.808
NZ_LNVK01000029_1 1.40|10917|26|NZ_LNVK01000029|CRT 10917-10942 26 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 1168608-1168633 5 0.808
NZ_LNVK01000029_1 1.40|10917|26|NZ_LNVK01000029|CRT 10917-10942 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 67570-67595 5 0.808
NZ_LNVK01000029_1 1.40|10917|26|NZ_LNVK01000029|CRT 10917-10942 26 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 1286344-1286369 5 0.808
NZ_LNVK01000029_1 1.40|10917|26|NZ_LNVK01000029|CRT 10917-10942 26 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 249721-249746 5 0.808
NZ_LNVK01000029_1 1.40|10917|26|NZ_LNVK01000029|CRT 10917-10942 26 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 535597-535622 5 0.808
NZ_LNVK01000029_1 1.40|10917|26|NZ_LNVK01000029|CRT 10917-10942 26 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 89825-89850 5 0.808
NZ_LNVK01000029_1 1.40|10917|26|NZ_LNVK01000029|CRT 10917-10942 26 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 175304-175329 5 0.808
NZ_LNVK01000029_1 1.40|10917|26|NZ_LNVK01000029|CRT 10917-10942 26 NZ_CP019483 Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence 1050790-1050815 5 0.808
NZ_LNVK01000029_1 1.40|10917|26|NZ_LNVK01000029|CRT 10917-10942 26 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 25845-25870 5 0.808
NZ_LNVK01000029_1 1.40|10917|26|NZ_LNVK01000029|CRT 10917-10942 26 NZ_CP019486 Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence 1005013-1005038 5 0.808
NZ_LNVK01000029_1 1.40|10917|26|NZ_LNVK01000029|CRT 10917-10942 26 NZ_CP024891 Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence 84391-84416 5 0.808
NZ_LNVK01000029_1 1.41|10965|26|NZ_LNVK01000029|CRT 10965-10990 26 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 673011-673036 5 0.808
NZ_LNVK01000029_1 1.42|11013|26|NZ_LNVK01000029|CRT 11013-11038 26 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 3898-3923 5 0.808
NZ_LNVK01000029_1 1.43|11061|26|NZ_LNVK01000029|CRT 11061-11086 26 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 487851-487876 5 0.808
NZ_LNVK01000029_1 1.43|11061|26|NZ_LNVK01000029|CRT 11061-11086 26 NZ_CP017422 Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence 108324-108349 5 0.808
NZ_LNVK01000029_1 1.43|11061|26|NZ_LNVK01000029|CRT 11061-11086 26 NZ_CP045122 Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence 210197-210222 5 0.808
NZ_LNVK01000029_1 1.43|11061|26|NZ_LNVK01000029|CRT 11061-11086 26 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 341354-341379 5 0.808
NZ_LNVK01000029_1 1.43|11061|26|NZ_LNVK01000029|CRT 11061-11086 26 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 45322-45347 5 0.808
NZ_LNVK01000029_1 1.44|11109|26|NZ_LNVK01000029|CRT 11109-11134 26 NZ_CP035502 Sphingosinicella sp. BN140058 plasmid p1, complete sequence 159356-159381 5 0.808
NZ_LNVK01000029_1 1.44|11109|26|NZ_LNVK01000029|CRT 11109-11134 26 NZ_CP019315 Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-3, complete sequence 11628-11653 5 0.808
NZ_LNVK01000029_1 1.44|11109|26|NZ_LNVK01000029|CRT 11109-11134 26 MT498057 Microbacterium phage Cicada, complete genome 22953-22978 5 0.808
NZ_LNVK01000029_1 1.45|11157|26|NZ_LNVK01000029|CRT 11157-11182 26 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 344688-344713 5 0.808
NZ_LNVK01000029_1 1.45|11157|26|NZ_LNVK01000029|CRT 11157-11182 26 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 702721-702746 5 0.808
NZ_LNVK01000029_1 1.46|11205|26|NZ_LNVK01000029|CRT 11205-11230 26 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1389298-1389323 5 0.808
NZ_LNVK01000029_1 1.46|11205|26|NZ_LNVK01000029|CRT 11205-11230 26 NZ_MN433457 Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence 299573-299598 5 0.808
NZ_LNVK01000029_1 1.46|11205|26|NZ_LNVK01000029|CRT 11205-11230 26 NZ_CP022416 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-1, complete sequence 228968-228993 5 0.808
NZ_LNVK01000029_1 1.46|11205|26|NZ_LNVK01000029|CRT 11205-11230 26 MN583270 Pseudomonas aeruginosa strain NK546 plasmid pNK546b, complete sequence 26605-26630 5 0.808
NZ_LNVK01000029_1 1.46|11205|26|NZ_LNVK01000029|CRT 11205-11230 26 NZ_CP014598 Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence 224229-224254 5 0.808
NZ_LNVK01000029_1 1.46|11205|26|NZ_LNVK01000029|CRT 11205-11230 26 MK376351 Pseudomonas sp. strain ANT_H62 plasmid pA62H2, complete sequence 57727-57752 5 0.808
NZ_LNVK01000029_1 1.47|11253|26|NZ_LNVK01000029|CRT 11253-11278 26 NZ_CP013856 Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence 102633-102658 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1839450-1839475 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 754600-754625 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 752536-752561 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1171297-1171322 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 849514-849539 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 803210-803235 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 899399-899424 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 751676-751701 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP021043 Phaeobacter gallaeciensis strain P129 plasmid pP129_c, complete sequence 8997-9022 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 649783-649808 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 717478-717503 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP010676 Phaeobacter gallaeciensis strain P75 plasmid pP75_c, complete sequence 8986-9011 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 874639-874664 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NC_023139 Phaeobacter gallaeciensis DSM 26640 plasmid pGal_C110, complete sequence 9144-9169 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1171426-1171451 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 899391-899416 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 630477-630502 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 667645-667670 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1226801-1226826 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 899406-899431 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 791469-791494 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 234551-234576 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 878985-879010 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 725022-725047 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1202238-1202263 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 806702-806727 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 706034-706059 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 648898-648923 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 651732-651757 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 651722-651747 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 805303-805328 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 992401-992426 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1171031-1171056 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 649771-649796 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 649789-649814 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 649768-649793 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 277028-277053 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1182790-1182815 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 132453-132478 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 878974-878999 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 992368-992393 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 913215-913240 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 992369-992394 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1170976-1171001 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 773107-773132 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 913215-913240 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 659609-659634 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 992382-992407 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 754664-754689 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 773130-773155 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 913215-913240 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 913215-913240 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 913215-913240 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 992382-992407 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1158931-1158956 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 992371-992396 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 773130-773155 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 807848-807873 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 754664-754689 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 788541-788566 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 842775-842800 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 879657-879682 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1271951-1271976 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 992371-992396 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 773130-773155 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 925031-925056 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 992367-992392 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 773130-773155 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 773130-773155 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 992382-992407 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 913217-913242 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1185737-1185762 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 992393-992418 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 992371-992396 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1185737-1185762 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP010591 Phaeobacter gallaeciensis strain P11 plasmid pP11_c, complete sequence 8986-9011 5 0.808
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 754650-754675 5 0.808
NZ_LNVK01000029_1 1.49|11349|26|NZ_LNVK01000029|CRT 11349-11374 26 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 513479-513504 5 0.808
NZ_LNVK01000029_1 1.49|11349|26|NZ_LNVK01000029|CRT 11349-11374 26 NC_008308 Sphingomonas sp. KA1 plasmid pCAR3 DNA, complete sequence 118376-118401 5 0.808
NZ_LNVK01000029_1 1.49|11349|26|NZ_LNVK01000029|CRT 11349-11374 26 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 371854-371879 5 0.808
NZ_LNVK01000029_1 1.49|11349|26|NZ_LNVK01000029|CRT 11349-11374 26 NC_015597 Sinorhizobium meliloti AK83 plasmid pSINME01, complete sequence 166575-166600 5 0.808
NZ_LNVK01000029_1 1.49|11349|26|NZ_LNVK01000029|CRT 11349-11374 26 NZ_CP018064 Rhodococcus sp. 2G plasmid p1, complete sequence 323169-323194 5 0.808
NZ_LNVK01000029_1 1.49|11349|26|NZ_LNVK01000029|CRT 11349-11374 26 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 1168608-1168633 5 0.808
NZ_LNVK01000029_1 1.49|11349|26|NZ_LNVK01000029|CRT 11349-11374 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 67570-67595 5 0.808
NZ_LNVK01000029_1 1.49|11349|26|NZ_LNVK01000029|CRT 11349-11374 26 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 1286344-1286369 5 0.808
NZ_LNVK01000029_1 1.49|11349|26|NZ_LNVK01000029|CRT 11349-11374 26 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 249721-249746 5 0.808
NZ_LNVK01000029_1 1.49|11349|26|NZ_LNVK01000029|CRT 11349-11374 26 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 535597-535622 5 0.808
NZ_LNVK01000029_1 1.49|11349|26|NZ_LNVK01000029|CRT 11349-11374 26 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 89825-89850 5 0.808
NZ_LNVK01000029_1 1.49|11349|26|NZ_LNVK01000029|CRT 11349-11374 26 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 175304-175329 5 0.808
NZ_LNVK01000029_1 1.49|11349|26|NZ_LNVK01000029|CRT 11349-11374 26 NZ_CP019483 Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence 1050790-1050815 5 0.808
NZ_LNVK01000029_1 1.49|11349|26|NZ_LNVK01000029|CRT 11349-11374 26 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 25845-25870 5 0.808
NZ_LNVK01000029_1 1.49|11349|26|NZ_LNVK01000029|CRT 11349-11374 26 NZ_CP019486 Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence 1005013-1005038 5 0.808
NZ_LNVK01000029_1 1.49|11349|26|NZ_LNVK01000029|CRT 11349-11374 26 NZ_CP024891 Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence 84391-84416 5 0.808
NZ_LNVK01000029_1 1.50|11397|26|NZ_LNVK01000029|CRT 11397-11422 26 NZ_CP049029 Fluviibacterium aquatile strain SC52 plasmid pSC52_1, complete sequence 116653-116678 5 0.808
NZ_LNVK01000029_1 1.51|11445|26|NZ_LNVK01000029|CRT 11445-11470 26 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 3898-3923 5 0.808
NZ_LNVK01000029_1 1.52|11493|26|NZ_LNVK01000029|CRT 11493-11518 26 NZ_KX426227 Acinetobacter lwoffii strain ED23-35 plasmid pALWED1.1, complete sequence 168483-168508 5 0.808
NZ_LNVK01000029_1 1.52|11493|26|NZ_LNVK01000029|CRT 11493-11518 26 CP033569 Acinetobacter pittii strain 2014N21-145 plasmid p2014N21-145-1, complete sequence 150546-150571 5 0.808
NZ_LNVK01000029_1 1.52|11493|26|NZ_LNVK01000029|CRT 11493-11518 26 NZ_CP017422 Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence 108324-108349 5 0.808
NZ_LNVK01000029_1 1.52|11493|26|NZ_LNVK01000029|CRT 11493-11518 26 NZ_CP010351 Acinetobacter johnsonii XBB1 plasmid pXBB1-9, complete sequence 318096-318121 5 0.808
NZ_LNVK01000029_1 1.52|11493|26|NZ_LNVK01000029|CRT 11493-11518 26 NZ_CP029396 Acinetobacter defluvii strain WCHA30 plasmid pOXA58_010030, complete sequence 308932-308957 5 0.808
NZ_LNVK01000029_1 1.53|11541|26|NZ_LNVK01000029|CRT 11541-11566 26 NZ_CP049029 Fluviibacterium aquatile strain SC52 plasmid pSC52_1, complete sequence 116653-116678 5 0.808
NZ_LNVK01000029_1 1.53|11541|26|NZ_LNVK01000029|CRT 11541-11566 26 NZ_CP032326 Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence 173114-173139 5 0.808
NZ_LNVK01000029_1 1.53|11541|26|NZ_LNVK01000029|CRT 11541-11566 26 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1641960-1641985 5 0.808
NZ_LNVK01000029_1 1.53|11541|26|NZ_LNVK01000029|CRT 11541-11566 26 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1659506-1659531 5 0.808
NZ_LNVK01000029_1 1.53|11541|26|NZ_LNVK01000029|CRT 11541-11566 26 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 359535-359560 5 0.808
NZ_LNVK01000029_1 1.53|11541|26|NZ_LNVK01000029|CRT 11541-11566 26 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 359522-359547 5 0.808
NZ_LNVK01000029_1 1.53|11541|26|NZ_LNVK01000029|CRT 11541-11566 26 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1624841-1624866 5 0.808
NZ_LNVK01000029_1 1.53|11541|26|NZ_LNVK01000029|CRT 11541-11566 26 NZ_CP012918 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence 27098-27123 5 0.808
NZ_LNVK01000029_1 1.54|11589|26|NZ_LNVK01000029|CRT 11589-11614 26 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 3898-3923 5 0.808
NZ_LNVK01000029_1 1.55|11637|26|NZ_LNVK01000029|CRT 11637-11662 26 NZ_CP017782 Rhodobacter sp. LPB0142 plasmid pEJ01, complete sequence 4813-4838 5 0.808
NZ_LNVK01000029_1 1.55|11637|26|NZ_LNVK01000029|CRT 11637-11662 26 NZ_CP017782 Rhodobacter sp. LPB0142 plasmid pEJ01, complete sequence 114089-114114 5 0.808
NZ_LNVK01000029_1 1.58|11781|26|NZ_LNVK01000029|CRT 11781-11806 26 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 33473-33498 5 0.808
NZ_LNVK01000029_1 1.58|11781|26|NZ_LNVK01000029|CRT 11781-11806 26 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 146106-146131 5 0.808
NZ_LNVK01000029_3 3.3|12519|25|NZ_LNVK01000029|CRISPRCasFinder 12519-12543 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5288431-5288455 5 0.8
NZ_LNVK01000029_3 3.3|12519|25|NZ_LNVK01000029|CRISPRCasFinder 12519-12543 25 NZ_CP021658 Aeromonas salmonicida strain O23A plasmid pO23AP4, complete sequence 15910-15934 5 0.8
NZ_LNVK01000029_3 3.3|12519|25|NZ_LNVK01000029|CRISPRCasFinder 12519-12543 25 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 68354-68378 5 0.8
NZ_LNVK01000029_3 3.3|12519|25|NZ_LNVK01000029|CRISPRCasFinder 12519-12543 25 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 528593-528617 5 0.8
NZ_LNVK01000029_3 3.3|12519|25|NZ_LNVK01000029|CRISPRCasFinder 12519-12543 25 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 409238-409262 5 0.8
NZ_LNVK01000029_3 3.3|12519|25|NZ_LNVK01000029|CRISPRCasFinder 12519-12543 25 MN444870 Gordonia phage Syleon, complete genome 28799-28823 5 0.8
NZ_LNVK01000029_3 3.3|12519|25|NZ_LNVK01000029|CRISPRCasFinder 12519-12543 25 MH976515 Gordonia phage Octobien14, complete genome 29393-29417 5 0.8
NZ_LNVK01000029_3 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder 12615-12639 25 MH727545 Mycobacterium phage DismalStressor, complete genome 39161-39185 5 0.8
NZ_LNVK01000029_3 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder 12615-12639 25 NC_026598 Mycobacterium phage Milly, complete genome 39134-39158 5 0.8
NZ_LNVK01000029_3 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder 12615-12639 25 MH834601 Mycobacterium phage BoostSeason, complete genome 38730-38754 5 0.8
NZ_LNVK01000029_3 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder 12615-12639 25 KX688047 Mycobacterium phage Marcoliusprime, complete genome 39161-39185 5 0.8
NZ_LNVK01000029_3 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder 12615-12639 25 NC_028759 Mycobacterium phage Mufasa, complete genome 38715-38739 5 0.8
NZ_LNVK01000029_3 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder 12615-12639 25 MF140408 Mycobacterium phage DismalFunk, complete genome 39161-39185 5 0.8
NZ_LNVK01000029_1 1.8|9381|26|NZ_LNVK01000029|CRT 9381-9406 26 MN585989 Mycobacterium phage Superchunk, complete genome 5292-5317 6 0.769
NZ_LNVK01000029_1 1.10|9477|26|NZ_LNVK01000029|CRT 9477-9502 26 LT559120 Nonomuraea sp. ATCC 39727 isolate nono1 genome assembly, plasmid: III 23471-23496 6 0.769
NZ_LNVK01000029_1 1.11|9525|26|NZ_LNVK01000029|CRT 9525-9550 26 NZ_CP051294 Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence 352474-352499 6 0.769
NZ_LNVK01000029_1 1.11|9525|26|NZ_LNVK01000029|CRT 9525-9550 26 NZ_CP033363 Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence 352461-352486 6 0.769
NZ_LNVK01000029_1 1.12|9573|26|NZ_LNVK01000029|CRT 9573-9598 26 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 168561-168586 6 0.769
NZ_LNVK01000029_1 1.12|9573|26|NZ_LNVK01000029|CRT 9573-9598 26 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 168561-168586 6 0.769
NZ_LNVK01000029_1 1.14|9669|26|NZ_LNVK01000029|CRT 9669-9694 26 CP000618 Burkholderia vietnamiensis G4 plasmid pBVIE02, complete sequence 44311-44336 6 0.769
NZ_LNVK01000029_1 1.15|9717|26|NZ_LNVK01000029|CRT 9717-9742 26 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 91995-92020 6 0.769
NZ_LNVK01000029_1 1.16|9765|26|NZ_LNVK01000029|CRT 9765-9790 26 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 112115-112140 6 0.769
NZ_LNVK01000029_1 1.23|10101|26|NZ_LNVK01000029|CRT 10101-10126 26 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 481667-481692 6 0.769
NZ_LNVK01000029_1 1.23|10101|26|NZ_LNVK01000029|CRT 10101-10126 26 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 436572-436597 6 0.769
NZ_LNVK01000029_1 1.23|10101|26|NZ_LNVK01000029|CRT 10101-10126 26 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 481703-481728 6 0.769
NZ_LNVK01000029_1 1.23|10101|26|NZ_LNVK01000029|CRT 10101-10126 26 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 481702-481727 6 0.769
NZ_LNVK01000029_1 1.23|10101|26|NZ_LNVK01000029|CRT 10101-10126 26 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 481694-481719 6 0.769
NZ_LNVK01000029_1 1.25|10197|26|NZ_LNVK01000029|CRT 10197-10222 26 CP052389 Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1 116286-116311 6 0.769
NZ_LNVK01000029_1 1.28|10341|26|NZ_LNVK01000029|CRT 10341-10366 26 LT559120 Nonomuraea sp. ATCC 39727 isolate nono1 genome assembly, plasmid: III 23471-23496 6 0.769
NZ_LNVK01000029_1 1.34|10629|26|NZ_LNVK01000029|CRT 10629-10654 26 LT559120 Nonomuraea sp. ATCC 39727 isolate nono1 genome assembly, plasmid: III 23471-23496 6 0.769
NZ_LNVK01000029_1 1.36|10725|26|NZ_LNVK01000029|CRT 10725-10750 26 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 593315-593340 6 0.769
NZ_LNVK01000029_1 1.38|10821|26|NZ_LNVK01000029|CRT 10821-10846 26 NC_016591 Burkholderia sp. YI23 plasmid byi_2p, complete sequence 124119-124144 6 0.769
NZ_LNVK01000029_1 1.38|10821|26|NZ_LNVK01000029|CRT 10821-10846 26 CP000617 Burkholderia vietnamiensis G4 plasmid pBVIE01, complete sequence 313274-313299 6 0.769
NZ_LNVK01000029_1 1.38|10821|26|NZ_LNVK01000029|CRT 10821-10846 26 KY555147 Caulobacter phage Ccr34, complete genome 28484-28509 6 0.769
NZ_LNVK01000029_1 1.38|10821|26|NZ_LNVK01000029|CRT 10821-10846 26 KY555145 Caulobacter phage Ccr29, complete genome 31131-31156 6 0.769
NZ_LNVK01000029_1 1.38|10821|26|NZ_LNVK01000029|CRT 10821-10846 26 KY555143 Caulobacter phage Ccr2, complete genome 28964-28989 6 0.769
NZ_LNVK01000029_1 1.38|10821|26|NZ_LNVK01000029|CRT 10821-10846 26 KY555146 Caulobacter phage Ccr32, complete genome 28485-28510 6 0.769
NZ_LNVK01000029_1 1.38|10821|26|NZ_LNVK01000029|CRT 10821-10846 26 KY555144 Caulobacter phage Ccr5, complete genome 28359-28384 6 0.769
NZ_LNVK01000029_1 1.38|10821|26|NZ_LNVK01000029|CRT 10821-10846 26 JX163858 Caulobacter phage phiCbK, complete genome 179347-179372 6 0.769
NZ_LNVK01000029_1 1.38|10821|26|NZ_LNVK01000029|CRT 10821-10846 26 KY555142 Caulobacter phage Ccr10, complete genome 28489-28514 6 0.769
NZ_LNVK01000029_1 1.40|10917|26|NZ_LNVK01000029|CRT 10917-10942 26 CP052389 Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1 116286-116311 6 0.769
NZ_LNVK01000029_1 1.43|11061|26|NZ_LNVK01000029|CRT 11061-11086 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 67570-67595 6 0.769
NZ_LNVK01000029_1 1.43|11061|26|NZ_LNVK01000029|CRT 11061-11086 26 LT559120 Nonomuraea sp. ATCC 39727 isolate nono1 genome assembly, plasmid: III 23471-23496 6 0.769
NZ_LNVK01000029_1 1.43|11061|26|NZ_LNVK01000029|CRT 11061-11086 26 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 25845-25870 6 0.769
NZ_LNVK01000029_1 1.48|11301|26|NZ_LNVK01000029|CRT 11301-11326 26 NZ_CP020717 Cnuibacter physcomitrellae strain XA(T) plasmid unnamed2, complete sequence 21091-21116 6 0.769
NZ_LNVK01000029_1 1.49|11349|26|NZ_LNVK01000029|CRT 11349-11374 26 CP052389 Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1 116286-116311 6 0.769
NZ_LNVK01000029_1 1.52|11493|26|NZ_LNVK01000029|CRT 11493-11518 26 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 64151-64176 6 0.769
NZ_LNVK01000029_3 3.3|12519|25|NZ_LNVK01000029|CRISPRCasFinder 12519-12543 25 NC_019408 Caulobacter phage CcrRogue, complete genome 64287-64311 6 0.76
NZ_LNVK01000029_3 3.3|12519|25|NZ_LNVK01000029|CRISPRCasFinder 12519-12543 25 MT684599 Gordonia Phage Sephiroth, complete genome 28877-28901 6 0.76
NZ_LNVK01000029_3 3.7|12711|25|NZ_LNVK01000029|CRISPRCasFinder 12711-12735 25 NZ_CP022581 Gordonia rubripertincta strain CWB2 plasmid pGCWB2, complete sequence 8354-8378 6 0.76
NZ_LNVK01000029_1 1.4|9189|26|NZ_LNVK01000029|CRT 9189-9214 26 NZ_CP014599 Yangia sp. CCB-MM3 plasmid unnamed3, complete sequence 103494-103519 7 0.731
NZ_LNVK01000029_1 1.52|11493|26|NZ_LNVK01000029|CRT 11493-11518 26 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 135275-135300 7 0.731

1. spacer 1.7|9333|26|NZ_LNVK01000029|CRT matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 2, identity: 0.923 

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
cgcgggcaagggcagcgagatcaccg	Protospacer
**** ************* *******

2. spacer 1.7|9333|26|NZ_LNVK01000029|CRT matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 2, identity: 0.923 

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
cgcgggcaagggcagcgagatcaccg	Protospacer
**** ************* *******

3. spacer 1.7|9333|26|NZ_LNVK01000029|CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 3, identity: 0.885 

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
caagcgcgagggcagcgacatcaccg	Protospacer
*. ****.******************

4. spacer 1.7|9333|26|NZ_LNVK01000029|CRT matches to NZ_CP029986 (Sphingomonas sp. FARSPH plasmid p01, complete sequence) position: , mismatch: 3, identity: 0.885 

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
cgcgcgcaagggaagcggcatcacgg	Protospacer
************ ****.****** *

5. spacer 1.7|9333|26|NZ_LNVK01000029|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 3, identity: 0.885 

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
cacgcgccaaggcagcgacatcaccg	Protospacer
*.***** *.****************

6. spacer 1.7|9333|26|NZ_LNVK01000029|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 3, identity: 0.885 

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
cacgcgccaaggcagcgacatcaccg	Protospacer
*.***** *.****************

7. spacer 1.8|9381|26|NZ_LNVK01000029|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 3, identity: 0.885 

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
cgccgggtcggacagcgcctggatcg	Protospacer
 ***************** * *****

8. spacer 1.8|9381|26|NZ_LNVK01000029|CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 3, identity: 0.885 

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
cgccggatcggacagcgcgtggatcg	Protospacer
 *****.************* *****

9. spacer 1.8|9381|26|NZ_LNVK01000029|CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 3, identity: 0.885 

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
cgccgggtcggacagcgcctggatcg	Protospacer
 ***************** * *****

10. spacer 1.8|9381|26|NZ_LNVK01000029|CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 3, identity: 0.885 

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
cgccggatcggacagcgcgtggatcg	Protospacer
 *****.************* *****

11. spacer 1.16|9765|26|NZ_LNVK01000029|CRT matches to NZ_CP029986 (Sphingomonas sp. FARSPH plasmid p01, complete sequence) position: , mismatch: 3, identity: 0.885 

cgcgcgcaagggcagcgacatcactg	CRISPR spacer
cgcgcgcaagggaagcggcatcacgg	Protospacer
************ ****.****** *

12. spacer 1.16|9765|26|NZ_LNVK01000029|CRT matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 3, identity: 0.885 

cgcgcgcaagggcagcgacatcactg	CRISPR spacer
cgcgggcaagggcagcgagatcaccg	Protospacer
**** ************* *****.*

13. spacer 1.16|9765|26|NZ_LNVK01000029|CRT matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 3, identity: 0.885 

cgcgcgcaagggcagcgacatcactg	CRISPR spacer
cgcgggcaagggcagcgagatcaccg	Protospacer
**** ************* *****.*

14. spacer 1.17|9813|26|NZ_LNVK01000029|CRT matches to NZ_CP010682 (Phaeobacter piscinae strain P14 plasmid pP14_a, complete sequence) position: , mismatch: 3, identity: 0.885 

cgccggatccgacagttcgttgatcg	CRISPR spacer
cgccagatccgacaattcgttgatag	Protospacer
****.*********.********* *

15. spacer 1.17|9813|26|NZ_LNVK01000029|CRT matches to NZ_CP010644 (Phaeobacter piscinae strain P36 plasmid pP36_a, complete sequence) position: , mismatch: 3, identity: 0.885 

cgccggatccgacagttcgttgatcg	CRISPR spacer
cgccagatccgacaattcgttgatag	Protospacer
****.*********.********* *

16. spacer 1.25|10197|26|NZ_LNVK01000029|CRT matches to NC_009427 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence) position: , mismatch: 3, identity: 0.885 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
tgcacgcgaaggcagcgacgtggccg	Protospacer
.******************** .***

17. spacer 1.25|10197|26|NZ_LNVK01000029|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 3, identity: 0.885 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cgcgcgcgaaggcagcggcgtcacct	Protospacer
***.*************.*******

18. spacer 1.25|10197|26|NZ_LNVK01000029|CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 3, identity: 0.885 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
tgcacgcgaaggcgtcgacgtcaccg	Protospacer
.************. ***********

19. spacer 1.27|10293|26|NZ_LNVK01000029|CRT matches to MN694784 (Marine virus AFVG_250M786, complete genome) position: , mismatch: 3, identity: 0.885 

ctccggtagcgacagttcgctgacgg	CRISPR spacer
ctccgatagcgacagttcgctgccgc	Protospacer
*****.**************** **

20. spacer 1.28|10341|26|NZ_LNVK01000029|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 3, identity: 0.885 

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cgcgcgcgagggcagcggcgtcacct	Protospacer
*******.*********.*******

21. spacer 1.30|10437|26|NZ_LNVK01000029|CRT matches to MN694784 (Marine virus AFVG_250M786, complete genome) position: , mismatch: 3, identity: 0.885 

ctccggtagcgacagttcgctgacgg	CRISPR spacer
ctccgatagcgacagttcgctgccgc	Protospacer
*****.**************** **

22. spacer 1.31|10485|26|NZ_LNVK01000029|CRT matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 3, identity: 0.885 

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcaccg	Protospacer
.****** ****** ***********

23. spacer 1.31|10485|26|NZ_LNVK01000029|CRT matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.885 

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcaccg	Protospacer
.****** ****** ***********

24. spacer 1.31|10485|26|NZ_LNVK01000029|CRT matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 3, identity: 0.885 

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcaccg	Protospacer
.****** ****** ***********

25. spacer 1.31|10485|26|NZ_LNVK01000029|CRT matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 3, identity: 0.885 

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcaccg	Protospacer
.****** ****** ***********

26. spacer 1.34|10629|26|NZ_LNVK01000029|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 3, identity: 0.885 

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cgcgcgcgagggcagcggcgtcacct	Protospacer
*******.*********.*******

27. spacer 1.38|10821|26|NZ_LNVK01000029|CRT matches to NZ_CP048816 (Caulobacter rhizosphaerae strain KCTC 52515 plasmid unnamed) position: , mismatch: 3, identity: 0.885 

cgcg-ggcgcggacagcaccttgatcg	CRISPR spacer
-gcgcggcgaggacagcaccttgatct	Protospacer
 *** **** ****************

28. spacer 1.40|10917|26|NZ_LNVK01000029|CRT matches to NC_009427 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence) position: , mismatch: 3, identity: 0.885 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
tgcacgcgaaggcagcgacgtggccg	Protospacer
.******************** .***

29. spacer 1.40|10917|26|NZ_LNVK01000029|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 3, identity: 0.885 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cgcgcgcgaaggcagcggcgtcacct	Protospacer
***.*************.*******

30. spacer 1.40|10917|26|NZ_LNVK01000029|CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 3, identity: 0.885 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
tgcacgcgaaggcgtcgacgtcaccg	Protospacer
.************. ***********

31. spacer 1.46|11205|26|NZ_LNVK01000029|CRT matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.885 

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
ctcgcgccagggcaccgacatgaccg	Protospacer
* ***** ****** ***********

32. spacer 1.49|11349|26|NZ_LNVK01000029|CRT matches to NC_009427 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence) position: , mismatch: 3, identity: 0.885 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
tgcacgcgaaggcagcgacgtggccg	Protospacer
.******************** .***

33. spacer 1.49|11349|26|NZ_LNVK01000029|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 3, identity: 0.885 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cgcgcgcgaaggcagcggcgtcacct	Protospacer
***.*************.*******

34. spacer 1.49|11349|26|NZ_LNVK01000029|CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 3, identity: 0.885 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
tgcacgcgaaggcgtcgacgtcaccg	Protospacer
.************. ***********

35. spacer 1.53|11541|26|NZ_LNVK01000029|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.885 

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
cgcgggcgcggaccgcaccctgcgcg	Protospacer
************* ********  **

36. spacer 1.55|11637|26|NZ_LNVK01000029|CRT matches to NZ_CP015203 (Rhodococcus sp. 008 plasmid pR8L1, complete sequence) position: , mismatch: 3, identity: 0.885 

ggcacggcagggcagcgacatcaccg	CRISPR spacer
cgcacaacagggcagcgacatcaccg	Protospacer
 ****..*******************

37. spacer 1.55|11637|26|NZ_LNVK01000029|CRT matches to NZ_CP034156 (Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.885 

ggcacggcagggcagcgacatcaccg	CRISPR spacer
cgcgcagcagggcagcgacatcaccg	Protospacer
 **.*.********************

38. spacer 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder matches to MT889372 (Microbacterium phage Avocadoman, complete genome) position: , mismatch: 3, identity: 0.88 

gctgatcgcgggcgccgacagcacc	CRISPR spacer
tctgatcgagggcgccgacggcacc	Protospacer
 ******* **********.*****

39. spacer 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder matches to MT639649 (Microbacterium phage Burritobowl, complete genome) position: , mismatch: 3, identity: 0.88 

gctgatcgcgggcgccgacagcacc	CRISPR spacer
tctgatcgagggcgccgacggcacc	Protospacer
 ******* **********.*****

40. spacer 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder matches to MN062714 (Microbacterium Phage DirtyBubble, complete genome) position: , mismatch: 3, identity: 0.88 

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cctgatcgagggcgccgacggcacc	Protospacer
 ******* **********.*****

41. spacer 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder matches to MT889389 (Microbacterium phage DickRichards, complete genome) position: , mismatch: 3, identity: 0.88 

gctgatcgcgggcgccgacagcacc	CRISPR spacer
tctgatcgagggcgccgacggcacc	Protospacer
 ******* **********.*****

42. spacer 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder matches to MT024860 (Microbacterium phage Stromboli, complete genome) position: , mismatch: 3, identity: 0.88 

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cctgatcgagggcgccgacggcacc	Protospacer
 ******* **********.*****

43. spacer 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.88 

gctgatcgcgggcgccgacagcacc	CRISPR spacer
gatgatcacgggcgccgacagcaac	Protospacer
* *****.*************** *

44. spacer 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 3, identity: 0.88 

gctgatcgcgggcgccgacagcacc	CRISPR spacer
gatgatcacgggcgccgacagcaac	Protospacer
* *****.*************** *

45. spacer 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 3, identity: 0.88 

gctgatcgcgggcgccgacagcacc	CRISPR spacer
gttgctcgcgggcgccgaaagcacc	Protospacer
*.** ************* ******

46. spacer 3.8|12759|25|NZ_LNVK01000029|CRISPRCasFinder matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.88 

gctgaccgccggcaagaacagcgtg	CRISPR spacer
cctgaacgccggcaagtacagcgtg	Protospacer
 **** ********** ********

47. spacer 3.8|12759|25|NZ_LNVK01000029|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 3, identity: 0.88 

gctgaccgccggcaagaacagcgtg	CRISPR spacer
ggtgaccgccgccaagaacggcgtg	Protospacer
* ********* *******.*****

48. spacer 3.8|12759|25|NZ_LNVK01000029|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

gctgaccgccggcaagaacagcgtg	CRISPR spacer
ggtgaccgccgccaagaacggcgtg	Protospacer
* ********* *******.*****

49. spacer 1.3|9141|26|NZ_LNVK01000029|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.846 

tgccgcgggcaggagcacgctcaccg	CRISPR spacer
tgccgcggtcgggagcacgctcacgc	Protospacer
******** *.*************

50. spacer 1.7|9333|26|NZ_LNVK01000029|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
cacgcgccagggcagcgacatcagca	Protospacer
*.***** *************** *.

51. spacer 1.7|9333|26|NZ_LNVK01000029|CRT matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
cctgcgcaagggcagctacaacaccg	Protospacer
* .************* *** *****

52. spacer 1.7|9333|26|NZ_LNVK01000029|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
catgcgcaagggcagcgacaacgccg	Protospacer
*..***************** *.***

53. spacer 1.7|9333|26|NZ_LNVK01000029|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
cacgcgccaaggcagcgacatcacca	Protospacer
*.***** *.***************.

54. spacer 1.8|9381|26|NZ_LNVK01000029|CRT matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.846 

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
ggccgggtcggacagcgggtcgagca	Protospacer
***************** **.** *.

55. spacer 1.10|9477|26|NZ_LNVK01000029|CRT matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcacgcaagggcagcgacgtcaccg	CRISPR spacer
ctcccgccagggcagcgacgtcacca	Protospacer
* * *** *****************.

56. spacer 1.13|9621|26|NZ_LNVK01000029|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 4, identity: 0.846 

ggcgcggcaaggcagcgatatcaccg	CRISPR spacer
cacgcgccaaggcagcgacatcaccg	Protospacer
 .**** ***********.*******

57. spacer 1.13|9621|26|NZ_LNVK01000029|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 4, identity: 0.846 

ggcgcggcaaggcagcgatatcaccg	CRISPR spacer
cacgcgccaaggcagcgacatcaccg	Protospacer
 .**** ***********.*******

58. spacer 1.14|9669|26|NZ_LNVK01000029|CRT matches to NZ_CP013482 (Pandoraea apista strain DSM 16535 plasmid pPA35, complete sequence) position: , mismatch: 4, identity: 0.846 

tgccggtgcggacagcacgctgatcg	CRISPR spacer
tgccggcgcggccagcacgctgaggg	Protospacer
******.**** ***********  *

59. spacer 1.15|9717|26|NZ_LNVK01000029|CRT matches to NZ_CP031960 (Phaeobacter sp. LSS9 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.846 

ctcgggcagcgacagctcgctgacag	CRISPR spacer
cccgggcaccgacagctggctgacaa	Protospacer
*.****** ******** *******.

60. spacer 1.15|9717|26|NZ_LNVK01000029|CRT matches to NZ_CP010602 (Phaeobacter inhibens strain P83 plasmid pP83_c, complete sequence) position: , mismatch: 4, identity: 0.846 

ctcgggcagcgacagctcgctgacag	CRISPR spacer
cccgggcaccgacagctggctgacaa	Protospacer
*.****** ******** *******.

61. spacer 1.15|9717|26|NZ_LNVK01000029|CRT matches to NZ_CP010769 (Phaeobacter piscinae strain P13 plasmid pP13_b, complete sequence) position: , mismatch: 4, identity: 0.846 

ctcgggcagcgacagctcgctgacag	CRISPR spacer
cccgggcaccgacagctggctgacaa	Protospacer
*.****** ******** *******.

62. spacer 1.15|9717|26|NZ_LNVK01000029|CRT matches to NZ_CP010708 (Phaeobacter inhibens strain P66 plasmid pP66_c, complete sequence) position: , mismatch: 4, identity: 0.846 

ctcgggcagcgacagctcgctgacag	CRISPR spacer
cccgggcaccgacagctggctgacaa	Protospacer
*.****** ******** *******.

63. spacer 1.15|9717|26|NZ_LNVK01000029|CRT matches to NZ_CP010737 (Phaeobacter inhibens strain P72 plasmid pP72_b, complete sequence) position: , mismatch: 4, identity: 0.846 

ctcgggcagcgacagctcgctgacag	CRISPR spacer
cccgggcaccgacagctggctgacaa	Protospacer
*.****** ******** *******.

64. spacer 1.16|9765|26|NZ_LNVK01000029|CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgcgcaagggcagcgacatcactg	CRISPR spacer
caagcgcgagggcagcgacatcaccg	Protospacer
*. ****.****************.*

65. spacer 1.18|9861|26|NZ_LNVK01000029|CRT matches to NZ_CP036488 (Rahnella aquatilis strain MEM40 plasmid pMEM40-1, complete sequence) position: , mismatch: 4, identity: 0.846 

cgctggcagcgaaagttcgctgacgg	CRISPR spacer
cgctgacagcgaaagtgcgctgatgc	Protospacer
*****.********** ******.*

66. spacer 1.18|9861|26|NZ_LNVK01000029|CRT matches to NC_017060 (Rahnella aquatilis HX2 plasmid PRA1, complete sequence) position: , mismatch: 4, identity: 0.846 

cgctggcagcgaaagttcgctgacgg	CRISPR spacer
cgctgacagcgaaagtgcgctgatgc	Protospacer
*****.********** ******.*

67. spacer 1.18|9861|26|NZ_LNVK01000029|CRT matches to NC_015062 (Rahnella sp. Y9602 plasmid pRAHAQ01, complete sequence) position: , mismatch: 4, identity: 0.846 

cgctggcagcgaaagttcgctgacgg	CRISPR spacer
cgctgacagcgaaagtgcgctgatgc	Protospacer
*****.********** ******.*

68. spacer 1.20|9957|26|NZ_LNVK01000029|CRT matches to MN035618 (Leviviridae sp. isolate H1_Rhizo_Litter_1_scaffold_1030_e_381 hypothetical protein (H1RhizoL11030e381_000001) and RNA-dependent RNA polymerase (H1RhizoL11030e381_000002) genes, complete cds) position: , mismatch: 4, identity: 0.846 

ggcgggtcacgacagttcgctgatcg	CRISPR spacer
ggtttgtcacgacagctcgctgatcg	Protospacer
**.  **********.**********

69. spacer 1.23|10101|26|NZ_LNVK01000029|CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 4, identity: 0.846 

cgccggtgccgacagtacgctgatcg	CRISPR spacer
cctcggtgccgatggtacgctgatcg	Protospacer
* .*********..************

70. spacer 1.25|10197|26|NZ_LNVK01000029|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgacgtcaccg	Protospacer
* . .*********************

71. spacer 1.25|10197|26|NZ_LNVK01000029|CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgacgtcaccg	Protospacer
* . .*********************

72. spacer 1.25|10197|26|NZ_LNVK01000029|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgacgtcaccg	Protospacer
* . .*********************

73. spacer 1.25|10197|26|NZ_LNVK01000029|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cgtccgcgaaggcagcgacgccacca	Protospacer
**. ****************.****.

74. spacer 1.25|10197|26|NZ_LNVK01000029|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cacgcgcgaaggcaacgacgtcacca	Protospacer
*.*.**********.**********.

75. spacer 1.25|10197|26|NZ_LNVK01000029|CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cggccaggaaggcagcgacgtcaccg	Protospacer
**  *. *******************

76. spacer 1.25|10197|26|NZ_LNVK01000029|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcacgc-gaaggcagcgacgtcaccg	CRISPR spacer
-gttcgtggaaggcagcgacgtcaccg	Protospacer
 *. **. *******************

77. spacer 1.27|10293|26|NZ_LNVK01000029|CRT matches to NZ_CP033429 (Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.846 

ctccggtagcgacagttcgctgacgg	CRISPR spacer
cggcggtcgcgacagttcgcggacgg	Protospacer
*  **** ************ *****

78. spacer 1.28|10341|26|NZ_LNVK01000029|CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
caagcgcgagggcagcgacatcaccg	Protospacer
*. ****.***********.******

79. spacer 1.28|10341|26|NZ_LNVK01000029|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cgcgcgcgagggcagcgacgttgcgg	Protospacer
*******.*************..* *

80. spacer 1.28|10341|26|NZ_LNVK01000029|CRT matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
ctcccgccagggcagcgacgtcacca	Protospacer
* * *** *****************.

81. spacer 1.28|10341|26|NZ_LNVK01000029|CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cctgcgcaagggcagctacgacaccg	Protospacer
* .************* *** *****

82. spacer 1.29|10389|26|NZ_LNVK01000029|CRT matches to MT114166 (Microbacterium phage Nike, complete genome) position: , mismatch: 4, identity: 0.846 

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.

83. spacer 1.29|10389|26|NZ_LNVK01000029|CRT matches to NC_047973 (Microbacterium phage Hyperion, complete genome) position: , mismatch: 4, identity: 0.846 

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.

84. spacer 1.29|10389|26|NZ_LNVK01000029|CRT matches to MT657333 (Microbacterium phage Casend, complete genome) position: , mismatch: 4, identity: 0.846 

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.

85. spacer 1.29|10389|26|NZ_LNVK01000029|CRT matches to NC_047975 (Microbacterium phage Squash, complete genome) position: , mismatch: 4, identity: 0.846 

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.

86. spacer 1.30|10437|26|NZ_LNVK01000029|CRT matches to NZ_CP033429 (Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.846 

ctccggtagcgacagttcgctgacgg	CRISPR spacer
cggcggtcgcgacagttcgcggacgg	Protospacer
*  **** ************ *****

87. spacer 1.31|10485|26|NZ_LNVK01000029|CRT matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcacca	Protospacer
.****** ****** **********.

88. spacer 1.31|10485|26|NZ_LNVK01000029|CRT matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcacca	Protospacer
.****** ****** **********.

89. spacer 1.31|10485|26|NZ_LNVK01000029|CRT matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcacca	Protospacer
.****** ****** **********.

90. spacer 1.31|10485|26|NZ_LNVK01000029|CRT matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcacca	Protospacer
.****** ****** **********.

91. spacer 1.31|10485|26|NZ_LNVK01000029|CRT matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcacca	Protospacer
.****** ****** **********.

92. spacer 1.31|10485|26|NZ_LNVK01000029|CRT matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcacca	Protospacer
.****** ****** **********.

93. spacer 1.31|10485|26|NZ_LNVK01000029|CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
ccagcgcaccggcagcgatgtcaccg	Protospacer
*  *****  ****************

94. spacer 1.31|10485|26|NZ_LNVK01000029|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
caggcgcaagggcatcgatgtctccg	Protospacer
*. *********** ******* ***

95. spacer 1.31|10485|26|NZ_LNVK01000029|CRT matches to NZ_CP018080 (Sulfitobacter sp. AM1-D1 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
cgcgcgcaagggcagcgatctggacg	Protospacer
******************* * . **

96. spacer 1.32|10533|26|NZ_LNVK01000029|CRT matches to MT114166 (Microbacterium phage Nike, complete genome) position: , mismatch: 4, identity: 0.846 

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.

97. spacer 1.32|10533|26|NZ_LNVK01000029|CRT matches to NC_047973 (Microbacterium phage Hyperion, complete genome) position: , mismatch: 4, identity: 0.846 

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.

98. spacer 1.32|10533|26|NZ_LNVK01000029|CRT matches to MT657333 (Microbacterium phage Casend, complete genome) position: , mismatch: 4, identity: 0.846 

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.

99. spacer 1.32|10533|26|NZ_LNVK01000029|CRT matches to NC_047975 (Microbacterium phage Squash, complete genome) position: , mismatch: 4, identity: 0.846 

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.

100. spacer 1.34|10629|26|NZ_LNVK01000029|CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
caagcgcgagggcagcgacatcaccg	Protospacer
*. ****.***********.******

101. spacer 1.34|10629|26|NZ_LNVK01000029|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cgcgcgcgagggcagcgacgttgcgg	Protospacer
*******.*************..* *

102. spacer 1.34|10629|26|NZ_LNVK01000029|CRT matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
ctcccgccagggcagcgacgtcacca	Protospacer
* * *** *****************.

103. spacer 1.34|10629|26|NZ_LNVK01000029|CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cctgcgcaagggcagctacgacaccg	Protospacer
* .************* *** *****

104. spacer 1.35|10677|26|NZ_LNVK01000029|CRT matches to MT114166 (Microbacterium phage Nike, complete genome) position: , mismatch: 4, identity: 0.846 

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.

105. spacer 1.35|10677|26|NZ_LNVK01000029|CRT matches to NC_047973 (Microbacterium phage Hyperion, complete genome) position: , mismatch: 4, identity: 0.846 

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.

106. spacer 1.35|10677|26|NZ_LNVK01000029|CRT matches to MT657333 (Microbacterium phage Casend, complete genome) position: , mismatch: 4, identity: 0.846 

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.

107. spacer 1.35|10677|26|NZ_LNVK01000029|CRT matches to NC_047975 (Microbacterium phage Squash, complete genome) position: , mismatch: 4, identity: 0.846 

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.

108. spacer 1.36|10725|26|NZ_LNVK01000029|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.846 

ctcgggcagcgacagttcgctgacgg	CRISPR spacer
gccggacagcgacagttcgcggacgg	Protospacer
 .***.************** *****

109. spacer 1.37|10773|26|NZ_LNVK01000029|CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgcgcaagggcagcgacattaccg	CRISPR spacer
caagcgcgagggcagcgacatcaccg	Protospacer
*. ****.*************.****

110. spacer 1.37|10773|26|NZ_LNVK01000029|CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgcgcaagggcagcgacattaccg	CRISPR spacer
catgcgcaagggcagcgacaatgccg	Protospacer
*..***************** *.***

111. spacer 1.38|10821|26|NZ_LNVK01000029|CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
ctgggccgcgtacagcaccttgatcg	Protospacer
*  ** **** ***************

112. spacer 1.38|10821|26|NZ_LNVK01000029|CRT matches to NZ_CP044348 (Escherichia coli strain P225M plasmid pP225M-2, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
cgtgctggcggacagcaccttgatcg	Protospacer
**.*   *******************

113. spacer 1.38|10821|26|NZ_LNVK01000029|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
ggggcgcgcgaacagcaccttgatcg	Protospacer
 * * *****.***************

114. spacer 1.39|10869|26|NZ_LNVK01000029|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846 

ctccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
* ************* *** *****

115. spacer 1.39|10869|26|NZ_LNVK01000029|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846 

ctccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
* ************* *** *****

116. spacer 1.39|10869|26|NZ_LNVK01000029|CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 4, identity: 0.846 

ctccggcagcgacagttcgctgaccg	CRISPR spacer
atgcggcggcgacagttcggtgaccg	Protospacer
 * ****.*********** ******

117. spacer 1.40|10917|26|NZ_LNVK01000029|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgacgtcaccg	Protospacer
* . .*********************

118. spacer 1.40|10917|26|NZ_LNVK01000029|CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgacgtcaccg	Protospacer
* . .*********************

119. spacer 1.40|10917|26|NZ_LNVK01000029|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgacgtcaccg	Protospacer
* . .*********************

120. spacer 1.40|10917|26|NZ_LNVK01000029|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cgtccgcgaaggcagcgacgccacca	Protospacer
**. ****************.****.

121. spacer 1.40|10917|26|NZ_LNVK01000029|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cacgcgcgaaggcaacgacgtcacca	Protospacer
*.*.**********.**********.

122. spacer 1.40|10917|26|NZ_LNVK01000029|CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cggccaggaaggcagcgacgtcaccg	Protospacer
**  *. *******************

123. spacer 1.40|10917|26|NZ_LNVK01000029|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcacgc-gaaggcagcgacgtcaccg	CRISPR spacer
-gttcgtggaaggcagcgacgtcaccg	Protospacer
 *. **. *******************

124. spacer 1.41|10965|26|NZ_LNVK01000029|CRT matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 4, identity: 0.846 

ggcgggcgcggacagcaccctgatct	CRISPR spacer
gtcggcggcggacagcaccctgatcc	Protospacer
* ***  ******************.

125. spacer 1.41|10965|26|NZ_LNVK01000029|CRT matches to NZ_CP012918 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence) position: , mismatch: 4, identity: 0.846 

ggcgggcgcggacagcaccctgatct	CRISPR spacer
gtcggcggcggacagcaccctgatcc	Protospacer
* ***  ******************.

126. spacer 1.42|11013|26|NZ_LNVK01000029|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846 

ggccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
 ************** *** *****

127. spacer 1.42|11013|26|NZ_LNVK01000029|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846 

ggccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
 ************** *** *****

128. spacer 1.42|11013|26|NZ_LNVK01000029|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.846 

ggccggcagcgacagttcgctgaccg	CRISPR spacer
ggccagcagcgacatttcgctgaagg	Protospacer
****.********* ********  *

129. spacer 1.43|11061|26|NZ_LNVK01000029|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 4, identity: 0.846 

tgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cgcgcgcgagggcagcggcgtcacct	Protospacer
.******.*********.*******

130. spacer 1.44|11109|26|NZ_LNVK01000029|CRT matches to NZ_CP044348 (Escherichia coli strain P225M plasmid pP225M-2, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgggtgcggacagcaccttgatcg	CRISPR spacer
cgtgctggcggacagcaccttgatcg	Protospacer
**.*   *******************

131. spacer 1.45|11157|26|NZ_LNVK01000029|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846 

ctccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
* ************* *** *****

132. spacer 1.45|11157|26|NZ_LNVK01000029|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846 

ctccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
* ************* *** *****

133. spacer 1.45|11157|26|NZ_LNVK01000029|CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 4, identity: 0.846 

ctccggcagcgacagttcgctgaccg	CRISPR spacer
atgcggcggcgacagttcggtgaccg	Protospacer
 * ****.*********** ******

134. spacer 1.46|11205|26|NZ_LNVK01000029|CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 4, identity: 0.846 

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
gtcgcgcaagggcagcgacacggccg	Protospacer
  ******************.*.***

135. spacer 1.46|11205|26|NZ_LNVK01000029|CRT matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
cgcgcgcaagggcatcgacatgttca	Protospacer
************** ******* .*.

136. spacer 1.46|11205|26|NZ_LNVK01000029|CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
caagcgcgagggcagcgacatcaccg	Protospacer
*. ****.************* ****

137. spacer 1.46|11205|26|NZ_LNVK01000029|CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
cgcgcgcaagggcagcgccacgatcc	Protospacer
***************** **.**.*

138. spacer 1.46|11205|26|NZ_LNVK01000029|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
cgcgcgcaagggcagcgccacgatcc	Protospacer
***************** **.**.*

139. spacer 1.47|11253|26|NZ_LNVK01000029|CRT matches to NZ_CP045406 (Roseovarius sp. THAF9 plasmid pTHAF9_b, complete sequence) position: , mismatch: 4, identity: 0.846 

cgctggcgcggatagcaccttgatcg	CRISPR spacer
cgctggcgcggttatcaccttgatgc	Protospacer
*********** ** *********

140. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 4, identity: 0.846 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
ttccggccgcgacagctcgccgacga	Protospacer
 ****** ************.****.

141. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.846 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
ttccggccgcgacagctcgccgacga	Protospacer
 ****** ************.****.

142. spacer 1.49|11349|26|NZ_LNVK01000029|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgacgtcaccg	Protospacer
* . .*********************

143. spacer 1.49|11349|26|NZ_LNVK01000029|CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgacgtcaccg	Protospacer
* . .*********************

144. spacer 1.49|11349|26|NZ_LNVK01000029|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgacgtcaccg	Protospacer
* . .*********************

145. spacer 1.49|11349|26|NZ_LNVK01000029|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cgtccgcgaaggcagcgacgccacca	Protospacer
**. ****************.****.

146. spacer 1.49|11349|26|NZ_LNVK01000029|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cacgcgcgaaggcaacgacgtcacca	Protospacer
*.*.**********.**********.

147. spacer 1.49|11349|26|NZ_LNVK01000029|CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cggccaggaaggcagcgacgtcaccg	Protospacer
**  *. *******************

148. spacer 1.49|11349|26|NZ_LNVK01000029|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcacgc-gaaggcagcgacgtcaccg	CRISPR spacer
-gttcgtggaaggcagcgacgtcaccg	Protospacer
 *. **. *******************

149. spacer 1.50|11397|26|NZ_LNVK01000029|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.846 

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
cgcgggcgcggaccgcaccctgcgcg	Protospacer
 ************ ********  **

150. spacer 1.50|11397|26|NZ_LNVK01000029|CRT matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 4, identity: 0.846 

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
gtcggcggcggacagcaccctgatcc	Protospacer
* ***  ******************

151. spacer 1.50|11397|26|NZ_LNVK01000029|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846 

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
*..********.***** ********

152. spacer 1.50|11397|26|NZ_LNVK01000029|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846 

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
*..********.***** ********

153. spacer 1.50|11397|26|NZ_LNVK01000029|CRT matches to NZ_CP015232 (Epibacterium mobile F1926 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.846 

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
tgagggcgccgacatcaccctgatcg	Protospacer
 * ****** **** ***********

154. spacer 1.50|11397|26|NZ_LNVK01000029|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 4, identity: 0.846 

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
*..********.***** ********

155. spacer 1.50|11397|26|NZ_LNVK01000029|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846 

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
*..********.***** ********

156. spacer 1.50|11397|26|NZ_LNVK01000029|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 4, identity: 0.846 

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
*..********.***** ********

157. spacer 1.50|11397|26|NZ_LNVK01000029|CRT matches to NZ_CP012918 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence) position: , mismatch: 4, identity: 0.846 

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
gtcggcggcggacagcaccctgatcc	Protospacer
* ***  ******************

158. spacer 1.50|11397|26|NZ_LNVK01000029|CRT matches to NZ_LR027555 (Epibacterium mobile isolate EPIB1 plasmid 3, complete sequence) position: , mismatch: 4, identity: 0.846 

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
cgagggcgccgacatcaccctgatcg	Protospacer
 * ****** **** ***********

159. spacer 1.51|11445|26|NZ_LNVK01000029|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846 

ggccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
 ************** *** *****

160. spacer 1.51|11445|26|NZ_LNVK01000029|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846 

ggccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
 ************** *** *****

161. spacer 1.51|11445|26|NZ_LNVK01000029|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.846 

ggccggcagcgacagttcgctgaccg	CRISPR spacer
ggccagcagcgacatttcgctgaagg	Protospacer
****.********* ********  *

162. spacer 1.53|11541|26|NZ_LNVK01000029|CRT matches to NZ_CP015232 (Epibacterium mobile F1926 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.846 

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
tgagggcgccgacatcaccctgatcg	Protospacer
.* ****** **** ***********

163. spacer 1.54|11589|26|NZ_LNVK01000029|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846 

ggccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
 ************** *** *****

164. spacer 1.54|11589|26|NZ_LNVK01000029|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846 

ggccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
 ************** *** *****

165. spacer 1.54|11589|26|NZ_LNVK01000029|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.846 

ggccggcagcgacagttcgctgaccg	CRISPR spacer
ggccagcagcgacatttcgctgaagg	Protospacer
****.********* ********  *

166. spacer 1.55|11637|26|NZ_LNVK01000029|CRT matches to NZ_CP014942 (Rhodococcus sp. BH4 plasmid, complete sequence) position: , mismatch: 4, identity: 0.846 

ggcacggcagggcagcgacatcaccg	CRISPR spacer
cgcgcaacagggcagcgacatcaccg	Protospacer
 **.*..*******************

167. spacer 1.55|11637|26|NZ_LNVK01000029|CRT matches to NZ_CP007256 (Rhodococcus erythropolis R138 plasmid pCRE138, complete sequence) position: , mismatch: 4, identity: 0.846 

ggcacggcagggcagcgacatcaccg	CRISPR spacer
cgcgcaacagggcagcgacatcaccg	Protospacer
 **.*..*******************

168. spacer 1.55|11637|26|NZ_LNVK01000029|CRT matches to NZ_CP017242 (Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence) position: , mismatch: 4, identity: 0.846 

ggcacggcagggcagcgacatcaccg	CRISPR spacer
gcaacggctgggcagcgacaacaccg	Protospacer
*  ***** *********** *****

169. spacer 1.57|11733|26|NZ_LNVK01000029|CRT matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 4, identity: 0.846 

cgccggctacgacagcaacctcactg	CRISPR spacer
cgccgcctacgacagcaacctcatca	Protospacer
***** *****************...

170. spacer 1.57|11733|26|NZ_LNVK01000029|CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 4, identity: 0.846 

cgccggctacgacagcaacctcactg	CRISPR spacer
cgccgactacgacagcgacctcacca	Protospacer
*****.**********.*******..

171. spacer 1.58|11781|26|NZ_LNVK01000029|CRT matches to NZ_CP023738 (Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence) position: , mismatch: 4, identity: 0.846 

ggcgcgcgaggacagctcgctcactg	CRISPR spacer
cgtgcgcgaggacagcgcgctcaccg	Protospacer
 *.************* *******.*

172. spacer 3.3|12519|25|NZ_LNVK01000029|CRISPRCasFinder matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 4, identity: 0.84 

gctgatcgcgggcaagggcagtttc	CRISPR spacer
gctgatggcgggcaagggcagtcag	Protospacer
****** ***************.

173. spacer 3.4|12567|25|NZ_LNVK01000029|CRISPRCasFinder matches to MK757446 (Mycobacterium phage Candle, complete genome) position: , mismatch: 4, identity: 0.84 

gctcattggcggtgccgccagcgtg	CRISPR spacer
gcacattggcggtgcccccagcggc	Protospacer
** ************* ******

174. spacer 3.4|12567|25|NZ_LNVK01000029|CRISPRCasFinder matches to KY969628 (Mycobacterium phage Zenon, complete genome) position: , mismatch: 4, identity: 0.84 

gctcattggcggtgccgccagcgtg	CRISPR spacer
gcacattggcggtgcccccagcggc	Protospacer
** ************* ******

175. spacer 3.4|12567|25|NZ_LNVK01000029|CRISPRCasFinder matches to MH926059 (Mycobacterium phage Riparian, complete genome) position: , mismatch: 4, identity: 0.84 

gctcattggcggtgccgccagcgtg	CRISPR spacer
gcacattggcggtgcccccagcggc	Protospacer
** ************* ******

176. spacer 3.4|12567|25|NZ_LNVK01000029|CRISPRCasFinder matches to JF704112 (Mycobacterium phage Send513, complete sequence) position: , mismatch: 4, identity: 0.84 

gctcattggcggtgccgccagcgtg	CRISPR spacer
gcacattggcggtgcccccagcggc	Protospacer
** ************* ******

177. spacer 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.84 

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cgtgatcgcggtcgccgacagcagc	Protospacer
  ********* *********** *

178. spacer 3.6|12663|25|NZ_LNVK01000029|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 4, identity: 0.84 

actgttggccggacgcaacagctat	CRISPR spacer
ggtgttgcgcggacgcaacagctat	Protospacer
. *****  ****************

179. spacer 3.6|12663|25|NZ_LNVK01000029|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 4, identity: 0.84 

actgttggccggacgcaacagctat	CRISPR spacer
ggtgttgcgcggacgcaacagctat	Protospacer
. *****  ****************

180. spacer 3.7|12711|25|NZ_LNVK01000029|CRISPRCasFinder matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 4, identity: 0.84 

gctgaccgccggcgacgacagtacg	CRISPR spacer
gctgcccgccggcgacgaccgtaaa	Protospacer
**** ************** *** .

181. spacer 3.8|12759|25|NZ_LNVK01000029|CRISPRCasFinder matches to NZ_CP045549 (Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84 

gctgaccgccggcaagaacagcgtg	CRISPR spacer
gctgaccgcgggcaagaacatcgaa	Protospacer
********* ********** ** .

182. spacer 1.1|9045|26|NZ_LNVK01000029|CRT matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcaggcgatcacagcgatctgatcg	CRISPR spacer
cgcaggcgatcacaacgatctggcga	Protospacer
**************.*******.. .

183. spacer 1.3|9141|26|NZ_LNVK01000029|CRT matches to NZ_CP047178 (Rathayibacter sp. VKM Ac-2759 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.808 

tgccgcgggcaggagcacgctcaccg	CRISPR spacer
ttccgcggacaggagcacgctcatgt	Protospacer
* ******.**************.

184. spacer 1.4|9189|26|NZ_LNVK01000029|CRT matches to NZ_CP027551 (Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcgcaggaaggcagccgtctcacct	CRISPR spacer
agcgcaggaaggccgccgtctcttca	Protospacer
.************ ******** .*

185. spacer 1.4|9189|26|NZ_LNVK01000029|CRT matches to NZ_CP027551 (Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcgcaggaaggcagccgtctcacct	CRISPR spacer
agcgcaggaaggccgccgtctcttca	Protospacer
.************ ******** .*

186. spacer 1.4|9189|26|NZ_LNVK01000029|CRT matches to NZ_CP027551 (Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcgcaggaaggcagccgtctcacct	CRISPR spacer
agcgcaggaaggccgccgtctcttca	Protospacer
.************ ******** .*

187. spacer 1.4|9189|26|NZ_LNVK01000029|CRT matches to NZ_CP027551 (Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcgcaggaaggcagccgtctcacct	CRISPR spacer
agcgcaggaaggccgccgtctcttca	Protospacer
.************ ******** .*

188. spacer 1.4|9189|26|NZ_LNVK01000029|CRT matches to NZ_CP027551 (Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcgcaggaaggcagccgtctcacct	CRISPR spacer
agcgcaggaaggccgccgtctcttca	Protospacer
.************ ******** .*

189. spacer 1.5|9237|26|NZ_LNVK01000029|CRT matches to NC_015057 (Granulicella tundricola MP5ACTX9 plasmid pACIX901, complete sequence) position: , mismatch: 5, identity: 0.808 

cagcggttctgacagcgcggtgatct	CRISPR spacer
cagcggttctgacagctccgtgactc	Protospacer
**************** * ****...

190. spacer 1.7|9333|26|NZ_LNVK01000029|CRT matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
cgcgcgcaagggcatcgacatgttca	Protospacer
************** ******  .*.

191. spacer 1.7|9333|26|NZ_LNVK01000029|CRT matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
ttggcgcaaggacagcggcatcaccg	Protospacer
.  ********.*****.********

192. spacer 1.8|9381|26|NZ_LNVK01000029|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 5, identity: 0.808 

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
ggccgggtcggccagcgcggtgagga	Protospacer
*********** ******* ***  .

193. spacer 1.8|9381|26|NZ_LNVK01000029|CRT matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 5, identity: 0.808 

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
cgccgggtcggacagcgcgtgcagcc	Protospacer
 *******************  * *

194. spacer 1.8|9381|26|NZ_LNVK01000029|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 5, identity: 0.808 

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
ggccgggtcggccagcgcggtgagga	Protospacer
*********** ******* ***  .

195. spacer 1.8|9381|26|NZ_LNVK01000029|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 5, identity: 0.808 

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
ggccgggtcggccagcgcggtgagga	Protospacer
*********** ******* ***  .

196. spacer 1.8|9381|26|NZ_LNVK01000029|CRT matches to MF375456 (Xanthomonas phage phi Xc10, complete genome) position: , mismatch: 5, identity: 0.808 

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
caccggatcggacagcacgttgatct	Protospacer
 .****.*********.********

197. spacer 1.8|9381|26|NZ_LNVK01000029|CRT matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 5, identity: 0.808 

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
caccggatcggacagcacgttgatct	Protospacer
 .****.*********.********

198. spacer 1.8|9381|26|NZ_LNVK01000029|CRT matches to MK903278 (Xanthomonas phage Pagan, complete genome) position: , mismatch: 5, identity: 0.808 

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
caccggatcggacagcacgttgatct	Protospacer
 .****.*********.********

199. spacer 1.8|9381|26|NZ_LNVK01000029|CRT matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 5, identity: 0.808 

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
caccggatcggacagcacgttgatct	Protospacer
 .****.*********.********

200. spacer 1.10|9477|26|NZ_LNVK01000029|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcaagggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .**.******************

201. spacer 1.10|9477|26|NZ_LNVK01000029|CRT matches to NZ_CP049116 (Pantoea stewartii strain ZJ-FGZX1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcaagggcagcgacgtcaccg	CRISPR spacer
tcgacgcaacggcagcgacgttaccg	Protospacer
.  ****** ***********.****

202. spacer 1.10|9477|26|NZ_LNVK01000029|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcaagggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .**.******************

203. spacer 1.12|9573|26|NZ_LNVK01000029|CRT matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 5, identity: 0.808 

cgctggcggcgaaagctctctcaccg	CRISPR spacer
cgctggcggcggaagctttctcaata	Protospacer
***********.*****.***** ..

204. spacer 1.12|9573|26|NZ_LNVK01000029|CRT matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgctggcggcgaaagctctctcaccg	CRISPR spacer
cgctggcggcggaagctttctcaata	Protospacer
***********.*****.***** ..

205. spacer 1.13|9621|26|NZ_LNVK01000029|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcgcggcaaggcagcgatatcaccg	CRISPR spacer
cacgcgccaaggcagcgacatcacca	Protospacer
 .**** ***********.******.

206. spacer 1.15|9717|26|NZ_LNVK01000029|CRT matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 5, identity: 0.808 

ctcgggcagcgacagctcgctgacag	CRISPR spacer
ctcggacagcgacagctcgctttgcg	Protospacer
*****.***************    *

207. spacer 1.15|9717|26|NZ_LNVK01000029|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808 

ctcgggcagcgacagctcgctgacag	CRISPR spacer
tacggtcagcgacacctcgctgacat	Protospacer
. *** ******** **********

208. spacer 1.16|9765|26|NZ_LNVK01000029|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgcgcaagggcagcgacatcactg	CRISPR spacer
cacgcgccagggcagcgacatcagca	Protospacer
*.***** *************** ..

209. spacer 1.23|10101|26|NZ_LNVK01000029|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.808 

cgccggtgccgacagtacgctgatcg	CRISPR spacer
gttcggtgccgacaggacgccgatcg	Protospacer
  .************ ****.*****

210. spacer 1.25|10197|26|NZ_LNVK01000029|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
attctgcgaaggcagcgacgtcaccg	Protospacer
  . .*********************

211. spacer 1.25|10197|26|NZ_LNVK01000029|CRT matches to NC_008308 (Sphingomonas sp. KA1 plasmid pCAR3 DNA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
catgcgcgaaggcagcgacgttacca	Protospacer
*...*****************.***.

212. spacer 1.25|10197|26|NZ_LNVK01000029|CRT matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

213. spacer 1.25|10197|26|NZ_LNVK01000029|CRT matches to NC_015597 (Sinorhizobium meliloti AK83 plasmid pSINME01, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

214. spacer 1.25|10197|26|NZ_LNVK01000029|CRT matches to NZ_CP018064 (Rhodococcus sp. 2G plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
acgacgcgcaggccgcgacgtcaccg	Protospacer
   ***** **** ************

215. spacer 1.25|10197|26|NZ_LNVK01000029|CRT matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

216. spacer 1.25|10197|26|NZ_LNVK01000029|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .****.****************

217. spacer 1.25|10197|26|NZ_LNVK01000029|CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttcggcgaaggcagcgaagtcaccg	Protospacer
* .  ************* *******

218. spacer 1.25|10197|26|NZ_LNVK01000029|CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

219. spacer 1.25|10197|26|NZ_LNVK01000029|CRT matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

220. spacer 1.25|10197|26|NZ_LNVK01000029|CRT matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

221. spacer 1.25|10197|26|NZ_LNVK01000029|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttcggcgaaggcagcgaagtcaccg	Protospacer
* .  ************* *******

222. spacer 1.25|10197|26|NZ_LNVK01000029|CRT matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

223. spacer 1.25|10197|26|NZ_LNVK01000029|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .****.****************

224. spacer 1.25|10197|26|NZ_LNVK01000029|CRT matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

225. spacer 1.25|10197|26|NZ_LNVK01000029|CRT matches to NZ_CP024891 (Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
acgacgcgcaggccgcgacgtcaccg	Protospacer
   ***** **** ************

226. spacer 1.28|10341|26|NZ_LNVK01000029|CRT matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
aaggcgcaaggggagcgaggtcaccg	Protospacer
 . ********* ***** *******

227. spacer 1.28|10341|26|NZ_LNVK01000029|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .**.******************

228. spacer 1.28|10341|26|NZ_LNVK01000029|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .**.******************

229. spacer 1.28|10341|26|NZ_LNVK01000029|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
atggcgcaagggcagcgacgacaacg	Protospacer
   ***************** ** **

230. spacer 1.29|10389|26|NZ_LNVK01000029|CRT matches to MN183284 (Microbacterium phage Mashley, complete genome) position: , mismatch: 5, identity: 0.808 

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcgggcagcacgctgacgc	Protospacer
***** *****.***********.

231. spacer 1.31|10485|26|NZ_LNVK01000029|CRT matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
aaggcgcaaggggagcgaggtcaccg	Protospacer
 . ********* ***** *******

232. spacer 1.31|10485|26|NZ_LNVK01000029|CRT matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tacgcgccagggcatcgatgtcacca	Protospacer
..***** ****** **********.

233. spacer 1.32|10533|26|NZ_LNVK01000029|CRT matches to MN183284 (Microbacterium phage Mashley, complete genome) position: , mismatch: 5, identity: 0.808 

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcgggcagcacgctgacgc	Protospacer
***** *****.***********.

234. spacer 1.34|10629|26|NZ_LNVK01000029|CRT matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
aaggcgcaaggggagcgaggtcaccg	Protospacer
 . ********* ***** *******

235. spacer 1.34|10629|26|NZ_LNVK01000029|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .**.******************

236. spacer 1.34|10629|26|NZ_LNVK01000029|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .**.******************

237. spacer 1.34|10629|26|NZ_LNVK01000029|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
atggcgcaagggcagcgacgacaacg	Protospacer
   ***************** ** **

238. spacer 1.35|10677|26|NZ_LNVK01000029|CRT matches to MN183284 (Microbacterium phage Mashley, complete genome) position: , mismatch: 5, identity: 0.808 

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcgggcagcacgctgacgc	Protospacer
***** *****.***********.

239. spacer 1.37|10773|26|NZ_LNVK01000029|CRT matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgcgcaagggcagcgacattaccg	CRISPR spacer
cgcgcgcaagggcatcgacatgttca	Protospacer
************** ******  .*.

240. spacer 1.38|10821|26|NZ_LNVK01000029|CRT matches to NZ_CP019315 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-3, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
gcggggggcgggcagcaccttgatcg	Protospacer
   *** ****.**************

241. spacer 1.39|10869|26|NZ_LNVK01000029|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 5, identity: 0.808 

ctccggcagcgacagttcgctgaccg	CRISPR spacer
ctccggcagcgacagttcggattcgg	Protospacer
*******************    * *

242. spacer 1.39|10869|26|NZ_LNVK01000029|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 5, identity: 0.808 

ctccggcagcgacagttcgctgaccg	CRISPR spacer
ctccggcagcgacagttcggattcgg	Protospacer
*******************    * *

243. spacer 1.40|10917|26|NZ_LNVK01000029|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
attctgcgaaggcagcgacgtcaccg	Protospacer
  . .*********************

244. spacer 1.40|10917|26|NZ_LNVK01000029|CRT matches to NC_008308 (Sphingomonas sp. KA1 plasmid pCAR3 DNA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
catgcgcgaaggcagcgacgttacca	Protospacer
*...*****************.***.

245. spacer 1.40|10917|26|NZ_LNVK01000029|CRT matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

246. spacer 1.40|10917|26|NZ_LNVK01000029|CRT matches to NC_015597 (Sinorhizobium meliloti AK83 plasmid pSINME01, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

247. spacer 1.40|10917|26|NZ_LNVK01000029|CRT matches to NZ_CP018064 (Rhodococcus sp. 2G plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
acgacgcgcaggccgcgacgtcaccg	Protospacer
   ***** **** ************

248. spacer 1.40|10917|26|NZ_LNVK01000029|CRT matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

249. spacer 1.40|10917|26|NZ_LNVK01000029|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .****.****************

250. spacer 1.40|10917|26|NZ_LNVK01000029|CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttcggcgaaggcagcgaagtcaccg	Protospacer
* .  ************* *******

251. spacer 1.40|10917|26|NZ_LNVK01000029|CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

252. spacer 1.40|10917|26|NZ_LNVK01000029|CRT matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

253. spacer 1.40|10917|26|NZ_LNVK01000029|CRT matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

254. spacer 1.40|10917|26|NZ_LNVK01000029|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttcggcgaaggcagcgaagtcaccg	Protospacer
* .  ************* *******

255. spacer 1.40|10917|26|NZ_LNVK01000029|CRT matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

256. spacer 1.40|10917|26|NZ_LNVK01000029|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .****.****************

257. spacer 1.40|10917|26|NZ_LNVK01000029|CRT matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

258. spacer 1.40|10917|26|NZ_LNVK01000029|CRT matches to NZ_CP024891 (Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
acgacgcgcaggccgcgacgtcaccg	Protospacer
   ***** **** ************

259. spacer 1.41|10965|26|NZ_LNVK01000029|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcgggcgcggacagcaccctgatct	CRISPR spacer
cgcgggcgcggaccgcaccctgcgcg	Protospacer
 ************ ********  *

260. spacer 1.42|11013|26|NZ_LNVK01000029|CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 5, identity: 0.808 

ggccggcagcgacagttcgctgaccg	CRISPR spacer
atgcggcggcgacagttcggtgaccg	Protospacer
.  ****.*********** ******

261. spacer 1.43|11061|26|NZ_LNVK01000029|CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 5, identity: 0.808 

tgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
caagcgcgagggcagcgacatcaccg	Protospacer
.. ****.***********.******

262. spacer 1.43|11061|26|NZ_LNVK01000029|CRT matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 5, identity: 0.808 

tgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
ctcccgccagggcagcgacgtcacca	Protospacer
. * *** *****************.

263. spacer 1.43|11061|26|NZ_LNVK01000029|CRT matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808 

tgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
aaggcgcaaggggagcgaggtcaccg	Protospacer
 . ********* ***** *******

264. spacer 1.43|11061|26|NZ_LNVK01000029|CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 5, identity: 0.808 

tgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cctgcgcaagggcagctacgacaccg	Protospacer
. .************* *** *****

265. spacer 1.43|11061|26|NZ_LNVK01000029|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808 

tgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
atggcgcaagggcagcgacgacaacg	Protospacer
   ***************** ** **

266. spacer 1.44|11109|26|NZ_LNVK01000029|CRT matches to NZ_CP035502 (Sphingosinicella sp. BN140058 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgggtgcggacagcaccttgatcg	CRISPR spacer
tttggctgcggacagccccttgatcg	Protospacer
. .** ********** *********

267. spacer 1.44|11109|26|NZ_LNVK01000029|CRT matches to NZ_CP019315 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-3, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgggtgcggacagcaccttgatcg	CRISPR spacer
gcggggggcgggcagcaccttgatcg	Protospacer
   *** ****.**************

268. spacer 1.44|11109|26|NZ_LNVK01000029|CRT matches to MT498057 (Microbacterium phage Cicada, complete genome) position: , mismatch: 5, identity: 0.808 

cgcgggtgcggacagcaccttgatcg	CRISPR spacer
ggcgggtgcggaaagcacctcgatgt	Protospacer
 *********** *******.***

269. spacer 1.45|11157|26|NZ_LNVK01000029|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 5, identity: 0.808 

ctccggcagcgacagttcgctgaccg	CRISPR spacer
ctccggcagcgacagttcggattcgg	Protospacer
*******************    * *

270. spacer 1.45|11157|26|NZ_LNVK01000029|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 5, identity: 0.808 

ctccggcagcgacagttcgctgaccg	CRISPR spacer
ctccggcagcgacagttcggattcgg	Protospacer
*******************    * *

271. spacer 1.46|11205|26|NZ_LNVK01000029|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
gaagcgcacgggcagcgacatgagcg	Protospacer
 . ***** ************** **

272. spacer 1.46|11205|26|NZ_LNVK01000029|CRT matches to NZ_MN433457 (Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
tcggcgcaagggcagcgacaagcccg	Protospacer
.  ***************** * ***

273. spacer 1.46|11205|26|NZ_LNVK01000029|CRT matches to NZ_CP022416 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-1, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
tgcgcgcaagggcatcgacatgttca	Protospacer
.************* ******* .*.

274. spacer 1.46|11205|26|NZ_LNVK01000029|CRT matches to MN583270 (Pseudomonas aeruginosa strain NK546 plasmid pNK546b, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
tcggcgcaagggcagcgacaagcccg	Protospacer
.  ***************** * ***

275. spacer 1.46|11205|26|NZ_LNVK01000029|CRT matches to NZ_CP014598 (Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
tgcgcgcaagggcatcgacatgttca	Protospacer
.************* ******* .*.

276. spacer 1.46|11205|26|NZ_LNVK01000029|CRT matches to MK376351 (Pseudomonas sp. strain ANT_H62 plasmid pA62H2, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
tcggcgcaagggcagcgacaagcccg	Protospacer
.  ***************** * ***

277. spacer 1.47|11253|26|NZ_LNVK01000029|CRT matches to NZ_CP013856 (Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence) position: , mismatch: 5, identity: 0.808 

cgctggcgcggatagcaccttgatcg	CRISPR spacer
cgctggcgcggatagcaccgggcctg	Protospacer
*******************  * ..*

278. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

279. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

280. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

281. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

282. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

283. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

284. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

285. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

286. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP021043 (Phaeobacter gallaeciensis strain P129 plasmid pP129_c, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
ccccggcaccgacagctggctgacga	Protospacer
 .****** ******** *******.

287. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

288. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

289. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP010676 (Phaeobacter gallaeciensis strain P75 plasmid pP75_c, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
ccccggcaccgacagctggctgacga	Protospacer
 .****** ******** *******.

290. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

291. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NC_023139 (Phaeobacter gallaeciensis DSM 26640 plasmid pGal_C110, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
ccccggcaccgacagctggctgacga	Protospacer
 .****** ******** *******.

292. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

293. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

294. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

295. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

296. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

297. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

298. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

299. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

300. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

301. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

302. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

303. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

304. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

305. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

306. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

307. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

308. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

309. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

310. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

311. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

312. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

313. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

314. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

315. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

316. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
atccggcagcgacggctcggtgacca	Protospacer
.************.***** **** .

317. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

318. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

319. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

320. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

321. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

322. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

323. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

324. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

325. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

326. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

327. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

328. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

329. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

330. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

331. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

332. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

333. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

334. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

335. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

336. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

337. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

338. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

339. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

340. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

341. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

342. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

343. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

344. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

345. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

346. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

347. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

348. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

349. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

350. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

351. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

352. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

353. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP010591 (Phaeobacter gallaeciensis strain P11 plasmid pP11_c, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
ccccggcaccgacagctggctgacga	Protospacer
 .****** ******** *******.

354. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** ***

355. spacer 1.49|11349|26|NZ_LNVK01000029|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
attctgcgaaggcagcgacgtcaccg	Protospacer
  . .*********************

356. spacer 1.49|11349|26|NZ_LNVK01000029|CRT matches to NC_008308 (Sphingomonas sp. KA1 plasmid pCAR3 DNA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
catgcgcgaaggcagcgacgttacca	Protospacer
*...*****************.***.

357. spacer 1.49|11349|26|NZ_LNVK01000029|CRT matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

358. spacer 1.49|11349|26|NZ_LNVK01000029|CRT matches to NC_015597 (Sinorhizobium meliloti AK83 plasmid pSINME01, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

359. spacer 1.49|11349|26|NZ_LNVK01000029|CRT matches to NZ_CP018064 (Rhodococcus sp. 2G plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
acgacgcgcaggccgcgacgtcaccg	Protospacer
   ***** **** ************

360. spacer 1.49|11349|26|NZ_LNVK01000029|CRT matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

361. spacer 1.49|11349|26|NZ_LNVK01000029|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .****.****************

362. spacer 1.49|11349|26|NZ_LNVK01000029|CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttcggcgaaggcagcgaagtcaccg	Protospacer
* .  ************* *******

363. spacer 1.49|11349|26|NZ_LNVK01000029|CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

364. spacer 1.49|11349|26|NZ_LNVK01000029|CRT matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

365. spacer 1.49|11349|26|NZ_LNVK01000029|CRT matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

366. spacer 1.49|11349|26|NZ_LNVK01000029|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttcggcgaaggcagcgaagtcaccg	Protospacer
* .  ************* *******

367. spacer 1.49|11349|26|NZ_LNVK01000029|CRT matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

368. spacer 1.49|11349|26|NZ_LNVK01000029|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .****.****************

369. spacer 1.49|11349|26|NZ_LNVK01000029|CRT matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

370. spacer 1.49|11349|26|NZ_LNVK01000029|CRT matches to NZ_CP024891 (Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
acgacgcgcaggccgcgacgtcaccg	Protospacer
   ***** **** ************

371. spacer 1.50|11397|26|NZ_LNVK01000029|CRT matches to NZ_CP049029 (Fluviibacterium aquatile strain SC52 plasmid pSC52_1, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
tctgggcccggacagcaccctgaccg	Protospacer
  .**** ***************.**

372. spacer 1.51|11445|26|NZ_LNVK01000029|CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 5, identity: 0.808 

ggccggcagcgacagttcgctgaccg	CRISPR spacer
atgcggcggcgacagttcggtgaccg	Protospacer
.  ****.*********** ******

373. spacer 1.52|11493|26|NZ_LNVK01000029|CRT matches to NZ_KX426227 (Acinetobacter lwoffii strain ED23-35 plasmid pALWED1.1, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcacggcagggcagcgacgtcaccg	CRISPR spacer
tgcacggctgggcagcgaagtcacga	Protospacer
 ******* ********* ***** .

374. spacer 1.52|11493|26|NZ_LNVK01000029|CRT matches to CP033569 (Acinetobacter pittii strain 2014N21-145 plasmid p2014N21-145-1, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcacggcagggcagcgacgtcaccg	CRISPR spacer
tgcacggctgggcagcgaagtcacga	Protospacer
 ******* ********* ***** .

375. spacer 1.52|11493|26|NZ_LNVK01000029|CRT matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcacggcagggcagcgacgtcaccg	CRISPR spacer
ctcccgccagggcagcgacgtcacca	Protospacer
  * ** ******************.

376. spacer 1.52|11493|26|NZ_LNVK01000029|CRT matches to NZ_CP010351 (Acinetobacter johnsonii XBB1 plasmid pXBB1-9, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcacggcagggcagcgacgtcaccg	CRISPR spacer
tgcacggctgggcagcgaagtcacga	Protospacer
 ******* ********* ***** .

377. spacer 1.52|11493|26|NZ_LNVK01000029|CRT matches to NZ_CP029396 (Acinetobacter defluvii strain WCHA30 plasmid pOXA58_010030, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcacggcagggcagcgacgtcaccg	CRISPR spacer
tgcacggctgggcagcgaagtcacga	Protospacer
 ******* ********* ***** .

378. spacer 1.53|11541|26|NZ_LNVK01000029|CRT matches to NZ_CP049029 (Fluviibacterium aquatile strain SC52 plasmid pSC52_1, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
tctgggcccggacagcaccctgaccg	Protospacer
. .**** ***************.**

379. spacer 1.53|11541|26|NZ_LNVK01000029|CRT matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
gtcggcggcggacagcaccctgatcc	Protospacer
  ***  ******************

380. spacer 1.53|11541|26|NZ_LNVK01000029|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
 ..********.***** ********

381. spacer 1.53|11541|26|NZ_LNVK01000029|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
 ..********.***** ********

382. spacer 1.53|11541|26|NZ_LNVK01000029|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
 ..********.***** ********

383. spacer 1.53|11541|26|NZ_LNVK01000029|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
 ..********.***** ********

384. spacer 1.53|11541|26|NZ_LNVK01000029|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
 ..********.***** ********

385. spacer 1.53|11541|26|NZ_LNVK01000029|CRT matches to NZ_CP012918 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence) position: , mismatch: 5, identity: 0.808 

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
gtcggcggcggacagcaccctgatcc	Protospacer
  ***  ******************

386. spacer 1.54|11589|26|NZ_LNVK01000029|CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 5, identity: 0.808 

ggccggcagcgacagttcgctgaccg	CRISPR spacer
atgcggcggcgacagttcggtgaccg	Protospacer
.  ****.*********** ******

387. spacer 1.55|11637|26|NZ_LNVK01000029|CRT matches to NZ_CP017782 (Rhodobacter sp. LPB0142 plasmid pEJ01, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcacggcagggcagcgacatcaccg	CRISPR spacer
cacggggcagggcagcgacatgaccg	Protospacer
 .*. **************** ****

388. spacer 1.55|11637|26|NZ_LNVK01000029|CRT matches to NZ_CP017782 (Rhodobacter sp. LPB0142 plasmid pEJ01, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcacggcagggcagcgacatcaccg	CRISPR spacer
cacggggcagggcagcgacatgaccg	Protospacer
 .*. **************** ****

389. spacer 1.58|11781|26|NZ_LNVK01000029|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcgcgcgaggacagctcgctcactg	CRISPR spacer
ggcgcgcgaggacagcacgctggccc	Protospacer
**************** **** .*.

390. spacer 1.58|11781|26|NZ_LNVK01000029|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 5, identity: 0.808 

ggcgcgcgaggacagctcgctcactg	CRISPR spacer
ggcgcgcgtggacagctcgcttgcgc	Protospacer
******** ************..*

391. spacer 3.3|12519|25|NZ_LNVK01000029|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.8 

gctgatcgcgggcaagggcagtttc	CRISPR spacer
ggtgatcgcgggcaagggcagggcg	Protospacer
* *******************  .

392. spacer 3.3|12519|25|NZ_LNVK01000029|CRISPRCasFinder matches to NZ_CP021658 (Aeromonas salmonicida strain O23A plasmid pO23AP4, complete sequence) position: , mismatch: 5, identity: 0.8 

gctgatcgcgggcaagggcagtttc	CRISPR spacer
gctgatctcgggcaagggcagcacg	Protospacer
******* *************. .

393. spacer 3.3|12519|25|NZ_LNVK01000029|CRISPRCasFinder matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 5, identity: 0.8 

gctgatcgcgggcaagggcagtttc	CRISPR spacer
gctgatggcgggcaagggcagccag	Protospacer
****** **************..

394. spacer 3.3|12519|25|NZ_LNVK01000029|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8 

gctgatcgcgggcaagggcagtttc	CRISPR spacer
cgtgatcgcgggcaatggcagttct	Protospacer
  ************* *******..

395. spacer 3.3|12519|25|NZ_LNVK01000029|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 5, identity: 0.8 

gctgatcgcgggcaagggcagtttc	CRISPR spacer
ggagatcgcgggcaagggcagtcat	Protospacer
*  *******************. .

396. spacer 3.3|12519|25|NZ_LNVK01000029|CRISPRCasFinder matches to MN444870 (Gordonia phage Syleon, complete genome) position: , mismatch: 5, identity: 0.8 

gctgatcgcgggcaagggcagtttc	CRISPR spacer
gctgatcgcgggcaagggctacgcc	Protospacer
******************* .. .*

397. spacer 3.3|12519|25|NZ_LNVK01000029|CRISPRCasFinder matches to MH976515 (Gordonia phage Octobien14, complete genome) position: , mismatch: 5, identity: 0.8 

gctgatcgcgggcaagggcagtttc	CRISPR spacer
gctgatcgcgggcaagggctacgcc	Protospacer
******************* .. .*

398. spacer 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder matches to MH727545 (Mycobacterium phage DismalStressor, complete genome) position: , mismatch: 5, identity: 0.8 

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cgcgatcgcgggcgccgacagcctc	Protospacer
  .******************* .*

399. spacer 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder matches to NC_026598 (Mycobacterium phage Milly, complete genome) position: , mismatch: 5, identity: 0.8 

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cgcgatcgcgggcgccgacagcctc	Protospacer
  .******************* .*

400. spacer 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder matches to MH834601 (Mycobacterium phage BoostSeason, complete genome) position: , mismatch: 5, identity: 0.8 

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cgcgatcgcgggcgccgacagcctc	Protospacer
  .******************* .*

401. spacer 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder matches to KX688047 (Mycobacterium phage Marcoliusprime, complete genome) position: , mismatch: 5, identity: 0.8 

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cgcgatcgcgggcgccgacagcctc	Protospacer
  .******************* .*

402. spacer 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder matches to NC_028759 (Mycobacterium phage Mufasa, complete genome) position: , mismatch: 5, identity: 0.8 

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cgcgatcgcgggcgccgacagcctc	Protospacer
  .******************* .*

403. spacer 3.5|12615|25|NZ_LNVK01000029|CRISPRCasFinder matches to MF140408 (Mycobacterium phage DismalFunk, complete genome) position: , mismatch: 5, identity: 0.8 

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cgcgatcgcgggcgccgacagcctc	Protospacer
  .******************* .*

404. spacer 1.8|9381|26|NZ_LNVK01000029|CRT matches to MN585989 (Mycobacterium phage Superchunk, complete genome) position: , mismatch: 6, identity: 0.769 

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
gcgtcggtcggacagcgcgttgatgt	Protospacer
*  . *******************

405. spacer 1.10|9477|26|NZ_LNVK01000029|CRT matches to LT559120 (Nonomuraea sp. ATCC 39727 isolate nono1 genome assembly, plasmid: III) position: , mismatch: 6, identity: 0.769 

cgcacgcaagggcagcgacgtcaccg	CRISPR spacer
gatcggcaagggcagcgacgtcatcg	Protospacer
 ..  ******************.**

406. spacer 1.11|9525|26|NZ_LNVK01000029|CRT matches to NZ_CP051294 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence) position: , mismatch: 6, identity: 0.769 

ggcgggtgccgacagcaccttgatcg	CRISPR spacer
ggcgggtgccgacagcaccccttaca	Protospacer
*******************..   *.

407. spacer 1.11|9525|26|NZ_LNVK01000029|CRT matches to NZ_CP033363 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence) position: , mismatch: 6, identity: 0.769 

ggcgggtgccgacagcaccttgatcg	CRISPR spacer
ggcgggtgccgacagcaccccttaca	Protospacer
*******************..   *.

408. spacer 1.12|9573|26|NZ_LNVK01000029|CRT matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 6, identity: 0.769 

cgctggcggcgaaagctctctcaccg	CRISPR spacer
atgacgcggcgaaagctctcttaccg	Protospacer
     ****************.****

409. spacer 1.12|9573|26|NZ_LNVK01000029|CRT matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 6, identity: 0.769 

cgctggcggcgaaagctctctcaccg	CRISPR spacer
atgacgcggcgaaagctctcttaccg	Protospacer
     ****************.****

410. spacer 1.14|9669|26|NZ_LNVK01000029|CRT matches to CP000618 (Burkholderia vietnamiensis G4 plasmid pBVIE02, complete sequence) position: , mismatch: 6, identity: 0.769 

tgccggtgcggacagcacgctgatcg	CRISPR spacer
gagcggtgcggccagcacgctgatgt	Protospacer
 . ******** ************

411. spacer 1.15|9717|26|NZ_LNVK01000029|CRT matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.769 

ctcgggcagcgacagctcgctgacag	CRISPR spacer
ttcgggcagcgacagctcgcggcgct	Protospacer
.******************* *

412. spacer 1.16|9765|26|NZ_LNVK01000029|CRT matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.769 

cgcgcgcaagggcagcgacatcactg	CRISPR spacer
cgcgcgcaagggcatcgacatgttca	Protospacer
************** ******  ...

413. spacer 1.23|10101|26|NZ_LNVK01000029|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.769 

cgccggtgccgacagtacgctgatcg	CRISPR spacer
ggccggtgccgacggtacgctgccgc	Protospacer
 ************.******** .

414. spacer 1.23|10101|26|NZ_LNVK01000029|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.769 

cgccggtgccgacagtacgctgatcg	CRISPR spacer
ggccggtgccgacggtacgctgccgc	Protospacer
 ************.******** .

415. spacer 1.23|10101|26|NZ_LNVK01000029|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.769 

cgccggtgccgacagtacgctgatcg	CRISPR spacer
ggccggtgccgacggtacgctgccgc	Protospacer
 ************.******** .

416. spacer 1.23|10101|26|NZ_LNVK01000029|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.769 

cgccggtgccgacagtacgctgatcg	CRISPR spacer
ggccggtgccgacggtacgctgccgc	Protospacer
 ************.******** .

417. spacer 1.23|10101|26|NZ_LNVK01000029|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.769 

cgccggtgccgacagtacgctgatcg	CRISPR spacer
ggccggtgccgacggtacgctgccgc	Protospacer
 ************.******** .

418. spacer 1.25|10197|26|NZ_LNVK01000029|CRT matches to CP052389 (Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1) position: , mismatch: 6, identity: 0.769 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
actgttcgaaggcagcgacgtcaccg	Protospacer
  ... ********************

419. spacer 1.28|10341|26|NZ_LNVK01000029|CRT matches to LT559120 (Nonomuraea sp. ATCC 39727 isolate nono1 genome assembly, plasmid: III) position: , mismatch: 6, identity: 0.769 

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
gatcggcaagggcagcgacgtcatcg	Protospacer
 ..  ******************.**

420. spacer 1.34|10629|26|NZ_LNVK01000029|CRT matches to LT559120 (Nonomuraea sp. ATCC 39727 isolate nono1 genome assembly, plasmid: III) position: , mismatch: 6, identity: 0.769 

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
gatcggcaagggcagcgacgtcatcg	Protospacer
 ..  ******************.**

421. spacer 1.36|10725|26|NZ_LNVK01000029|CRT matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 6, identity: 0.769 

ctcgggcagcgacagttcgctgacgg	CRISPR spacer
gccggccagcgacagttcgctgagct	Protospacer
 .*** *****************

422. spacer 1.38|10821|26|NZ_LNVK01000029|CRT matches to NC_016591 (Burkholderia sp. YI23 plasmid byi_2p, complete sequence) position: , mismatch: 6, identity: 0.769 

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
atagggcgcggacaccaccttgatga	Protospacer
   *********** ********* .

423. spacer 1.38|10821|26|NZ_LNVK01000029|CRT matches to CP000617 (Burkholderia vietnamiensis G4 plasmid pBVIE01, complete sequence) position: , mismatch: 6, identity: 0.769 

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
atagggcgcggacaccaccttgatga	Protospacer
   *********** ********* .

424. spacer 1.38|10821|26|NZ_LNVK01000029|CRT matches to KY555147 (Caulobacter phage Ccr34, complete genome) position: , mismatch: 6, identity: 0.769 

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
gtcgggcgcggtcagcaccttgacga	Protospacer
  ********* ***********. .

425. spacer 1.38|10821|26|NZ_LNVK01000029|CRT matches to KY555145 (Caulobacter phage Ccr29, complete genome) position: , mismatch: 6, identity: 0.769 

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
gtcgggcgcggtcagcaccttgacga	Protospacer
  ********* ***********. .

426. spacer 1.38|10821|26|NZ_LNVK01000029|CRT matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 6, identity: 0.769 

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
gtcgggcgcggtcagcaccttgacga	Protospacer
  ********* ***********. .

427. spacer 1.38|10821|26|NZ_LNVK01000029|CRT matches to KY555146 (Caulobacter phage Ccr32, complete genome) position: , mismatch: 6, identity: 0.769 

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
gtcgggcgcggtcagcaccttgacga	Protospacer
  ********* ***********. .

428. spacer 1.38|10821|26|NZ_LNVK01000029|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 6, identity: 0.769 

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
gtcgggcgcggtcagcaccttgacga	Protospacer
  ********* ***********. .

429. spacer 1.38|10821|26|NZ_LNVK01000029|CRT matches to JX163858 (Caulobacter phage phiCbK, complete genome) position: , mismatch: 6, identity: 0.769 

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
gtcgggcgcggtcagcaccttgacga	Protospacer
  ********* ***********. .

430. spacer 1.38|10821|26|NZ_LNVK01000029|CRT matches to KY555142 (Caulobacter phage Ccr10, complete genome) position: , mismatch: 6, identity: 0.769 

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
gtcgggcgcggtcagcaccttgacga	Protospacer
  ********* ***********. .

431. spacer 1.40|10917|26|NZ_LNVK01000029|CRT matches to CP052389 (Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1) position: , mismatch: 6, identity: 0.769 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
actgttcgaaggcagcgacgtcaccg	Protospacer
  ... ********************

432. spacer 1.43|11061|26|NZ_LNVK01000029|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.769 

tgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
. . .**.******************

433. spacer 1.43|11061|26|NZ_LNVK01000029|CRT matches to LT559120 (Nonomuraea sp. ATCC 39727 isolate nono1 genome assembly, plasmid: III) position: , mismatch: 6, identity: 0.769 

tgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
gatcggcaagggcagcgacgtcatcg	Protospacer
 ..  ******************.**

434. spacer 1.43|11061|26|NZ_LNVK01000029|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 6, identity: 0.769 

tgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
. . .**.******************

435. spacer 1.48|11301|26|NZ_LNVK01000029|CRT matches to NZ_CP020717 (Cnuibacter physcomitrellae strain XA(T) plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.769 

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caacggcagcgacaactcgctgacca	Protospacer
   ***********.********* .

436. spacer 1.49|11349|26|NZ_LNVK01000029|CRT matches to CP052389 (Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1) position: , mismatch: 6, identity: 0.769 

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
actgttcgaaggcagcgacgtcaccg	Protospacer
  ... ********************

437. spacer 1.52|11493|26|NZ_LNVK01000029|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.769 

ggcacggcagggcagcgacgtcaccg	CRISPR spacer
gttcgtccagggcagcgacgtcaccg	Protospacer
* .    *******************

438. spacer 3.3|12519|25|NZ_LNVK01000029|CRISPRCasFinder matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 6, identity: 0.76 

gctgatcgcgggcaagggcagtttc	CRISPR spacer
cctgatcgcgggcaagggcaaggaa	Protospacer
 *******************.

439. spacer 3.3|12519|25|NZ_LNVK01000029|CRISPRCasFinder matches to MT684599 (Gordonia Phage Sephiroth, complete genome) position: , mismatch: 6, identity: 0.76 

gctgatcgcgggcaagggcagtttc	CRISPR spacer
gctgatcgcgggcaagggctacgca	Protospacer
******************* .. .

440. spacer 3.7|12711|25|NZ_LNVK01000029|CRISPRCasFinder matches to NZ_CP022581 (Gordonia rubripertincta strain CWB2 plasmid pGCWB2, complete sequence) position: , mismatch: 6, identity: 0.76 

gctgaccgccggcgacgacagtacg	CRISPR spacer
cctgaccgccggcgacgacacgggc	Protospacer
 *******************  .

441. spacer 1.4|9189|26|NZ_LNVK01000029|CRT matches to NZ_CP014599 (Yangia sp. CCB-MM3 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.731 

ggcgcaggaaggcagccgtctcacct	CRISPR spacer
agcgcaggaaggcagccgtcgggtaa	Protospacer
.*******************  ..

442. spacer 1.52|11493|26|NZ_LNVK01000029|CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 7, identity: 0.731 

ggcacggcagggcagcgacgtcaccg	CRISPR spacer
attcatccagggcagcgacgtcaccg	Protospacer
. .    *******************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_LNVK01000044
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNVK01000044_1 2588-2690 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_LNVK01000017
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNVK01000017_1 91210-91321 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 14175 : 20520 6 Escherichia_phage(33.33%) NA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_LNVK01000010
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNVK01000010_1 64317-68628 TypeI I-C
65 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_LNVK01000010_1 1.45|67295|35|NZ_LNVK01000010|PILER-CR 67295-67329 35 NZ_LNVK01000008.1 64411-64445 0 1.0
NZ_LNVK01000010_1 1.47|67429|34|NZ_LNVK01000010|PILER-CR 67429-67462 34 NZ_LNVK01000008.1 62094-62127 0 1.0
NZ_LNVK01000010_1 1.60|68294|34|NZ_LNVK01000010|PILER-CR 68294-68327 34 NZ_LNVK01000008.1 58637-58670 0 1.0
NZ_LNVK01000010_1 1.64|68562|33|NZ_LNVK01000010|PILER-CR 68562-68594 33 NZ_LNVK01000008.1 78396-78428 0 1.0
NZ_LNVK01000010_1 1.109|67250|35|NZ_LNVK01000010|CRISPRCasFinder,CRT 67250-67284 35 NZ_LNVK01000008.1 64411-64445 0 1.0
NZ_LNVK01000010_1 1.111|67382|34|NZ_LNVK01000010|CRISPRCasFinder,CRT 67382-67415 34 NZ_LNVK01000008.1 62094-62127 0 1.0
NZ_LNVK01000010_1 1.124|68234|35|NZ_LNVK01000010|CRT 68234-68268 35 NZ_LNVK01000008.1 58637-58671 0 1.0
NZ_LNVK01000010_1 1.128|68499|33|NZ_LNVK01000010|CRT,CRISPRCasFinder 68499-68531 33 NZ_LNVK01000008.1 78396-78428 0 1.0
NZ_LNVK01000010_1 1.129|68563|35|NZ_LNVK01000010|CRT,CRISPRCasFinder 68563-68597 35 NZ_LNVK01000008.1 83221-83255 1 0.971

1. spacer 1.45|67295|35|NZ_LNVK01000010|PILER-CR matches to position: 64411-64445, mismatch: 0, identity: 1.0 

cgcagtctctggccggagattgagctgaaccgctc	CRISPR spacer
cgcagtctctggccggagattgagctgaaccgctc	Protospacer
***********************************

2. spacer 1.47|67429|34|NZ_LNVK01000010|PILER-CR matches to position: 62094-62127, mismatch: 0, identity: 1.0 

tcggatgtggcaagagcggcgtcgtccagatccg	CRISPR spacer
tcggatgtggcaagagcggcgtcgtccagatccg	Protospacer
**********************************

3. spacer 1.60|68294|34|NZ_LNVK01000010|PILER-CR matches to position: 58637-58670, mismatch: 0, identity: 1.0 

tccaagtcgggatggtccgcggcgccggcgcggc	CRISPR spacer
tccaagtcgggatggtccgcggcgccggcgcggc	Protospacer
**********************************

4. spacer 1.64|68562|33|NZ_LNVK01000010|PILER-CR matches to position: 78396-78428, mismatch: 0, identity: 1.0 

ccgtactacgtcaccggcaacttcgagggtggt	CRISPR spacer
ccgtactacgtcaccggcaacttcgagggtggt	Protospacer
*********************************

5. spacer 1.109|67250|35|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to position: 64411-64445, mismatch: 0, identity: 1.0 

cgcagtctctggccggagattgagctgaaccgctc	CRISPR spacer
cgcagtctctggccggagattgagctgaaccgctc	Protospacer
***********************************

6. spacer 1.111|67382|34|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to position: 62094-62127, mismatch: 0, identity: 1.0 

tcggatgtggcaagagcggcgtcgtccagatccg	CRISPR spacer
tcggatgtggcaagagcggcgtcgtccagatccg	Protospacer
**********************************

7. spacer 1.124|68234|35|NZ_LNVK01000010|CRT matches to position: 58637-58671, mismatch: 0, identity: 1.0 

ctccaagtcgggatggtccgcggcgccggcgcggc	CRISPR spacer
ctccaagtcgggatggtccgcggcgccggcgcggc	Protospacer
***********************************

8. spacer 1.128|68499|33|NZ_LNVK01000010|CRT,CRISPRCasFinder matches to position: 78396-78428, mismatch: 0, identity: 1.0 

ccgtactacgtcaccggcaacttcgagggtggt	CRISPR spacer
ccgtactacgtcaccggcaacttcgagggtggt	Protospacer
*********************************

9. spacer 1.129|68563|35|NZ_LNVK01000010|CRT,CRISPRCasFinder matches to position: 83221-83255, mismatch: 1, identity: 0.971 

acccatgccatgtcgtcccggcgccactcgacatc	CRISPR spacer
acccaagccatgtcgtcccggcgccactcgacatc	Protospacer
***** *****************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LNVK01000010_1 1.30|66287|34|NZ_LNVK01000010|PILER-CR 66287-66320 34 NC_030937 Xanthomonas phage f30-Xaj, complete genome 27643-27676 1 0.971
NZ_LNVK01000010_1 1.30|66287|34|NZ_LNVK01000010|PILER-CR 66287-66320 34 NC_030928 Xanthomonas phage f20-Xaj, complete genome 41357-41390 1 0.971
NZ_LNVK01000010_1 1.94|66257|34|NZ_LNVK01000010|CRISPRCasFinder,CRT 66257-66290 34 NC_030937 Xanthomonas phage f30-Xaj, complete genome 27643-27676 1 0.971
NZ_LNVK01000010_1 1.94|66257|34|NZ_LNVK01000010|CRISPRCasFinder,CRT 66257-66290 34 NC_030928 Xanthomonas phage f20-Xaj, complete genome 41357-41390 1 0.971
NZ_LNVK01000010_1 1.17|65418|36|NZ_LNVK01000010|PILER-CR 65418-65453 36 NC_030937 Xanthomonas phage f30-Xaj, complete genome 27393-27428 2 0.944
NZ_LNVK01000010_1 1.17|65418|36|NZ_LNVK01000010|PILER-CR 65418-65453 36 NC_030928 Xanthomonas phage f20-Xaj, complete genome 41107-41142 2 0.944
NZ_LNVK01000010_1 1.81|65401|36|NZ_LNVK01000010|CRISPRCasFinder,CRT 65401-65436 36 NC_030937 Xanthomonas phage f30-Xaj, complete genome 27393-27428 2 0.944
NZ_LNVK01000010_1 1.81|65401|36|NZ_LNVK01000010|CRISPRCasFinder,CRT 65401-65436 36 NC_030928 Xanthomonas phage f20-Xaj, complete genome 41107-41142 2 0.944
NZ_LNVK01000010_1 1.23|65820|34|NZ_LNVK01000010|PILER-CR 65820-65853 34 MN478375 Bacteriophage Titan-X, complete genome 2144-2177 3 0.912
NZ_LNVK01000010_1 1.87|65797|34|NZ_LNVK01000010|CRISPRCasFinder,CRT 65797-65830 34 MN478375 Bacteriophage Titan-X, complete genome 2144-2177 3 0.912
NZ_LNVK01000010_1 1.23|65820|34|NZ_LNVK01000010|PILER-CR 65820-65853 34 NC_047762 Xanthomonas phage XAJ24, complete genome 2208-2241 4 0.882
NZ_LNVK01000010_1 1.87|65797|34|NZ_LNVK01000010|CRISPRCasFinder,CRT 65797-65830 34 NC_047762 Xanthomonas phage XAJ24, complete genome 2208-2241 4 0.882
NZ_LNVK01000010_1 1.23|65820|34|NZ_LNVK01000010|PILER-CR 65820-65853 34 NC_022982 Xylella phage Paz, complete genome 2387-2420 5 0.853
NZ_LNVK01000010_1 1.57|68092|35|NZ_LNVK01000010|PILER-CR 68092-68126 35 NC_020205 Xanthomonas citri phage CP2 DNA, complete genome 6091-6125 5 0.857
NZ_LNVK01000010_1 1.87|65797|34|NZ_LNVK01000010|CRISPRCasFinder,CRT 65797-65830 34 NC_022982 Xylella phage Paz, complete genome 2387-2420 5 0.853
NZ_LNVK01000010_1 1.121|68035|35|NZ_LNVK01000010|CRISPRCasFinder,CRT 68035-68069 35 NC_020205 Xanthomonas citri phage CP2 DNA, complete genome 6091-6125 5 0.857
NZ_LNVK01000010_1 1.46|67362|35|NZ_LNVK01000010|PILER-CR 67362-67396 35 NC_023006 Pseudomonas phage PPpW-3 DNA, complete sequence 36701-36735 6 0.829
NZ_LNVK01000010_1 1.110|67316|35|NZ_LNVK01000010|CRISPRCasFinder,CRT 67316-67350 35 NC_023006 Pseudomonas phage PPpW-3 DNA, complete sequence 36701-36735 6 0.829
NZ_LNVK01000010_1 1.41|67024|35|NZ_LNVK01000010|PILER-CR 67024-67058 35 NZ_CP028969 Aminobacter sp. MSH1 plasmid pUSP1, complete sequence 363031-363065 7 0.8
NZ_LNVK01000010_1 1.41|67024|35|NZ_LNVK01000010|PILER-CR 67024-67058 35 NZ_CP026266 Aminobacter sp. MSH1 plasmid pAM01, complete sequence 360217-360251 7 0.8
NZ_LNVK01000010_1 1.55|67959|34|NZ_LNVK01000010|PILER-CR 67959-67992 34 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 359039-359072 7 0.794
NZ_LNVK01000010_1 1.55|67959|34|NZ_LNVK01000010|PILER-CR 67959-67992 34 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 376258-376291 7 0.794
NZ_LNVK01000010_1 1.55|67959|34|NZ_LNVK01000010|PILER-CR 67959-67992 34 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 199796-199829 7 0.794
NZ_LNVK01000010_1 1.55|67959|34|NZ_LNVK01000010|PILER-CR 67959-67992 34 AF394895 Actinophage Q5 replication protein gene, partial cds 638-671 7 0.794
NZ_LNVK01000010_1 1.60|68294|34|NZ_LNVK01000010|PILER-CR 68294-68327 34 MN234219 Mycobacterium phage Mercurio, complete genome 14561-14594 7 0.794
NZ_LNVK01000010_1 1.105|66983|35|NZ_LNVK01000010|CRISPRCasFinder,CRT 66983-67017 35 NZ_CP028969 Aminobacter sp. MSH1 plasmid pUSP1, complete sequence 363031-363065 7 0.8
NZ_LNVK01000010_1 1.105|66983|35|NZ_LNVK01000010|CRISPRCasFinder,CRT 66983-67017 35 NZ_CP026266 Aminobacter sp. MSH1 plasmid pAM01, complete sequence 360217-360251 7 0.8
NZ_LNVK01000010_1 1.119|67904|34|NZ_LNVK01000010|CRISPRCasFinder,CRT 67904-67937 34 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 359039-359072 7 0.794
NZ_LNVK01000010_1 1.119|67904|34|NZ_LNVK01000010|CRISPRCasFinder,CRT 67904-67937 34 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 376258-376291 7 0.794
NZ_LNVK01000010_1 1.119|67904|34|NZ_LNVK01000010|CRISPRCasFinder,CRT 67904-67937 34 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 199796-199829 7 0.794
NZ_LNVK01000010_1 1.119|67904|34|NZ_LNVK01000010|CRISPRCasFinder,CRT 67904-67937 34 AF394895 Actinophage Q5 replication protein gene, partial cds 638-671 7 0.794
NZ_LNVK01000010_1 1.124|68234|35|NZ_LNVK01000010|CRT 68234-68268 35 MN234219 Mycobacterium phage Mercurio, complete genome 14560-14594 7 0.8
NZ_LNVK01000010_1 1.21|65686|34|NZ_LNVK01000010|PILER-CR 65686-65719 34 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 68749-68782 8 0.765
NZ_LNVK01000010_1 1.27|66086|35|NZ_LNVK01000010|PILER-CR 66086-66120 35 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 181092-181126 8 0.771
NZ_LNVK01000010_1 1.39|66889|35|NZ_LNVK01000010|PILER-CR 66889-66923 35 MG757155 Gordonia phage Boneham, complete genome 26715-26749 8 0.771
NZ_LNVK01000010_1 1.39|66889|35|NZ_LNVK01000010|PILER-CR 66889-66923 35 NC_048820 Gordonia phage Jellybones, complete genome 26735-26769 8 0.771
NZ_LNVK01000010_1 1.39|66889|35|NZ_LNVK01000010|PILER-CR 66889-66923 35 MK433263 Gordonia phage FelixAlejandro, complete genome 26913-26947 8 0.771
NZ_LNVK01000010_1 1.39|66889|35|NZ_LNVK01000010|PILER-CR 66889-66923 35 MK359302 Gordonia phage Sombrero, complete genome 26744-26778 8 0.771
NZ_LNVK01000010_1 1.39|66889|35|NZ_LNVK01000010|PILER-CR 66889-66923 35 NC_047892 Gordonia phage BirksAndSocks, complete genome 26716-26750 8 0.771
NZ_LNVK01000010_1 1.39|66889|35|NZ_LNVK01000010|PILER-CR 66889-66923 35 MG770214 Gordonia phage SteveFrench, complete genome 27478-27512 8 0.771
NZ_LNVK01000010_1 1.39|66889|35|NZ_LNVK01000010|PILER-CR 66889-66923 35 MK433267 Gordonia phage Butterball, complete genome 26715-26749 8 0.771
NZ_LNVK01000010_1 1.44|67228|35|NZ_LNVK01000010|PILER-CR 67228-67262 35 KX911187 Rathayibacter phage NCPPB3778, complete genome 7785-7819 8 0.771
NZ_LNVK01000010_1 1.47|67429|34|NZ_LNVK01000010|PILER-CR 67429-67462 34 NZ_CP050105 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence 189496-189529 8 0.765
NZ_LNVK01000010_1 1.47|67429|34|NZ_LNVK01000010|PILER-CR 67429-67462 34 NZ_CP050110 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence 189498-189531 8 0.765
NZ_LNVK01000010_1 1.47|67429|34|NZ_LNVK01000010|PILER-CR 67429-67462 34 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 76281-76314 8 0.765
NZ_LNVK01000010_1 1.48|67495|36|NZ_LNVK01000010|PILER-CR 67495-67530 36 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 726279-726314 8 0.778
NZ_LNVK01000010_1 1.60|68294|34|NZ_LNVK01000010|PILER-CR 68294-68327 34 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 35823-35856 8 0.765
NZ_LNVK01000010_1 1.60|68294|34|NZ_LNVK01000010|PILER-CR 68294-68327 34 MN234185 Mycobacterium phage Lemuria, complete genome 13917-13950 8 0.765
NZ_LNVK01000010_1 1.85|65665|34|NZ_LNVK01000010|CRISPRCasFinder,CRT 65665-65698 34 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 68749-68782 8 0.765
NZ_LNVK01000010_1 1.91|66059|35|NZ_LNVK01000010|CRISPRCasFinder,CRT 66059-66093 35 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 181092-181126 8 0.771
NZ_LNVK01000010_1 1.103|66850|35|NZ_LNVK01000010|CRISPRCasFinder,CRT 66850-66884 35 MG757155 Gordonia phage Boneham, complete genome 26715-26749 8 0.771
NZ_LNVK01000010_1 1.103|66850|35|NZ_LNVK01000010|CRISPRCasFinder,CRT 66850-66884 35 NC_048820 Gordonia phage Jellybones, complete genome 26735-26769 8 0.771
NZ_LNVK01000010_1 1.103|66850|35|NZ_LNVK01000010|CRISPRCasFinder,CRT 66850-66884 35 MK433263 Gordonia phage FelixAlejandro, complete genome 26913-26947 8 0.771
NZ_LNVK01000010_1 1.103|66850|35|NZ_LNVK01000010|CRISPRCasFinder,CRT 66850-66884 35 MK359302 Gordonia phage Sombrero, complete genome 26744-26778 8 0.771
NZ_LNVK01000010_1 1.103|66850|35|NZ_LNVK01000010|CRISPRCasFinder,CRT 66850-66884 35 NC_047892 Gordonia phage BirksAndSocks, complete genome 26716-26750 8 0.771
NZ_LNVK01000010_1 1.103|66850|35|NZ_LNVK01000010|CRISPRCasFinder,CRT 66850-66884 35 MG770214 Gordonia phage SteveFrench, complete genome 27478-27512 8 0.771
NZ_LNVK01000010_1 1.103|66850|35|NZ_LNVK01000010|CRISPRCasFinder,CRT 66850-66884 35 MK433267 Gordonia phage Butterball, complete genome 26715-26749 8 0.771
NZ_LNVK01000010_1 1.108|67184|35|NZ_LNVK01000010|CRISPRCasFinder,CRT 67184-67218 35 KX911187 Rathayibacter phage NCPPB3778, complete genome 7785-7819 8 0.771
NZ_LNVK01000010_1 1.111|67382|34|NZ_LNVK01000010|CRISPRCasFinder,CRT 67382-67415 34 NZ_CP050105 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence 189496-189529 8 0.765
NZ_LNVK01000010_1 1.111|67382|34|NZ_LNVK01000010|CRISPRCasFinder,CRT 67382-67415 34 NZ_CP050110 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence 189498-189531 8 0.765
NZ_LNVK01000010_1 1.111|67382|34|NZ_LNVK01000010|CRISPRCasFinder,CRT 67382-67415 34 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 76281-76314 8 0.765
NZ_LNVK01000010_1 1.112|67447|36|NZ_LNVK01000010|CRISPRCasFinder,CRT 67447-67482 36 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 726279-726314 8 0.778
NZ_LNVK01000010_1 1.124|68234|35|NZ_LNVK01000010|CRT 68234-68268 35 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 35823-35857 8 0.771
NZ_LNVK01000010_1 1.9|64879|34|NZ_LNVK01000010|PILER-CR 64879-64912 34 NZ_CP039640 Azospirillum sp. TSH100 plasmid p1, complete sequence 274754-274787 9 0.735
NZ_LNVK01000010_1 1.19|65554|34|NZ_LNVK01000010|PILER-CR 65554-65587 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2051325-2051358 9 0.735
NZ_LNVK01000010_1 1.19|65554|34|NZ_LNVK01000010|PILER-CR 65554-65587 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2062297-2062330 9 0.735
NZ_LNVK01000010_1 1.21|65686|34|NZ_LNVK01000010|PILER-CR 65686-65719 34 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 97058-97091 9 0.735
NZ_LNVK01000010_1 1.44|67228|35|NZ_LNVK01000010|PILER-CR 67228-67262 35 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 202811-202845 9 0.743
NZ_LNVK01000010_1 1.45|67295|35|NZ_LNVK01000010|PILER-CR 67295-67329 35 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1689129-1689163 9 0.743
NZ_LNVK01000010_1 1.47|67429|34|NZ_LNVK01000010|PILER-CR 67429-67462 34 NZ_CP016462 Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence 97668-97701 9 0.735
NZ_LNVK01000010_1 1.50|67628|33|NZ_LNVK01000010|PILER-CR 67628-67660 33 KX752698 Mycobacterium phage Tonenili, complete genome 149552-149584 9 0.727
NZ_LNVK01000010_1 1.60|68294|34|NZ_LNVK01000010|PILER-CR 68294-68327 34 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 375386-375419 9 0.735
NZ_LNVK01000010_1 1.60|68294|34|NZ_LNVK01000010|PILER-CR 68294-68327 34 NZ_CP039918 Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence 26901-26934 9 0.735
NZ_LNVK01000010_1 1.60|68294|34|NZ_LNVK01000010|PILER-CR 68294-68327 34 NZ_CP039905 Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623a, complete sequence 20386-20419 9 0.735
NZ_LNVK01000010_1 1.60|68294|34|NZ_LNVK01000010|PILER-CR 68294-68327 34 NZ_CP039909 Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence 215244-215277 9 0.735
NZ_LNVK01000010_1 1.73|64870|34|NZ_LNVK01000010|CRISPRCasFinder,CRT 64870-64903 34 NZ_CP039640 Azospirillum sp. TSH100 plasmid p1, complete sequence 274754-274787 9 0.735
NZ_LNVK01000010_1 1.83|65535|34|NZ_LNVK01000010|CRISPRCasFinder,CRT 65535-65568 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2051325-2051358 9 0.735
NZ_LNVK01000010_1 1.83|65535|34|NZ_LNVK01000010|CRISPRCasFinder,CRT 65535-65568 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2062297-2062330 9 0.735
NZ_LNVK01000010_1 1.85|65665|34|NZ_LNVK01000010|CRISPRCasFinder,CRT 65665-65698 34 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 97058-97091 9 0.735
NZ_LNVK01000010_1 1.108|67184|35|NZ_LNVK01000010|CRISPRCasFinder,CRT 67184-67218 35 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 202811-202845 9 0.743
NZ_LNVK01000010_1 1.109|67250|35|NZ_LNVK01000010|CRISPRCasFinder,CRT 67250-67284 35 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1689129-1689163 9 0.743
NZ_LNVK01000010_1 1.111|67382|34|NZ_LNVK01000010|CRISPRCasFinder,CRT 67382-67415 34 NZ_CP016462 Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence 97668-97701 9 0.735
NZ_LNVK01000010_1 1.114|67578|33|NZ_LNVK01000010|CRISPRCasFinder,CRT 67578-67610 33 KX752698 Mycobacterium phage Tonenili, complete genome 149552-149584 9 0.727
NZ_LNVK01000010_1 1.124|68234|35|NZ_LNVK01000010|CRT 68234-68268 35 MN234185 Mycobacterium phage Lemuria, complete genome 13916-13950 9 0.743
NZ_LNVK01000010_1 1.9|64879|34|NZ_LNVK01000010|PILER-CR 64879-64912 34 NZ_CP045120 Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence 138837-138870 10 0.706
NZ_LNVK01000010_1 1.14|65215|35|NZ_LNVK01000010|PILER-CR 65215-65249 35 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 260935-260969 10 0.714
NZ_LNVK01000010_1 1.14|65215|35|NZ_LNVK01000010|PILER-CR 65215-65249 35 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 268047-268081 10 0.714
NZ_LNVK01000010_1 1.29|66221|34|NZ_LNVK01000010|PILER-CR 66221-66254 34 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1906752-1906785 10 0.706
NZ_LNVK01000010_1 1.29|66221|34|NZ_LNVK01000010|PILER-CR 66221-66254 34 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 287381-287414 10 0.706
NZ_LNVK01000010_1 1.41|67024|35|NZ_LNVK01000010|PILER-CR 67024-67058 35 NZ_CP017242 Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence 50736-50770 10 0.714
NZ_LNVK01000010_1 1.42|67091|37|NZ_LNVK01000010|PILER-CR 67091-67127 37 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 149194-149230 10 0.73
NZ_LNVK01000010_1 1.48|67495|36|NZ_LNVK01000010|PILER-CR 67495-67530 36 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1477450-1477485 10 0.722
NZ_LNVK01000010_1 1.60|68294|34|NZ_LNVK01000010|PILER-CR 68294-68327 34 MT024859 Gordonia phage DumpsterDude, complete genome 13125-13158 10 0.706
NZ_LNVK01000010_1 1.73|64870|34|NZ_LNVK01000010|CRISPRCasFinder,CRT 64870-64903 34 NZ_CP045120 Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence 138837-138870 10 0.706
NZ_LNVK01000010_1 1.78|65201|35|NZ_LNVK01000010|CRISPRCasFinder,CRT 65201-65235 35 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 260935-260969 10 0.714
NZ_LNVK01000010_1 1.78|65201|35|NZ_LNVK01000010|CRISPRCasFinder,CRT 65201-65235 35 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 268047-268081 10 0.714
NZ_LNVK01000010_1 1.93|66192|34|NZ_LNVK01000010|CRISPRCasFinder,CRT 66192-66225 34 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1906752-1906785 10 0.706
NZ_LNVK01000010_1 1.93|66192|34|NZ_LNVK01000010|CRISPRCasFinder,CRT 66192-66225 34 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 287381-287414 10 0.706
NZ_LNVK01000010_1 1.105|66983|35|NZ_LNVK01000010|CRISPRCasFinder,CRT 66983-67017 35 NZ_CP017242 Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence 50736-50770 10 0.714
NZ_LNVK01000010_1 1.106|67049|37|NZ_LNVK01000010|CRISPRCasFinder,CRT 67049-67085 37 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 149194-149230 10 0.73
NZ_LNVK01000010_1 1.112|67447|36|NZ_LNVK01000010|CRISPRCasFinder,CRT 67447-67482 36 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1477450-1477485 10 0.722
NZ_LNVK01000010_1 1.124|68234|35|NZ_LNVK01000010|CRT 68234-68268 35 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 375385-375419 10 0.714
NZ_LNVK01000010_1 1.7|64747|34|NZ_LNVK01000010|PILER-CR 64747-64780 34 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 608994-609027 11 0.676
NZ_LNVK01000010_1 1.21|65686|34|NZ_LNVK01000010|PILER-CR 65686-65719 34 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 715792-715825 11 0.676
NZ_LNVK01000010_1 1.21|65686|34|NZ_LNVK01000010|PILER-CR 65686-65719 34 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 772682-772715 11 0.676
NZ_LNVK01000010_1 1.29|66221|34|NZ_LNVK01000010|PILER-CR 66221-66254 34 MF360958 Salicola phage SCTP-2, complete genome 377440-377473 11 0.676
NZ_LNVK01000010_1 1.29|66221|34|NZ_LNVK01000010|PILER-CR 66221-66254 34 MK388689 Pantoea phage vB_PagM_LIET2, complete genome 3237-3270 11 0.676
NZ_LNVK01000010_1 1.44|67228|35|NZ_LNVK01000010|PILER-CR 67228-67262 35 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4200703-4200737 11 0.686
NZ_LNVK01000010_1 1.52|67760|34|NZ_LNVK01000010|PILER-CR 67760-67793 34 MG518519 Streptomyces phage Manuel, complete genome 21300-21333 11 0.676
NZ_LNVK01000010_1 1.60|68294|34|NZ_LNVK01000010|PILER-CR 68294-68327 34 NC_048019 Gordonia phage Ruthy, complete genome 13235-13268 11 0.676
NZ_LNVK01000010_1 1.71|64740|34|NZ_LNVK01000010|CRISPRCasFinder,CRT 64740-64773 34 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 608994-609027 11 0.676
NZ_LNVK01000010_1 1.85|65665|34|NZ_LNVK01000010|CRISPRCasFinder,CRT 65665-65698 34 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 715792-715825 11 0.676
NZ_LNVK01000010_1 1.85|65665|34|NZ_LNVK01000010|CRISPRCasFinder,CRT 65665-65698 34 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 772682-772715 11 0.676
NZ_LNVK01000010_1 1.93|66192|34|NZ_LNVK01000010|CRISPRCasFinder,CRT 66192-66225 34 MF360958 Salicola phage SCTP-2, complete genome 377440-377473 11 0.676
NZ_LNVK01000010_1 1.93|66192|34|NZ_LNVK01000010|CRISPRCasFinder,CRT 66192-66225 34 MK388689 Pantoea phage vB_PagM_LIET2, complete genome 3237-3270 11 0.676
NZ_LNVK01000010_1 1.108|67184|35|NZ_LNVK01000010|CRISPRCasFinder,CRT 67184-67218 35 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4200703-4200737 11 0.686
NZ_LNVK01000010_1 1.116|67708|34|NZ_LNVK01000010|CRISPRCasFinder,CRT 67708-67741 34 MG518519 Streptomyces phage Manuel, complete genome 21300-21333 11 0.676

1. spacer 1.30|66287|34|NZ_LNVK01000010|PILER-CR matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 1, identity: 0.971 

aggtttccgccgtagcgaggggccgtctcgtcga	CRISPR spacer
aggtttccgccgtagcgaggggccgtctcgtcca	Protospacer
******************************** *

2. spacer 1.30|66287|34|NZ_LNVK01000010|PILER-CR matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 1, identity: 0.971 

aggtttccgccgtagcgaggggccgtctcgtcga	CRISPR spacer
aggtttccgccgtagcgaggggccgtctcgtcca	Protospacer
******************************** *

3. spacer 1.94|66257|34|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 1, identity: 0.971 

aggtttccgccgtagcgaggggccgtctcgtcga	CRISPR spacer
aggtttccgccgtagcgaggggccgtctcgtcca	Protospacer
******************************** *

4. spacer 1.94|66257|34|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 1, identity: 0.971 

aggtttccgccgtagcgaggggccgtctcgtcga	CRISPR spacer
aggtttccgccgtagcgaggggccgtctcgtcca	Protospacer
******************************** *

5. spacer 1.17|65418|36|NZ_LNVK01000010|PILER-CR matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 2, identity: 0.944 

accatcgaggccgagtttaacggcatgtacgtggac	CRISPR spacer
accatcgaggccgagtacaacggcatgtacgtggac	Protospacer
**************** .******************

6. spacer 1.17|65418|36|NZ_LNVK01000010|PILER-CR matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 2, identity: 0.944 

accatcgaggccgagtttaacggcatgtacgtggac	CRISPR spacer
accatcgaggccgagtacaacggcatgtacgtggac	Protospacer
**************** .******************

7. spacer 1.81|65401|36|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 2, identity: 0.944 

accatcgaggccgagtttaacggcatgtacgtggac	CRISPR spacer
accatcgaggccgagtacaacggcatgtacgtggac	Protospacer
**************** .******************

8. spacer 1.81|65401|36|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 2, identity: 0.944 

accatcgaggccgagtttaacggcatgtacgtggac	CRISPR spacer
accatcgaggccgagtacaacggcatgtacgtggac	Protospacer
**************** .******************

9. spacer 1.23|65820|34|NZ_LNVK01000010|PILER-CR matches to MN478375 (Bacteriophage Titan-X, complete genome) position: , mismatch: 3, identity: 0.912 

aagtgtgcatcgccgtggcccctcttgcgaaggg	CRISPR spacer
cagtgtgcagcaccgtggcccctcttgcgaaggg	Protospacer
 ******** *.**********************

10. spacer 1.87|65797|34|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to MN478375 (Bacteriophage Titan-X, complete genome) position: , mismatch: 3, identity: 0.912 

aagtgtgcatcgccgtggcccctcttgcgaaggg	CRISPR spacer
cagtgtgcagcaccgtggcccctcttgcgaaggg	Protospacer
 ******** *.**********************

11. spacer 1.23|65820|34|NZ_LNVK01000010|PILER-CR matches to NC_047762 (Xanthomonas phage XAJ24, complete genome) position: , mismatch: 4, identity: 0.882 

aagtgtgcatcgccgtggcccctcttgcgaaggg	CRISPR spacer
gtatgtgcatcaccgtggcccctcttgcgaaggg	Protospacer
. .********.**********************

12. spacer 1.87|65797|34|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NC_047762 (Xanthomonas phage XAJ24, complete genome) position: , mismatch: 4, identity: 0.882 

aagtgtgcatcgccgtggcccctcttgcgaaggg	CRISPR spacer
gtatgtgcatcaccgtggcccctcttgcgaaggg	Protospacer
. .********.**********************

13. spacer 1.23|65820|34|NZ_LNVK01000010|PILER-CR matches to NC_022982 (Xylella phage Paz, complete genome) position: , mismatch: 5, identity: 0.853 

aagtgtgcatcgccgtggcccctcttgcgaaggg	CRISPR spacer
ttgcgtgtatctccgtggcccctcttgcgaaggg	Protospacer
  *.***.*** **********************

14. spacer 1.57|68092|35|NZ_LNVK01000010|PILER-CR matches to NC_020205 (Xanthomonas citri phage CP2 DNA, complete genome) position: , mismatch: 5, identity: 0.857 

ctggccaacctggtggtgctggtcttcacttccag	CRISPR spacer
ctggccaacctggtcgtgctggtgttcacgaacag	Protospacer
************** ******** *****   ***

15. spacer 1.87|65797|34|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NC_022982 (Xylella phage Paz, complete genome) position: , mismatch: 5, identity: 0.853 

aagtgtgcatcgccgtggcccctcttgcgaaggg	CRISPR spacer
ttgcgtgtatctccgtggcccctcttgcgaaggg	Protospacer
  *.***.*** **********************

16. spacer 1.121|68035|35|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NC_020205 (Xanthomonas citri phage CP2 DNA, complete genome) position: , mismatch: 5, identity: 0.857 

ctggccaacctggtggtgctggtcttcacttccag	CRISPR spacer
ctggccaacctggtcgtgctggtgttcacgaacag	Protospacer
************** ******** *****   ***

17. spacer 1.46|67362|35|NZ_LNVK01000010|PILER-CR matches to NC_023006 (Pseudomonas phage PPpW-3 DNA, complete sequence) position: , mismatch: 6, identity: 0.829 

tgtacaaggcgcacaggctagcatggctc-catgtc	CRISPR spacer
agtacaaggcgcacaagctcgcatggcttgcctgt-	Protospacer
 **************.*** ********. * ***

18. spacer 1.110|67316|35|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NC_023006 (Pseudomonas phage PPpW-3 DNA, complete sequence) position: , mismatch: 6, identity: 0.829 

tgtacaaggcgcacaggctagcatggctc-catgtc	CRISPR spacer
agtacaaggcgcacaagctcgcatggcttgcctgt-	Protospacer
 **************.*** ********. * ***

19. spacer 1.41|67024|35|NZ_LNVK01000010|PILER-CR matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 7, identity: 0.8 

caaaatttcattacgatggacgacatcgtcaccga	CRISPR spacer
ccgcatgacattccgatggacgtcatcgtcaccga	Protospacer
* . **  **** ********* ************

20. spacer 1.41|67024|35|NZ_LNVK01000010|PILER-CR matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 7, identity: 0.8 

caaaatttcattacgatggacgacatcgtcaccga	CRISPR spacer
ccgcatgacattccgatggacgtcatcgtcaccga	Protospacer
* . **  **** ********* ************

21. spacer 1.55|67959|34|NZ_LNVK01000010|PILER-CR matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.794 

tcgatgccggcggcctggcaaatctcagtcgccc---	CRISPR spacer
tcgatcccggcggcctggcaagtct---gcgcgcgga	Protospacer
***** ***************.***    *** *

22. spacer 1.55|67959|34|NZ_LNVK01000010|PILER-CR matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.794 

tcgatgccggcggcctggcaaatctcagtcgccc---	CRISPR spacer
tcgatcccggcggcctggcaagtct---gcgcgcgga	Protospacer
***** ***************.***    *** *

23. spacer 1.55|67959|34|NZ_LNVK01000010|PILER-CR matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.794 

tcgatgccggcggcctggcaaatctcagtcgccc---	CRISPR spacer
tcgatcccggcggcctggcaagtct---gcgcgcgga	Protospacer
***** ***************.***    *** *

24. spacer 1.55|67959|34|NZ_LNVK01000010|PILER-CR matches to AF394895 (Actinophage Q5 replication protein gene, partial cds) position: , mismatch: 7, identity: 0.794 

tcgatgccggcggcctggcaaatctcagtcgccc	CRISPR spacer
tcgtgggggtcggcctggcaaatctgtgtcgccc	Protospacer
***  *  * ***************  *******

25. spacer 1.60|68294|34|NZ_LNVK01000010|PILER-CR matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 7, identity: 0.794 

tccaagtcgggatggtccgcggcgccggcgcggc	CRISPR spacer
tgattctcgggaagggccgcggcgccggcgcggc	Protospacer
*     ****** ** ******************

26. spacer 1.105|66983|35|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 7, identity: 0.8 

caaaatttcattacgatggacgacatcgtcaccga	CRISPR spacer
ccgcatgacattccgatggacgtcatcgtcaccga	Protospacer
* . **  **** ********* ************

27. spacer 1.105|66983|35|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 7, identity: 0.8 

caaaatttcattacgatggacgacatcgtcaccga	CRISPR spacer
ccgcatgacattccgatggacgtcatcgtcaccga	Protospacer
* . **  **** ********* ************

28. spacer 1.119|67904|34|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.794 

tcgatgccggcggcctggcaaatctcagtcgccc---	CRISPR spacer
tcgatcccggcggcctggcaagtct---gcgcgcgga	Protospacer
***** ***************.***    *** *

29. spacer 1.119|67904|34|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.794 

tcgatgccggcggcctggcaaatctcagtcgccc---	CRISPR spacer
tcgatcccggcggcctggcaagtct---gcgcgcgga	Protospacer
***** ***************.***    *** *

30. spacer 1.119|67904|34|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.794 

tcgatgccggcggcctggcaaatctcagtcgccc---	CRISPR spacer
tcgatcccggcggcctggcaagtct---gcgcgcgga	Protospacer
***** ***************.***    *** *

31. spacer 1.119|67904|34|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to AF394895 (Actinophage Q5 replication protein gene, partial cds) position: , mismatch: 7, identity: 0.794 

tcgatgccggcggcctggcaaatctcagtcgccc	CRISPR spacer
tcgtgggggtcggcctggcaaatctgtgtcgccc	Protospacer
***  *  * ***************  *******

32. spacer 1.124|68234|35|NZ_LNVK01000010|CRT matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 7, identity: 0.8 

----ctccaagtcgggatggtccgcggcgccggcgcggc	CRISPR spacer
gtgattc----tcgggaagggccgcggcgccggcgcggc	Protospacer
    .**    ****** ** ******************

33. spacer 1.21|65686|34|NZ_LNVK01000010|PILER-CR matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 8, identity: 0.765 

tactactgccgggccgaggcactggtggcggcga	CRISPR spacer
gcctttggccgggccgaggcacagctggcggcgg	Protospacer
  ** . *************** * ********.

34. spacer 1.27|66086|35|NZ_LNVK01000010|PILER-CR matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 8, identity: 0.771 

tgaacacggtcgctgaagaactcgccaccagagag	CRISPR spacer
tgaacacggtcgccgaagaactcgcactgtcagaa	Protospacer
*************.***********  .   ***.

35. spacer 1.39|66889|35|NZ_LNVK01000010|PILER-CR matches to MG757155 (Gordonia phage Boneham, complete genome) position: , mismatch: 8, identity: 0.771 

atgggcgaaatcaagcacagcgccgatggcaagta	CRISPR spacer
cttggcgaagtcaagcactgcgccgatggcattcg	Protospacer
 * ******.******** ************  ..

36. spacer 1.39|66889|35|NZ_LNVK01000010|PILER-CR matches to NC_048820 (Gordonia phage Jellybones, complete genome) position: , mismatch: 8, identity: 0.771 

atgggcgaaatcaagcacagcgccgatggcaagta	CRISPR spacer
cttggcgaagtcaagcactgcgccgatggcattcg	Protospacer
 * ******.******** ************  ..

37. spacer 1.39|66889|35|NZ_LNVK01000010|PILER-CR matches to MK433263 (Gordonia phage FelixAlejandro, complete genome) position: , mismatch: 8, identity: 0.771 

atgggcgaaatcaagcacagcgccgatggcaagta	CRISPR spacer
cttggcgaagtcaagcactgcgccgatggcattcg	Protospacer
 * ******.******** ************  ..

38. spacer 1.39|66889|35|NZ_LNVK01000010|PILER-CR matches to MK359302 (Gordonia phage Sombrero, complete genome) position: , mismatch: 8, identity: 0.771 

atgggcgaaatcaagcacagcgccgatggcaagta	CRISPR spacer
cttggcgaagtcaagcactgcgccgatggcattcg	Protospacer
 * ******.******** ************  ..

39. spacer 1.39|66889|35|NZ_LNVK01000010|PILER-CR matches to NC_047892 (Gordonia phage BirksAndSocks, complete genome) position: , mismatch: 8, identity: 0.771 

atgggcgaaatcaagcacagcgccgatggcaagta	CRISPR spacer
cttggcgaagtcaagcactgcgccgatggcattcg	Protospacer
 * ******.******** ************  ..

40. spacer 1.39|66889|35|NZ_LNVK01000010|PILER-CR matches to MG770214 (Gordonia phage SteveFrench, complete genome) position: , mismatch: 8, identity: 0.771 

atgggcgaaatcaagcacagcgccgatggcaagta	CRISPR spacer
cttggcgaagtcaagcactgcgccgatggcattcg	Protospacer
 * ******.******** ************  ..

41. spacer 1.39|66889|35|NZ_LNVK01000010|PILER-CR matches to MK433267 (Gordonia phage Butterball, complete genome) position: , mismatch: 8, identity: 0.771 

atgggcgaaatcaagcacagcgccgatggcaagta	CRISPR spacer
cttggcgaagtcaagcactgcgccgatggcattcg	Protospacer
 * ******.******** ************  ..

42. spacer 1.44|67228|35|NZ_LNVK01000010|PILER-CR matches to KX911187 (Rathayibacter phage NCPPB3778, complete genome) position: , mismatch: 8, identity: 0.771 

aagcgcgacagcagcaaggccgggaacctgcagct	CRISPR spacer
aggcgcgaaagcagcaaggccggtaaccgggatac	Protospacer
*.****** ************** **** * *  .

43. spacer 1.47|67429|34|NZ_LNVK01000010|PILER-CR matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 8, identity: 0.765 

tcggatgtggcaagagcggcgtcgtccagatccg	CRISPR spacer
tcgcggccgccaagagcctcgtcgtccagatccg	Protospacer
*** .  .* *******  ***************

44. spacer 1.47|67429|34|NZ_LNVK01000010|PILER-CR matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 8, identity: 0.765 

tcggatgtggcaagagcggcgtcgtccagatccg	CRISPR spacer
tcgcggccgccaagagcctcgtcgtccagatccg	Protospacer
*** .  .* *******  ***************

45. spacer 1.47|67429|34|NZ_LNVK01000010|PILER-CR matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765 

tcggatgtggcaagagcggcgtcgtccagatccg	CRISPR spacer
tcgcggccgccaagagcctcgtcgtccagatccg	Protospacer
*** .  .* *******  ***************

46. spacer 1.48|67495|36|NZ_LNVK01000010|PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.778 

cgggacgc---ggcgctgggtgtcgtggacgccgcgcgc	CRISPR spacer
---gatgtgcaggcgctgggcgtcgtcgacgccgcgcgg	Protospacer
   **.*.   *********.***** ***********

47. spacer 1.60|68294|34|NZ_LNVK01000010|PILER-CR matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765 

tccaagtcgggatggtccgcggcgccggcgcggc	CRISPR spacer
ggcacgaatggacggtccgcggcgccggcgaggc	Protospacer
  ** *   ***.***************** ***

48. spacer 1.60|68294|34|NZ_LNVK01000010|PILER-CR matches to MN234185 (Mycobacterium phage Lemuria, complete genome) position: , mismatch: 8, identity: 0.765 

tccaagtcgggatggtccgcggcgccggcgcggc	CRISPR spacer
tcattctcgggaagggccgcggcgccggcgctcc	Protospacer
**    ****** ** ***************  *

49. spacer 1.85|65665|34|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 8, identity: 0.765 

tactactgccgggccgaggcactggtggcggcga	CRISPR spacer
gcctttggccgggccgaggcacagctggcggcgg	Protospacer
  ** . *************** * ********.

50. spacer 1.91|66059|35|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 8, identity: 0.771 

tgaacacggtcgctgaagaactcgccaccagagag	CRISPR spacer
tgaacacggtcgccgaagaactcgcactgtcagaa	Protospacer
*************.***********  .   ***.

51. spacer 1.103|66850|35|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to MG757155 (Gordonia phage Boneham, complete genome) position: , mismatch: 8, identity: 0.771 

atgggcgaaatcaagcacagcgccgatggcaagta	CRISPR spacer
cttggcgaagtcaagcactgcgccgatggcattcg	Protospacer
 * ******.******** ************  ..

52. spacer 1.103|66850|35|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NC_048820 (Gordonia phage Jellybones, complete genome) position: , mismatch: 8, identity: 0.771 

atgggcgaaatcaagcacagcgccgatggcaagta	CRISPR spacer
cttggcgaagtcaagcactgcgccgatggcattcg	Protospacer
 * ******.******** ************  ..

53. spacer 1.103|66850|35|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to MK433263 (Gordonia phage FelixAlejandro, complete genome) position: , mismatch: 8, identity: 0.771 

atgggcgaaatcaagcacagcgccgatggcaagta	CRISPR spacer
cttggcgaagtcaagcactgcgccgatggcattcg	Protospacer
 * ******.******** ************  ..

54. spacer 1.103|66850|35|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to MK359302 (Gordonia phage Sombrero, complete genome) position: , mismatch: 8, identity: 0.771 

atgggcgaaatcaagcacagcgccgatggcaagta	CRISPR spacer
cttggcgaagtcaagcactgcgccgatggcattcg	Protospacer
 * ******.******** ************  ..

55. spacer 1.103|66850|35|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NC_047892 (Gordonia phage BirksAndSocks, complete genome) position: , mismatch: 8, identity: 0.771 

atgggcgaaatcaagcacagcgccgatggcaagta	CRISPR spacer
cttggcgaagtcaagcactgcgccgatggcattcg	Protospacer
 * ******.******** ************  ..

56. spacer 1.103|66850|35|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to MG770214 (Gordonia phage SteveFrench, complete genome) position: , mismatch: 8, identity: 0.771 

atgggcgaaatcaagcacagcgccgatggcaagta	CRISPR spacer
cttggcgaagtcaagcactgcgccgatggcattcg	Protospacer
 * ******.******** ************  ..

57. spacer 1.103|66850|35|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to MK433267 (Gordonia phage Butterball, complete genome) position: , mismatch: 8, identity: 0.771 

atgggcgaaatcaagcacagcgccgatggcaagta	CRISPR spacer
cttggcgaagtcaagcactgcgccgatggcattcg	Protospacer
 * ******.******** ************  ..

58. spacer 1.108|67184|35|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to KX911187 (Rathayibacter phage NCPPB3778, complete genome) position: , mismatch: 8, identity: 0.771 

aagcgcgacagcagcaaggccgggaacctgcagct	CRISPR spacer
aggcgcgaaagcagcaaggccggtaaccgggatac	Protospacer
*.****** ************** **** * *  .

59. spacer 1.111|67382|34|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 8, identity: 0.765 

tcggatgtggcaagagcggcgtcgtccagatccg	CRISPR spacer
tcgcggccgccaagagcctcgtcgtccagatccg	Protospacer
*** .  .* *******  ***************

60. spacer 1.111|67382|34|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 8, identity: 0.765 

tcggatgtggcaagagcggcgtcgtccagatccg	CRISPR spacer
tcgcggccgccaagagcctcgtcgtccagatccg	Protospacer
*** .  .* *******  ***************

61. spacer 1.111|67382|34|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765 

tcggatgtggcaagagcggcgtcgtccagatccg	CRISPR spacer
tcgcggccgccaagagcctcgtcgtccagatccg	Protospacer
*** .  .* *******  ***************

62. spacer 1.112|67447|36|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.778 

cgggacgc---ggcgctgggtgtcgtggacgccgcgcgc	CRISPR spacer
---gatgtgcaggcgctgggcgtcgtcgacgccgcgcgg	Protospacer
   **.*.   *********.***** ***********

63. spacer 1.124|68234|35|NZ_LNVK01000010|CRT matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.771 

ctccaagtcgggatggtccgcggcgccggcgcggc	CRISPR spacer
cggcacgaatggacggtccgcggcgccggcgaggc	Protospacer
*  ** *   ***.***************** ***

64. spacer 1.9|64879|34|NZ_LNVK01000010|PILER-CR matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.735 

ctcggccgccggcccgtcttgcgttggccttggt	CRISPR spacer
ctgccgcgccgaccggtcttgcgttggcctccgg	Protospacer
**    *****.** ***************. *

65. spacer 1.19|65554|34|NZ_LNVK01000010|PILER-CR matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.735 

ttgtccatcgcgcaggcgcgcttaatgaccacgc	CRISPR spacer
gtgtccatcgcccaggcgcgcgtaaacagtatcc	Protospacer
 ********** ********* ***  * .*. *

66. spacer 1.19|65554|34|NZ_LNVK01000010|PILER-CR matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.735 

ttgtccatcgcgcaggcgcgcttaatgaccacgc	CRISPR spacer
gtgtccatcgcccaggcgcgcgtaaacagtatcc	Protospacer
 ********** ********* ***  * .*. *

67. spacer 1.21|65686|34|NZ_LNVK01000010|PILER-CR matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 9, identity: 0.735 

tactactg----ccgggccgaggcactggtggcggcga	CRISPR spacer
----gcggtgaccctggccgaggcactggtggcggccg	Protospacer
    .* *    ** ********************* .

68. spacer 1.44|67228|35|NZ_LNVK01000010|PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.743 

aagcgcgacagcagcaaggccgggaacctgcagct	CRISPR spacer
tcgcgcgacggcagcaaggccggcaacatcgtgcg	Protospacer
  *******.************* *** *   **

69. spacer 1.45|67295|35|NZ_LNVK01000010|PILER-CR matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.743 

cgcagtc-tctggccggagattgagctgaaccgctc	CRISPR spacer
-gcgaccgaacggccgaagattgcgctgaaccgctc	Protospacer
 **...*   .*****.****** ************

70. spacer 1.47|67429|34|NZ_LNVK01000010|PILER-CR matches to NZ_CP016462 (Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence) position: , mismatch: 9, identity: 0.735 

tcggatgtggcaagagcggcgtcgtccagatccg	CRISPR spacer
atggcccgggcaagatcggcctcgtccagatcgg	Protospacer
 .** .  ******* **** *********** *

71. spacer 1.50|67628|33|NZ_LNVK01000010|PILER-CR matches to KX752698 (Mycobacterium phage Tonenili, complete genome) position: , mismatch: 9, identity: 0.727 

acggtgatccgatgctgggcgatgtctgggatg	CRISPR spacer
ccggtgacccgctgctgggcgatgtcgatgcca	Protospacer
 ******.*** ************** . * ..

72. spacer 1.60|68294|34|NZ_LNVK01000010|PILER-CR matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.735 

tccaagtcgggatggtccgcggcgccggcgcggc	CRISPR spacer
tcagcgtcggggtcgtccgcggcgccggcgactt	Protospacer
** . ******.* ****************   .

73. spacer 1.60|68294|34|NZ_LNVK01000010|PILER-CR matches to NZ_CP039918 (Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence) position: , mismatch: 9, identity: 0.735 

tccaag---tcgggatggtccgcggcgccggcgcggc	CRISPR spacer
---gaggcttcgggatggtccgcggcgtaggcgtaga	Protospacer
   .**   ******************. ****..*

74. spacer 1.60|68294|34|NZ_LNVK01000010|PILER-CR matches to NZ_CP039905 (Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623a, complete sequence) position: , mismatch: 9, identity: 0.735 

tccaag---tcgggatggtccgcggcgccggcgcggc	CRISPR spacer
---gaggcttcgggatggtccgcggcgtaggcgtaga	Protospacer
   .**   ******************. ****..*

75. spacer 1.60|68294|34|NZ_LNVK01000010|PILER-CR matches to NZ_CP039909 (Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence) position: , mismatch: 9, identity: 0.735 

tccaag---tcgggatggtccgcggcgccggcgcggc	CRISPR spacer
---gaggcttcgggatggtccgcggcgtaggcgtaga	Protospacer
   .**   ******************. ****..*

76. spacer 1.73|64870|34|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.735 

ctcggccgccggcccgtcttgcgttggccttggt	CRISPR spacer
ctgccgcgccgaccggtcttgcgttggcctccgg	Protospacer
**    *****.** ***************. *

77. spacer 1.83|65535|34|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.735 

ttgtccatcgcgcaggcgcgcttaatgaccacgc	CRISPR spacer
gtgtccatcgcccaggcgcgcgtaaacagtatcc	Protospacer
 ********** ********* ***  * .*. *

78. spacer 1.83|65535|34|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.735 

ttgtccatcgcgcaggcgcgcttaatgaccacgc	CRISPR spacer
gtgtccatcgcccaggcgcgcgtaaacagtatcc	Protospacer
 ********** ********* ***  * .*. *

79. spacer 1.85|65665|34|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 9, identity: 0.735 

tactactg----ccgggccgaggcactggtggcggcga	CRISPR spacer
----gcggtgaccctggccgaggcactggtggcggccg	Protospacer
    .* *    ** ********************* .

80. spacer 1.108|67184|35|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.743 

aagcgcgacagcagcaaggccgggaacctgcagct	CRISPR spacer
tcgcgcgacggcagcaaggccggcaacatcgtgcg	Protospacer
  *******.************* *** *   **

81. spacer 1.109|67250|35|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.743 

cgcagtc-tctggccggagattgagctgaaccgctc	CRISPR spacer
-gcgaccgaacggccgaagattgcgctgaaccgctc	Protospacer
 **...*   .*****.****** ************

82. spacer 1.111|67382|34|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NZ_CP016462 (Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence) position: , mismatch: 9, identity: 0.735 

tcggatgtggcaagagcggcgtcgtccagatccg	CRISPR spacer
atggcccgggcaagatcggcctcgtccagatcgg	Protospacer
 .** .  ******* **** *********** *

83. spacer 1.114|67578|33|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to KX752698 (Mycobacterium phage Tonenili, complete genome) position: , mismatch: 9, identity: 0.727 

acggtgatccgatgctgggcgatgtctgggatg	CRISPR spacer
ccggtgacccgctgctgggcgatgtcgatgcca	Protospacer
 ******.*** ************** . * ..

84. spacer 1.124|68234|35|NZ_LNVK01000010|CRT matches to MN234185 (Mycobacterium phage Lemuria, complete genome) position: , mismatch: 9, identity: 0.743 

ctccaagtcgggatggtccgcggcgccggcgcggc	CRISPR spacer
gtcattctcgggaagggccgcggcgccggcgctcc	Protospacer
 **    ****** ** ***************  *

85. spacer 1.9|64879|34|NZ_LNVK01000010|PILER-CR matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706 

ctcggccgccggcccgtcttgcgttggccttggt	CRISPR spacer
accggccgccggcccgtcttgcgtcgggacgaag	Protospacer
 .**********************.**  . ..

86. spacer 1.14|65215|35|NZ_LNVK01000010|PILER-CR matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 10, identity: 0.714 

gtggtatgcggccccgcccagctccgcgagcagca	CRISPR spacer
gatgcccaacgccccgcccagcaccgcgaccagca	Protospacer
*  *. ..  ************ ****** *****

87. spacer 1.14|65215|35|NZ_LNVK01000010|PILER-CR matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.714 

gtggtatgcggccccgcccagctccgcgagcagca	CRISPR spacer
accgagcgcggccccgcccagcgccgccagcacaa	Protospacer
.. * ..*************** **** ****  *

88. spacer 1.29|66221|34|NZ_LNVK01000010|PILER-CR matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706 

attcaacacctgcatcaccagcccgccctactac	CRISPR spacer
catgaacgccttcatcaccagcccgcccgagggt	Protospacer
  * ***.*** **************** *  ..

89. spacer 1.29|66221|34|NZ_LNVK01000010|PILER-CR matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706 

attcaacacctgcatcaccagcccgccctactac	CRISPR spacer
catgaacgccttcatcaccagcccgcccgagggt	Protospacer
  * ***.*** **************** *  ..

90. spacer 1.41|67024|35|NZ_LNVK01000010|PILER-CR matches to NZ_CP017242 (Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence) position: , mismatch: 10, identity: 0.714 

caaaatttcattacgatggacgacatcgtcaccga	CRISPR spacer
ccgcacggatttacgatggacgacatggtcaacga	Protospacer
* . *.    **************** **** ***

91. spacer 1.42|67091|37|NZ_LNVK01000010|PILER-CR matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.73 

acctgcttgcggcgcagttcggcggcctgcaggtcca	CRISPR spacer
accatgccgcggcgcaggtcggcgccctgcaggttgg	Protospacer
***   ..********* ****** *********. .

92. spacer 1.48|67495|36|NZ_LNVK01000010|PILER-CR matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 10, identity: 0.722 

cgggacgcggcgctgggtgtcgtggacgccgcgcgc	CRISPR spacer
gtggacgcggcgctgggcgtcgtggtcgtcaagatg	Protospacer
  ***************.******* **.*. *

93. spacer 1.60|68294|34|NZ_LNVK01000010|PILER-CR matches to MT024859 (Gordonia phage DumpsterDude, complete genome) position: , mismatch: 10, identity: 0.706 

tccaagtcgggatggtccgcggcgccggcgcggc	CRISPR spacer
gtgcgatcggcatggtgcgcggcgccggcgggcc	Protospacer
 .  ..**** ***** ************* * *

94. spacer 1.73|64870|34|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706 

ctcggccgccggcccgtcttgcgttggccttggt	CRISPR spacer
accggccgccggcccgtcttgcgtcgggacgaag	Protospacer
 .**********************.**  . ..

95. spacer 1.78|65201|35|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 10, identity: 0.714 

gtggtatgcggccccgcccagctccgcgagcagca	CRISPR spacer
gatgcccaacgccccgcccagcaccgcgaccagca	Protospacer
*  *. ..  ************ ****** *****

96. spacer 1.78|65201|35|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.714 

gtggtatgcggccccgcccagctccgcgagcagca	CRISPR spacer
accgagcgcggccccgcccagcgccgccagcacaa	Protospacer
.. * ..*************** **** ****  *

97. spacer 1.93|66192|34|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706 

attcaacacctgcatcaccagcccgccctactac	CRISPR spacer
catgaacgccttcatcaccagcccgcccgagggt	Protospacer
  * ***.*** **************** *  ..

98. spacer 1.93|66192|34|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706 

attcaacacctgcatcaccagcccgccctactac	CRISPR spacer
catgaacgccttcatcaccagcccgcccgagggt	Protospacer
  * ***.*** **************** *  ..

99. spacer 1.105|66983|35|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NZ_CP017242 (Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence) position: , mismatch: 10, identity: 0.714 

caaaatttcattacgatggacgacatcgtcaccga	CRISPR spacer
ccgcacggatttacgatggacgacatggtcaacga	Protospacer
* . *.    **************** **** ***

100. spacer 1.106|67049|37|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.73 

acctgcttgcggcgcagttcggcggcctgcaggtcca	CRISPR spacer
accatgccgcggcgcaggtcggcgccctgcaggttgg	Protospacer
***   ..********* ****** *********. .

101. spacer 1.112|67447|36|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 10, identity: 0.722 

cgggacgcggcgctgggtgtcgtggacgccgcgcgc	CRISPR spacer
gtggacgcggcgctgggcgtcgtggtcgtcaagatg	Protospacer
  ***************.******* **.*. *

102. spacer 1.124|68234|35|NZ_LNVK01000010|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 10, identity: 0.714 

ctccaagtcgggatggtccgcggcgccggcgcggc	CRISPR spacer
gtcagcgtcggggtcgtccgcggcgccggcgactt	Protospacer
 ** . ******.* ****************   .

103. spacer 1.7|64747|34|NZ_LNVK01000010|PILER-CR matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 11, identity: 0.676 

accttctggacccgggccagcacgttgtgccggc	CRISPR spacer
tagatctggacccgggtcagcaccttgtccttcg	Protospacer
    ************.****** **** *.

104. spacer 1.21|65686|34|NZ_LNVK01000010|PILER-CR matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 11, identity: 0.676 

----tactactgccgggccgaggcactggtggcggcga	CRISPR spacer
gaggtggcg----cgggccgaggcgcaggtggcggcgg	Protospacer
    *. ..    ***********.* **********.

105. spacer 1.21|65686|34|NZ_LNVK01000010|PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676 

tactactgccgggccgaggcactggtggcggcga	CRISPR spacer
agcgcgaaccgggccgaggcactggcgtcggctg	Protospacer
 .*    .*****************.* **** .

106. spacer 1.29|66221|34|NZ_LNVK01000010|PILER-CR matches to MF360958 (Salicola phage SCTP-2, complete genome) position: , mismatch: 11, identity: 0.676 

attcaacacctgcatcaccagcccgccctactac	CRISPR spacer
attcaacaccttcatcaccaccccatataagcca	Protospacer
*********** ******** ***.. . * .

107. spacer 1.29|66221|34|NZ_LNVK01000010|PILER-CR matches to MK388689 (Pantoea phage vB_PagM_LIET2, complete genome) position: , mismatch: 11, identity: 0.676 

attcaacacctgcatcaccagcccgccctactac	CRISPR spacer
ctgtccgtgctgcatcaccagcccgccccagtat	Protospacer
 * .     *******************.* **.

108. spacer 1.44|67228|35|NZ_LNVK01000010|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.686 

aagcgcgacagcagcaaggccgggaacctgcagct	CRISPR spacer
ctgaccgacatcagcaaggcctggaacctgggcac	Protospacer
  *  ***** ********** ******** .  .

109. spacer 1.52|67760|34|NZ_LNVK01000010|PILER-CR matches to MG518519 (Streptomyces phage Manuel, complete genome) position: , mismatch: 11, identity: 0.676 

ggtgatcatcctcgacgagtgctacaccgttttc	CRISPR spacer
tcctatcatcatcgacgggtgctacacccgtcgt	Protospacer
  . ****** ******.**********  *. .

110. spacer 1.60|68294|34|NZ_LNVK01000010|PILER-CR matches to NC_048019 (Gordonia phage Ruthy, complete genome) position: , mismatch: 11, identity: 0.676 

tccaagtcgggatggtccgcggcgccggcgcggc	CRISPR spacer
gtgcgatcggcatggtgcgcggcgccggcggtcc	Protospacer
 .  ..**** ***** *************   *

111. spacer 1.71|64740|34|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 11, identity: 0.676 

accttctggacccgggccagcacgttgtgccggc	CRISPR spacer
tagatctggacccgggtcagcaccttgtccttcg	Protospacer
    ************.****** **** *.

112. spacer 1.85|65665|34|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 11, identity: 0.676 

----tactactgccgggccgaggcactggtggcggcga	CRISPR spacer
gaggtggcg----cgggccgaggcgcaggtggcggcgg	Protospacer
    *. ..    ***********.* **********.

113. spacer 1.85|65665|34|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676 

tactactgccgggccgaggcactggtggcggcga	CRISPR spacer
agcgcgaaccgggccgaggcactggcgtcggctg	Protospacer
 .*    .*****************.* **** .

114. spacer 1.93|66192|34|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to MF360958 (Salicola phage SCTP-2, complete genome) position: , mismatch: 11, identity: 0.676 

attcaacacctgcatcaccagcccgccctactac	CRISPR spacer
attcaacaccttcatcaccaccccatataagcca	Protospacer
*********** ******** ***.. . * .

115. spacer 1.93|66192|34|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to MK388689 (Pantoea phage vB_PagM_LIET2, complete genome) position: , mismatch: 11, identity: 0.676 

attcaacacctgcatcaccagcccgccctactac	CRISPR spacer
ctgtccgtgctgcatcaccagcccgccccagtat	Protospacer
 * .     *******************.* **.

116. spacer 1.108|67184|35|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.686 

aagcgcgacagcagcaaggccgggaacctgcagct	CRISPR spacer
ctgaccgacatcagcaaggcctggaacctgggcac	Protospacer
  *  ***** ********** ******** .  .

117. spacer 1.116|67708|34|NZ_LNVK01000010|CRISPRCasFinder,CRT matches to MG518519 (Streptomyces phage Manuel, complete genome) position: , mismatch: 11, identity: 0.676 

ggtgatcatcctcgacgagtgctacaccgttttc	CRISPR spacer
tcctatcatcatcgacgggtgctacacccgtcgt	Protospacer
  . ****** ******.**********  *. .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_LNVK01000005
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNVK01000005_1 75881-76024 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage