Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LNVL01000118 Xanthomonas translucens strain CS22 flattened_line_234, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000065 Xanthomonas translucens strain CS22 flattened_line_128, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000072 Xanthomonas translucens strain CS22 flattened_line_144, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000088 Xanthomonas translucens strain CS22 flattened_line_175, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000101 Xanthomonas translucens strain CS22 flattened_line_200, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000081 Xanthomonas translucens strain CS22 flattened_line_162, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000080 Xanthomonas translucens strain CS22 flattened_line_160, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000070 Xanthomonas translucens strain CS22 flattened_line_140, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000074 Xanthomonas translucens strain CS22 flattened_line_148, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000041 Xanthomonas translucens strain CS22 flattened_line_80, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000047 Xanthomonas translucens strain CS22 flattened_line_92, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000084 Xanthomonas translucens strain CS22 flattened_line_167, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000010 Xanthomonas translucens strain CS22 flattened_line_18, whole genome shotgun sequence 0 crisprs DEDDh,csa3 0 0 0 0
NZ_LNVL01000048 Xanthomonas translucens strain CS22 flattened_line_94, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000028 Xanthomonas translucens strain CS22 flattened_line_54, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000056 Xanthomonas translucens strain CS22 flattened_line_110, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000017 Xanthomonas translucens strain CS22 flattened_line_32, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_LNVL01000098 Xanthomonas translucens strain CS22 flattened_line_194, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000083 Xanthomonas translucens strain CS22 flattened_line_165, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000069 Xanthomonas translucens strain CS22 flattened_line_138, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000113 Xanthomonas translucens strain CS22 flattened_line_224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000115 Xanthomonas translucens strain CS22 flattened_line_228, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000110 Xanthomonas translucens strain CS22 flattened_line_218, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000049 Xanthomonas translucens strain CS22 flattened_line_96, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000109 Xanthomonas translucens strain CS22 flattened_line_216, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000117 Xanthomonas translucens strain CS22 flattened_line_232, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000012 Xanthomonas translucens strain CS22 flattened_line_22, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000038 Xanthomonas translucens strain CS22 flattened_line_74, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000107 Xanthomonas translucens strain CS22 flattened_line_212, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000096 Xanthomonas translucens strain CS22 flattened_line_190, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000079 Xanthomonas translucens strain CS22 flattened_line_158, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000005 Xanthomonas translucens strain CS22 flattened_line_8, whole genome shotgun sequence 0 crisprs Cas9_archaeal,cas3,csa3 0 0 0 0
NZ_LNVL01000104 Xanthomonas translucens strain CS22 flattened_line_206, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000108 Xanthomonas translucens strain CS22 flattened_line_214, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000009 Xanthomonas translucens strain CS22 flattened_line_16, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_LNVL01000105 Xanthomonas translucens strain CS22 flattened_line_208, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000040 Xanthomonas translucens strain CS22 flattened_line_78, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000116 Xanthomonas translucens strain CS22 flattened_line_230, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000045 Xanthomonas translucens strain CS22 flattened_line_88, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000035 Xanthomonas translucens strain CS22 flattened_line_68, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000007 Xanthomonas translucens strain CS22 flattened_line_12, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000002 Xanthomonas translucens strain CS22 flattened_line_2, whole genome shotgun sequence 1 crisprs NA 0 0 1 0
NZ_LNVL01000046 Xanthomonas translucens strain CS22 flattened_line_90, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000052 Xanthomonas translucens strain CS22 flattened_line_102, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000114 Xanthomonas translucens strain CS22 flattened_line_226, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000014 Xanthomonas translucens strain CS22 flattened_line_26, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_LNVL01000063 Xanthomonas translucens strain CS22 flattened_line_124, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000050 Xanthomonas translucens strain CS22 flattened_line_98, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000001 Xanthomonas translucens strain CS22 flattened_line_0, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000085 Xanthomonas translucens strain CS22 flattened_line_169, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000066 Xanthomonas translucens strain CS22 flattened_line_130, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000026 Xanthomonas translucens strain CS22 flattened_line_50, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000033 Xanthomonas translucens strain CS22 flattened_line_64, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000019 Xanthomonas translucens strain CS22 flattened_line_36, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_LNVL01000090 Xanthomonas translucens strain CS22 flattened_line_179, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000112 Xanthomonas translucens strain CS22 flattened_line_222, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000097 Xanthomonas translucens strain CS22 flattened_line_192, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000027 Xanthomonas translucens strain CS22 flattened_line_52, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000103 Xanthomonas translucens strain CS22 flattened_line_204, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000061 Xanthomonas translucens strain CS22 flattened_line_120, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000055 Xanthomonas translucens strain CS22 flattened_line_108, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000077 Xanthomonas translucens strain CS22 flattened_line_154, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000042 Xanthomonas translucens strain CS22 flattened_line_82, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000031 Xanthomonas translucens strain CS22 flattened_line_60, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000022 Xanthomonas translucens strain CS22 flattened_line_42, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000032 Xanthomonas translucens strain CS22 flattened_line_62, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000057 Xanthomonas translucens strain CS22 flattened_line_112, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000086 Xanthomonas translucens strain CS22 flattened_line_171, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000059 Xanthomonas translucens strain CS22 flattened_line_116, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000013 Xanthomonas translucens strain CS22 flattened_line_24, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000068 Xanthomonas translucens strain CS22 flattened_line_134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000058 Xanthomonas translucens strain CS22 flattened_line_114, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000044 Xanthomonas translucens strain CS22 flattened_line_86, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000043 Xanthomonas translucens strain CS22 flattened_line_84, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000064 Xanthomonas translucens strain CS22 flattened_line_126, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000025 Xanthomonas translucens strain CS22 flattened_line_48, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_LNVL01000082 Xanthomonas translucens strain CS22 flattened_line_164, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000111 Xanthomonas translucens strain CS22 flattened_line_220, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000024 Xanthomonas translucens strain CS22 flattened_line_46, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000036 Xanthomonas translucens strain CS22 flattened_line_70, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000016 Xanthomonas translucens strain CS22 flattened_line_30, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000094 Xanthomonas translucens strain CS22 flattened_line_186, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000102 Xanthomonas translucens strain CS22 flattened_line_202, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000060 Xanthomonas translucens strain CS22 flattened_line_118, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000034 Xanthomonas translucens strain CS22 flattened_line_66, whole genome shotgun sequence 1 crisprs cas3 0 0 0 0
NZ_LNVL01000018 Xanthomonas translucens strain CS22 flattened_line_34, whole genome shotgun sequence 2 crisprs NA 1 6 0 0
NZ_LNVL01000092 Xanthomonas translucens strain CS22 flattened_line_183, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000039 Xanthomonas translucens strain CS22 flattened_line_76, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_LNVL01000003 Xanthomonas translucens strain CS22 flattened_line_4, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000004 Xanthomonas translucens strain CS22 flattened_line_6, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_LNVL01000087 Xanthomonas translucens strain CS22 flattened_line_173, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000091 Xanthomonas translucens strain CS22 flattened_line_181, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000076 Xanthomonas translucens strain CS22 flattened_line_152, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000054 Xanthomonas translucens strain CS22 flattened_line_106, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000051 Xanthomonas translucens strain CS22 flattened_line_100, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000067 Xanthomonas translucens strain CS22 flattened_line_132, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000030 Xanthomonas translucens strain CS22 flattened_line_58, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000106 Xanthomonas translucens strain CS22 flattened_line_210, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000093 Xanthomonas translucens strain CS22 flattened_line_185, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000029 Xanthomonas translucens strain CS22 flattened_line_56, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000008 Xanthomonas translucens strain CS22 flattened_line_14, whole genome shotgun sequence 0 crisprs DEDDh 0 0 1 2
NZ_LNVL01000073 Xanthomonas translucens strain CS22 flattened_line_146, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000062 Xanthomonas translucens strain CS22 flattened_line_122, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000075 Xanthomonas translucens strain CS22 flattened_line_150, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000089 Xanthomonas translucens strain CS22 flattened_line_177, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000099 Xanthomonas translucens strain CS22 flattened_line_196, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000020 Xanthomonas translucens strain CS22 flattened_line_38, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000078 Xanthomonas translucens strain CS22 flattened_line_156, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000100 Xanthomonas translucens strain CS22 flattened_line_198, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000021 Xanthomonas translucens strain CS22 flattened_line_40, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000071 Xanthomonas translucens strain CS22 flattened_line_142, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000023 Xanthomonas translucens strain CS22 flattened_line_44, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000011 Xanthomonas translucens strain CS22 flattened_line_20, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_LNVL01000037 Xanthomonas translucens strain CS22 flattened_line_72, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_LNVL01000015 Xanthomonas translucens strain CS22 flattened_line_28, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000006 Xanthomonas translucens strain CS22 flattened_line_10, whole genome shotgun sequence 1 crisprs cas2,cas1,cas4,cas7,cas8c,cas5,cas3 9 46 0 0
NZ_LNVL01000095 Xanthomonas translucens strain CS22 flattened_line_188, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVL01000053 Xanthomonas translucens strain CS22 flattened_line_104, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_LNVL01000009
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNVL01000009_1 49640-49783 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_LNVL01000002
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNVL01000002_1 385420-385531 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 308385 : 314730 6 Escherichia_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_LNVL01000008
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 61132 : 91494 40 Siphoviridae_environmental_samples(34.78%) integrase,tail,terminase attL 67205:67224|attR 93040:93059
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_LNVL01000008.1|WP_058195519.1|89642_89927_-|hypothetical-protein 89642_89927_- 94 aa aa AcrIC10 NA NA 61132-91494 yes
NZ_LNVL01000008.1|WP_058195493.1|62845_63358_+|hypothetical-protein 62845_63358_+ 170 aa aa NA NA NA 61132-91494 yes
4. NZ_LNVL01000018
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNVL01000018_1 12038-12133 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNVL01000018_2 12230-12660 Orphan NA
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_LNVL01000018_2 2.7|12565|25|NZ_LNVL01000018|CRISPRCasFinder 12565-12589 25 NZ_LNVL01000018.1 10885-10909 2 0.92

1. spacer 2.7|12565|25|NZ_LNVL01000018|CRISPRCasFinder matches to position: 10885-10909, mismatch: 2, identity: 0.92

gctgaccgccggcgacgacagtacg	CRISPR spacer
gctgaccgccggctacggcagtacg	Protospacer
************* ***.*******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LNVL01000018_2 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder 12469-12493 25 MT889372 Microbacterium phage Avocadoman, complete genome 23120-23144 3 0.88
NZ_LNVL01000018_2 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder 12469-12493 25 MT639649 Microbacterium phage Burritobowl, complete genome 23512-23536 3 0.88
NZ_LNVL01000018_2 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder 12469-12493 25 MN062714 Microbacterium Phage DirtyBubble, complete genome 24364-24388 3 0.88
NZ_LNVL01000018_2 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder 12469-12493 25 MT889389 Microbacterium phage DickRichards, complete genome 23841-23865 3 0.88
NZ_LNVL01000018_2 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder 12469-12493 25 MT024860 Microbacterium phage Stromboli, complete genome 24734-24758 3 0.88
NZ_LNVL01000018_2 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder 12469-12493 25 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 281166-281190 3 0.88
NZ_LNVL01000018_2 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder 12469-12493 25 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 766061-766085 3 0.88
NZ_LNVL01000018_2 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder 12469-12493 25 NC_010997 Rhizobium etli CIAT 652 plasmid pC, complete sequence 194425-194449 3 0.88
NZ_LNVL01000018_2 2.8|12613|25|NZ_LNVL01000018|CRISPRCasFinder 12613-12637 25 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 328038-328062 3 0.88
NZ_LNVL01000018_2 2.8|12613|25|NZ_LNVL01000018|CRISPRCasFinder 12613-12637 25 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1960062-1960086 3 0.88
NZ_LNVL01000018_2 2.8|12613|25|NZ_LNVL01000018|CRISPRCasFinder 12613-12637 25 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1125643-1125667 3 0.88
NZ_LNVL01000018_2 2.3|12373|25|NZ_LNVL01000018|CRISPRCasFinder 12373-12397 25 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 351846-351870 4 0.84
NZ_LNVL01000018_2 2.4|12421|25|NZ_LNVL01000018|CRISPRCasFinder 12421-12445 25 MK757446 Mycobacterium phage Candle, complete genome 9162-9186 4 0.84
NZ_LNVL01000018_2 2.4|12421|25|NZ_LNVL01000018|CRISPRCasFinder 12421-12445 25 KY969628 Mycobacterium phage Zenon, complete genome 9164-9188 4 0.84
NZ_LNVL01000018_2 2.4|12421|25|NZ_LNVL01000018|CRISPRCasFinder 12421-12445 25 MH926059 Mycobacterium phage Riparian, complete genome 8620-8644 4 0.84
NZ_LNVL01000018_2 2.4|12421|25|NZ_LNVL01000018|CRISPRCasFinder 12421-12445 25 JF704112 Mycobacterium phage Send513, complete sequence 9162-9186 4 0.84
NZ_LNVL01000018_2 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder 12469-12493 25 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 884327-884351 4 0.84
NZ_LNVL01000018_2 2.6|12517|25|NZ_LNVL01000018|CRISPRCasFinder 12517-12541 25 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 1379972-1379996 4 0.84
NZ_LNVL01000018_2 2.6|12517|25|NZ_LNVL01000018|CRISPRCasFinder 12517-12541 25 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 1379950-1379974 4 0.84
NZ_LNVL01000018_2 2.7|12565|25|NZ_LNVL01000018|CRISPRCasFinder 12565-12589 25 NZ_CP010990 Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence 60660-60684 4 0.84
NZ_LNVL01000018_2 2.8|12613|25|NZ_LNVL01000018|CRISPRCasFinder 12613-12637 25 NZ_CP045549 Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence 19015-19039 4 0.84
NZ_LNVL01000018_2 2.3|12373|25|NZ_LNVL01000018|CRISPRCasFinder 12373-12397 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5288431-5288455 5 0.8
NZ_LNVL01000018_2 2.3|12373|25|NZ_LNVL01000018|CRISPRCasFinder 12373-12397 25 NZ_CP021658 Aeromonas salmonicida strain O23A plasmid pO23AP4, complete sequence 15910-15934 5 0.8
NZ_LNVL01000018_2 2.3|12373|25|NZ_LNVL01000018|CRISPRCasFinder 12373-12397 25 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 68354-68378 5 0.8
NZ_LNVL01000018_2 2.3|12373|25|NZ_LNVL01000018|CRISPRCasFinder 12373-12397 25 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 528593-528617 5 0.8
NZ_LNVL01000018_2 2.3|12373|25|NZ_LNVL01000018|CRISPRCasFinder 12373-12397 25 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 409238-409262 5 0.8
NZ_LNVL01000018_2 2.3|12373|25|NZ_LNVL01000018|CRISPRCasFinder 12373-12397 25 MN444870 Gordonia phage Syleon, complete genome 28799-28823 5 0.8
NZ_LNVL01000018_2 2.3|12373|25|NZ_LNVL01000018|CRISPRCasFinder 12373-12397 25 MH976515 Gordonia phage Octobien14, complete genome 29393-29417 5 0.8
NZ_LNVL01000018_2 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder 12469-12493 25 MH727545 Mycobacterium phage DismalStressor, complete genome 39161-39185 5 0.8
NZ_LNVL01000018_2 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder 12469-12493 25 NC_026598 Mycobacterium phage Milly, complete genome 39134-39158 5 0.8
NZ_LNVL01000018_2 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder 12469-12493 25 MH834601 Mycobacterium phage BoostSeason, complete genome 38730-38754 5 0.8
NZ_LNVL01000018_2 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder 12469-12493 25 KX688047 Mycobacterium phage Marcoliusprime, complete genome 39161-39185 5 0.8
NZ_LNVL01000018_2 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder 12469-12493 25 NC_028759 Mycobacterium phage Mufasa, complete genome 38715-38739 5 0.8
NZ_LNVL01000018_2 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder 12469-12493 25 MF140408 Mycobacterium phage DismalFunk, complete genome 39161-39185 5 0.8
NZ_LNVL01000018_2 2.3|12373|25|NZ_LNVL01000018|CRISPRCasFinder 12373-12397 25 NC_019408 Caulobacter phage CcrRogue, complete genome 64287-64311 6 0.76
NZ_LNVL01000018_2 2.3|12373|25|NZ_LNVL01000018|CRISPRCasFinder 12373-12397 25 MT684599 Gordonia Phage Sephiroth, complete genome 28877-28901 6 0.76
NZ_LNVL01000018_2 2.7|12565|25|NZ_LNVL01000018|CRISPRCasFinder 12565-12589 25 NZ_CP022581 Gordonia rubripertincta strain CWB2 plasmid pGCWB2, complete sequence 8354-8378 6 0.76

1. spacer 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder matches to MT889372 (Microbacterium phage Avocadoman, complete genome) position: , mismatch: 3, identity: 0.88

gctgatcgcgggcgccgacagcacc	CRISPR spacer
tctgatcgagggcgccgacggcacc	Protospacer
 ******* **********.*****

2. spacer 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder matches to MT639649 (Microbacterium phage Burritobowl, complete genome) position: , mismatch: 3, identity: 0.88

gctgatcgcgggcgccgacagcacc	CRISPR spacer
tctgatcgagggcgccgacggcacc	Protospacer
 ******* **********.*****

3. spacer 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder matches to MN062714 (Microbacterium Phage DirtyBubble, complete genome) position: , mismatch: 3, identity: 0.88

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cctgatcgagggcgccgacggcacc	Protospacer
 ******* **********.*****

4. spacer 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder matches to MT889389 (Microbacterium phage DickRichards, complete genome) position: , mismatch: 3, identity: 0.88

gctgatcgcgggcgccgacagcacc	CRISPR spacer
tctgatcgagggcgccgacggcacc	Protospacer
 ******* **********.*****

5. spacer 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder matches to MT024860 (Microbacterium phage Stromboli, complete genome) position: , mismatch: 3, identity: 0.88

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cctgatcgagggcgccgacggcacc	Protospacer
 ******* **********.*****

6. spacer 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.88

gctgatcgcgggcgccgacagcacc	CRISPR spacer
gatgatcacgggcgccgacagcaac	Protospacer
* *****.*************** *

7. spacer 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 3, identity: 0.88

gctgatcgcgggcgccgacagcacc	CRISPR spacer
gatgatcacgggcgccgacagcaac	Protospacer
* *****.*************** *

8. spacer 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 3, identity: 0.88

gctgatcgcgggcgccgacagcacc	CRISPR spacer
gttgctcgcgggcgccgaaagcacc	Protospacer
*.** ************* ******

9. spacer 2.8|12613|25|NZ_LNVL01000018|CRISPRCasFinder matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.88

gctgaccgccggcaagaacagcgtg	CRISPR spacer
cctgaacgccggcaagtacagcgtg	Protospacer
 **** ********** ********

10. spacer 2.8|12613|25|NZ_LNVL01000018|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 3, identity: 0.88

gctgaccgccggcaagaacagcgtg	CRISPR spacer
ggtgaccgccgccaagaacggcgtg	Protospacer
* ********* *******.*****

11. spacer 2.8|12613|25|NZ_LNVL01000018|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88

gctgaccgccggcaagaacagcgtg	CRISPR spacer
ggtgaccgccgccaagaacggcgtg	Protospacer
* ********* *******.*****

12. spacer 2.3|12373|25|NZ_LNVL01000018|CRISPRCasFinder matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 4, identity: 0.84

gctgatcgcgggcaagggcagtttc	CRISPR spacer
gctgatggcgggcaagggcagtcag	Protospacer
****** ***************.  

13. spacer 2.4|12421|25|NZ_LNVL01000018|CRISPRCasFinder matches to MK757446 (Mycobacterium phage Candle, complete genome) position: , mismatch: 4, identity: 0.84

gctcattggcggtgccgccagcgtg	CRISPR spacer
gcacattggcggtgcccccagcggc	Protospacer
** ************* ******  

14. spacer 2.4|12421|25|NZ_LNVL01000018|CRISPRCasFinder matches to KY969628 (Mycobacterium phage Zenon, complete genome) position: , mismatch: 4, identity: 0.84

gctcattggcggtgccgccagcgtg	CRISPR spacer
gcacattggcggtgcccccagcggc	Protospacer
** ************* ******  

15. spacer 2.4|12421|25|NZ_LNVL01000018|CRISPRCasFinder matches to MH926059 (Mycobacterium phage Riparian, complete genome) position: , mismatch: 4, identity: 0.84

gctcattggcggtgccgccagcgtg	CRISPR spacer
gcacattggcggtgcccccagcggc	Protospacer
** ************* ******  

16. spacer 2.4|12421|25|NZ_LNVL01000018|CRISPRCasFinder matches to JF704112 (Mycobacterium phage Send513, complete sequence) position: , mismatch: 4, identity: 0.84

gctcattggcggtgccgccagcgtg	CRISPR spacer
gcacattggcggtgcccccagcggc	Protospacer
** ************* ******  

17. spacer 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.84

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cgtgatcgcggtcgccgacagcagc	Protospacer
  ********* *********** *

18. spacer 2.6|12517|25|NZ_LNVL01000018|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 4, identity: 0.84

actgttggccggacgcaacagctat	CRISPR spacer
ggtgttgcgcggacgcaacagctat	Protospacer
. *****  ****************

19. spacer 2.6|12517|25|NZ_LNVL01000018|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 4, identity: 0.84

actgttggccggacgcaacagctat	CRISPR spacer
ggtgttgcgcggacgcaacagctat	Protospacer
. *****  ****************

20. spacer 2.7|12565|25|NZ_LNVL01000018|CRISPRCasFinder matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 4, identity: 0.84

gctgaccgccggcgacgacagtacg	CRISPR spacer
gctgcccgccggcgacgaccgtaaa	Protospacer
**** ************** *** .

21. spacer 2.8|12613|25|NZ_LNVL01000018|CRISPRCasFinder matches to NZ_CP045549 (Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84

gctgaccgccggcaagaacagcgtg	CRISPR spacer
gctgaccgcgggcaagaacatcgaa	Protospacer
********* ********** ** .

22. spacer 2.3|12373|25|NZ_LNVL01000018|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcaagggcagtttc	CRISPR spacer
ggtgatcgcgggcaagggcagggcg	Protospacer
* *******************  . 

23. spacer 2.3|12373|25|NZ_LNVL01000018|CRISPRCasFinder matches to NZ_CP021658 (Aeromonas salmonicida strain O23A plasmid pO23AP4, complete sequence) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcaagggcagtttc	CRISPR spacer
gctgatctcgggcaagggcagcacg	Protospacer
******* *************. . 

24. spacer 2.3|12373|25|NZ_LNVL01000018|CRISPRCasFinder matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcaagggcagtttc	CRISPR spacer
gctgatggcgggcaagggcagccag	Protospacer
****** **************..  

25. spacer 2.3|12373|25|NZ_LNVL01000018|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcaagggcagtttc	CRISPR spacer
cgtgatcgcgggcaatggcagttct	Protospacer
  ************* *******..

26. spacer 2.3|12373|25|NZ_LNVL01000018|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcaagggcagtttc	CRISPR spacer
ggagatcgcgggcaagggcagtcat	Protospacer
*  *******************. .

27. spacer 2.3|12373|25|NZ_LNVL01000018|CRISPRCasFinder matches to MN444870 (Gordonia phage Syleon, complete genome) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcaagggcagtttc	CRISPR spacer
gctgatcgcgggcaagggctacgcc	Protospacer
******************* .. .*

28. spacer 2.3|12373|25|NZ_LNVL01000018|CRISPRCasFinder matches to MH976515 (Gordonia phage Octobien14, complete genome) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcaagggcagtttc	CRISPR spacer
gctgatcgcgggcaagggctacgcc	Protospacer
******************* .. .*

29. spacer 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder matches to MH727545 (Mycobacterium phage DismalStressor, complete genome) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cgcgatcgcgggcgccgacagcctc	Protospacer
  .******************* .*

30. spacer 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder matches to NC_026598 (Mycobacterium phage Milly, complete genome) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cgcgatcgcgggcgccgacagcctc	Protospacer
  .******************* .*

31. spacer 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder matches to MH834601 (Mycobacterium phage BoostSeason, complete genome) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cgcgatcgcgggcgccgacagcctc	Protospacer
  .******************* .*

32. spacer 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder matches to KX688047 (Mycobacterium phage Marcoliusprime, complete genome) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cgcgatcgcgggcgccgacagcctc	Protospacer
  .******************* .*

33. spacer 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder matches to NC_028759 (Mycobacterium phage Mufasa, complete genome) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cgcgatcgcgggcgccgacagcctc	Protospacer
  .******************* .*

34. spacer 2.5|12469|25|NZ_LNVL01000018|CRISPRCasFinder matches to MF140408 (Mycobacterium phage DismalFunk, complete genome) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cgcgatcgcgggcgccgacagcctc	Protospacer
  .******************* .*

35. spacer 2.3|12373|25|NZ_LNVL01000018|CRISPRCasFinder matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 6, identity: 0.76

gctgatcgcgggcaagggcagtttc	CRISPR spacer
cctgatcgcgggcaagggcaaggaa	Protospacer
 *******************.    

36. spacer 2.3|12373|25|NZ_LNVL01000018|CRISPRCasFinder matches to MT684599 (Gordonia Phage Sephiroth, complete genome) position: , mismatch: 6, identity: 0.76

gctgatcgcgggcaagggcagtttc	CRISPR spacer
gctgatcgcgggcaagggctacgca	Protospacer
******************* .. . 

37. spacer 2.7|12565|25|NZ_LNVL01000018|CRISPRCasFinder matches to NZ_CP022581 (Gordonia rubripertincta strain CWB2 plasmid pGCWB2, complete sequence) position: , mismatch: 6, identity: 0.76

gctgaccgccggcgacgacagtacg	CRISPR spacer
cctgaccgccggcgacgacacgggc	Protospacer
 *******************  .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_LNVL01000034
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNVL01000034_1 45281-45383 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_LNVL01000004
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 11606 : 64111 44 Staphylococcus_phage(28.57%) tRNA,protease,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_LNVL01000006
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNVL01000006_1 80149-84460 TypeI I-C
65 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_LNVL01000006_1 1.1|80180|35|NZ_LNVL01000006|CRISPRCasFinder,CRT 80180-80214 35 NZ_LNVL01000008.1 83221-83255 1 0.971
NZ_LNVL01000006_1 1.2|80246|33|NZ_LNVL01000006|CRISPRCasFinder,CRT 80246-80278 33 NZ_LNVL01000008.1 78396-78428 0 1.0
NZ_LNVL01000006_1 1.6|80509|34|NZ_LNVL01000006|CRT 80509-80542 34 NZ_LNVL01000008.1 58637-58670 0 1.0
NZ_LNVL01000006_1 1.19|81362|34|NZ_LNVL01000006|CRT,CRISPRCasFinder 81362-81395 34 NZ_LNVL01000008.1 62094-62127 0 1.0
NZ_LNVL01000006_1 1.21|81493|35|NZ_LNVL01000006|CRT,CRISPRCasFinder 81493-81527 35 NZ_LNVL01000008.1 64411-64445 0 1.0
NZ_LNVL01000006_1 1.66|80247|33|NZ_LNVL01000006|PILER-CR 80247-80279 33 NZ_LNVL01000008.1 78396-78428 0 1.0
NZ_LNVL01000006_1 1.70|80514|34|NZ_LNVL01000006|PILER-CR 80514-80547 34 NZ_LNVL01000008.1 58637-58670 0 1.0
NZ_LNVL01000006_1 1.83|81379|34|NZ_LNVL01000006|PILER-CR 81379-81412 34 NZ_LNVL01000008.1 62094-62127 0 1.0
NZ_LNVL01000006_1 1.85|81512|35|NZ_LNVL01000006|PILER-CR 81512-81546 35 NZ_LNVL01000008.1 64411-64445 0 1.0

1. spacer 1.1|80180|35|NZ_LNVL01000006|CRISPRCasFinder,CRT matches to position: 83221-83255, mismatch: 1, identity: 0.971

gatgtcgagtggcgccgggacgacatggcatgggt	CRISPR spacer
gatgtcgagtggcgccgggacgacatggcttgggt	Protospacer
***************************** *****

2. spacer 1.2|80246|33|NZ_LNVL01000006|CRISPRCasFinder,CRT matches to position: 78396-78428, mismatch: 0, identity: 1.0

accaccctcgaagttgccggtgacgtagtacgg	CRISPR spacer
accaccctcgaagttgccggtgacgtagtacgg	Protospacer
*********************************

3. spacer 1.6|80509|34|NZ_LNVL01000006|CRT matches to position: 58637-58670, mismatch: 0, identity: 1.0

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gccgcgccggcgccgcggaccatcccgacttgga	Protospacer
**********************************

4. spacer 1.19|81362|34|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to position: 62094-62127, mismatch: 0, identity: 1.0

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgccgctcttgccacatccga	Protospacer
**********************************

5. spacer 1.21|81493|35|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to position: 64411-64445, mismatch: 0, identity: 1.0

gagcggttcagctcaatctccggccagagactgcg	CRISPR spacer
gagcggttcagctcaatctccggccagagactgcg	Protospacer
***********************************

6. spacer 1.66|80247|33|NZ_LNVL01000006|PILER-CR matches to position: 78396-78428, mismatch: 0, identity: 1.0

accaccctcgaagttgccggtgacgtagtacgg	CRISPR spacer
accaccctcgaagttgccggtgacgtagtacgg	Protospacer
*********************************

7. spacer 1.70|80514|34|NZ_LNVL01000006|PILER-CR matches to position: 58637-58670, mismatch: 0, identity: 1.0

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gccgcgccggcgccgcggaccatcccgacttgga	Protospacer
**********************************

8. spacer 1.83|81379|34|NZ_LNVL01000006|PILER-CR matches to position: 62094-62127, mismatch: 0, identity: 1.0

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgccgctcttgccacatccga	Protospacer
**********************************

9. spacer 1.85|81512|35|NZ_LNVL01000006|PILER-CR matches to position: 64411-64445, mismatch: 0, identity: 1.0

gagcggttcagctcaatctccggccagagactgcg	CRISPR spacer
gagcggttcagctcaatctccggccagagactgcg	Protospacer
***********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LNVL01000006_1 1.36|82487|34|NZ_LNVL01000006|CRT,CRISPRCasFinder 82487-82520 34 NC_030937 Xanthomonas phage f30-Xaj, complete genome 27643-27676 1 0.971
NZ_LNVL01000006_1 1.36|82487|34|NZ_LNVL01000006|CRT,CRISPRCasFinder 82487-82520 34 NC_030928 Xanthomonas phage f20-Xaj, complete genome 41357-41390 1 0.971
NZ_LNVL01000006_1 1.100|82521|34|NZ_LNVL01000006|PILER-CR 82521-82554 34 NC_030937 Xanthomonas phage f30-Xaj, complete genome 27643-27676 1 0.971
NZ_LNVL01000006_1 1.100|82521|34|NZ_LNVL01000006|PILER-CR 82521-82554 34 NC_030928 Xanthomonas phage f20-Xaj, complete genome 41357-41390 1 0.971
NZ_LNVL01000006_1 1.49|83341|36|NZ_LNVL01000006|CRT,CRISPRCasFinder 83341-83376 36 NC_030937 Xanthomonas phage f30-Xaj, complete genome 27393-27428 2 0.944
NZ_LNVL01000006_1 1.49|83341|36|NZ_LNVL01000006|CRT,CRISPRCasFinder 83341-83376 36 NC_030928 Xanthomonas phage f20-Xaj, complete genome 41107-41142 2 0.944
NZ_LNVL01000006_1 1.113|83388|36|NZ_LNVL01000006|PILER-CR 83388-83423 36 NC_030937 Xanthomonas phage f30-Xaj, complete genome 27393-27428 2 0.944
NZ_LNVL01000006_1 1.113|83388|36|NZ_LNVL01000006|PILER-CR 83388-83423 36 NC_030928 Xanthomonas phage f20-Xaj, complete genome 41107-41142 2 0.944
NZ_LNVL01000006_1 1.43|82947|34|NZ_LNVL01000006|CRT,CRISPRCasFinder 82947-82980 34 MN478375 Bacteriophage Titan-X, complete genome 2144-2177 3 0.912
NZ_LNVL01000006_1 1.107|82988|34|NZ_LNVL01000006|PILER-CR 82988-83021 34 MN478375 Bacteriophage Titan-X, complete genome 2144-2177 3 0.912
NZ_LNVL01000006_1 1.43|82947|34|NZ_LNVL01000006|CRT,CRISPRCasFinder 82947-82980 34 NC_047762 Xanthomonas phage XAJ24, complete genome 2208-2241 4 0.882
NZ_LNVL01000006_1 1.107|82988|34|NZ_LNVL01000006|PILER-CR 82988-83021 34 NC_047762 Xanthomonas phage XAJ24, complete genome 2208-2241 4 0.882
NZ_LNVL01000006_1 1.9|80708|35|NZ_LNVL01000006|CRT,CRISPRCasFinder 80708-80742 35 NC_020205 Xanthomonas citri phage CP2 DNA, complete genome 6091-6125 5 0.857
NZ_LNVL01000006_1 1.43|82947|34|NZ_LNVL01000006|CRT,CRISPRCasFinder 82947-82980 34 NC_022982 Xylella phage Paz, complete genome 2387-2420 5 0.853
NZ_LNVL01000006_1 1.73|80715|35|NZ_LNVL01000006|PILER-CR 80715-80749 35 NC_020205 Xanthomonas citri phage CP2 DNA, complete genome 6091-6125 5 0.857
NZ_LNVL01000006_1 1.107|82988|34|NZ_LNVL01000006|PILER-CR 82988-83021 34 NC_022982 Xylella phage Paz, complete genome 2387-2420 5 0.853
NZ_LNVL01000006_1 1.20|81427|35|NZ_LNVL01000006|CRT,CRISPRCasFinder 81427-81461 35 NC_023006 Pseudomonas phage PPpW-3 DNA, complete sequence 36701-36735 6 0.829
NZ_LNVL01000006_1 1.84|81445|35|NZ_LNVL01000006|PILER-CR 81445-81479 35 NC_023006 Pseudomonas phage PPpW-3 DNA, complete sequence 36701-36735 6 0.829
NZ_LNVL01000006_1 1.6|80509|34|NZ_LNVL01000006|CRT 80509-80542 34 MN234219 Mycobacterium phage Mercurio, complete genome 14561-14594 7 0.794
NZ_LNVL01000006_1 1.11|80840|34|NZ_LNVL01000006|CRT,CRISPRCasFinder 80840-80873 34 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 359039-359072 7 0.794
NZ_LNVL01000006_1 1.11|80840|34|NZ_LNVL01000006|CRT,CRISPRCasFinder 80840-80873 34 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 376258-376291 7 0.794
NZ_LNVL01000006_1 1.11|80840|34|NZ_LNVL01000006|CRT,CRISPRCasFinder 80840-80873 34 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 199796-199829 7 0.794
NZ_LNVL01000006_1 1.11|80840|34|NZ_LNVL01000006|CRT,CRISPRCasFinder 80840-80873 34 AF394895 Actinophage Q5 replication protein gene, partial cds 638-671 7 0.794
NZ_LNVL01000006_1 1.25|81760|35|NZ_LNVL01000006|CRT,CRISPRCasFinder 81760-81794 35 NZ_CP028969 Aminobacter sp. MSH1 plasmid pUSP1, complete sequence 363031-363065 7 0.8
NZ_LNVL01000006_1 1.25|81760|35|NZ_LNVL01000006|CRT,CRISPRCasFinder 81760-81794 35 NZ_CP026266 Aminobacter sp. MSH1 plasmid pAM01, complete sequence 360217-360251 7 0.8
NZ_LNVL01000006_1 1.70|80514|34|NZ_LNVL01000006|PILER-CR 80514-80547 34 MN234219 Mycobacterium phage Mercurio, complete genome 14561-14594 7 0.794
NZ_LNVL01000006_1 1.75|80849|34|NZ_LNVL01000006|PILER-CR 80849-80882 34 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 359039-359072 7 0.794
NZ_LNVL01000006_1 1.75|80849|34|NZ_LNVL01000006|PILER-CR 80849-80882 34 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 376258-376291 7 0.794
NZ_LNVL01000006_1 1.75|80849|34|NZ_LNVL01000006|PILER-CR 80849-80882 34 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 199796-199829 7 0.794
NZ_LNVL01000006_1 1.75|80849|34|NZ_LNVL01000006|PILER-CR 80849-80882 34 AF394895 Actinophage Q5 replication protein gene, partial cds 638-671 7 0.794
NZ_LNVL01000006_1 1.89|81783|35|NZ_LNVL01000006|PILER-CR 81783-81817 35 NZ_CP028969 Aminobacter sp. MSH1 plasmid pUSP1, complete sequence 363031-363065 7 0.8
NZ_LNVL01000006_1 1.89|81783|35|NZ_LNVL01000006|PILER-CR 81783-81817 35 NZ_CP026266 Aminobacter sp. MSH1 plasmid pAM01, complete sequence 360217-360251 7 0.8
NZ_LNVL01000006_1 1.6|80509|34|NZ_LNVL01000006|CRT 80509-80542 34 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 35823-35856 8 0.765
NZ_LNVL01000006_1 1.6|80509|34|NZ_LNVL01000006|CRT 80509-80542 34 MN234185 Mycobacterium phage Lemuria, complete genome 13917-13950 8 0.765
NZ_LNVL01000006_1 1.18|81295|36|NZ_LNVL01000006|CRT,CRISPRCasFinder 81295-81330 36 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 726279-726314 8 0.778
NZ_LNVL01000006_1 1.19|81362|34|NZ_LNVL01000006|CRT,CRISPRCasFinder 81362-81395 34 NZ_CP050105 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence 189496-189529 8 0.765
NZ_LNVL01000006_1 1.19|81362|34|NZ_LNVL01000006|CRT,CRISPRCasFinder 81362-81395 34 NZ_CP050110 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence 189498-189531 8 0.765
NZ_LNVL01000006_1 1.19|81362|34|NZ_LNVL01000006|CRT,CRISPRCasFinder 81362-81395 34 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 76281-76314 8 0.765
NZ_LNVL01000006_1 1.22|81559|35|NZ_LNVL01000006|CRT,CRISPRCasFinder 81559-81593 35 KX911187 Rathayibacter phage NCPPB3778, complete genome 7785-7819 8 0.771
NZ_LNVL01000006_1 1.27|81893|35|NZ_LNVL01000006|CRT,CRISPRCasFinder 81893-81927 35 MG757155 Gordonia phage Boneham, complete genome 26715-26749 8 0.771
NZ_LNVL01000006_1 1.27|81893|35|NZ_LNVL01000006|CRT,CRISPRCasFinder 81893-81927 35 NC_048820 Gordonia phage Jellybones, complete genome 26735-26769 8 0.771
NZ_LNVL01000006_1 1.27|81893|35|NZ_LNVL01000006|CRT,CRISPRCasFinder 81893-81927 35 MK433263 Gordonia phage FelixAlejandro, complete genome 26913-26947 8 0.771
NZ_LNVL01000006_1 1.27|81893|35|NZ_LNVL01000006|CRT,CRISPRCasFinder 81893-81927 35 MK359302 Gordonia phage Sombrero, complete genome 26744-26778 8 0.771
NZ_LNVL01000006_1 1.27|81893|35|NZ_LNVL01000006|CRT,CRISPRCasFinder 81893-81927 35 NC_047892 Gordonia phage BirksAndSocks, complete genome 26716-26750 8 0.771
NZ_LNVL01000006_1 1.27|81893|35|NZ_LNVL01000006|CRT,CRISPRCasFinder 81893-81927 35 MG770214 Gordonia phage SteveFrench, complete genome 27478-27512 8 0.771
NZ_LNVL01000006_1 1.27|81893|35|NZ_LNVL01000006|CRT,CRISPRCasFinder 81893-81927 35 MK433267 Gordonia phage Butterball, complete genome 26715-26749 8 0.771
NZ_LNVL01000006_1 1.39|82684|35|NZ_LNVL01000006|CRT,CRISPRCasFinder 82684-82718 35 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 181092-181126 8 0.771
NZ_LNVL01000006_1 1.45|83079|34|NZ_LNVL01000006|CRT,CRISPRCasFinder 83079-83112 34 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 68749-68782 8 0.765
NZ_LNVL01000006_1 1.70|80514|34|NZ_LNVL01000006|PILER-CR 80514-80547 34 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 35823-35856 8 0.765
NZ_LNVL01000006_1 1.70|80514|34|NZ_LNVL01000006|PILER-CR 80514-80547 34 MN234185 Mycobacterium phage Lemuria, complete genome 13917-13950 8 0.765
NZ_LNVL01000006_1 1.82|81311|36|NZ_LNVL01000006|PILER-CR 81311-81346 36 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 726279-726314 8 0.778
NZ_LNVL01000006_1 1.83|81379|34|NZ_LNVL01000006|PILER-CR 81379-81412 34 NZ_CP050105 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence 189496-189529 8 0.765
NZ_LNVL01000006_1 1.83|81379|34|NZ_LNVL01000006|PILER-CR 81379-81412 34 NZ_CP050110 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence 189498-189531 8 0.765
NZ_LNVL01000006_1 1.83|81379|34|NZ_LNVL01000006|PILER-CR 81379-81412 34 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 76281-76314 8 0.765
NZ_LNVL01000006_1 1.86|81579|35|NZ_LNVL01000006|PILER-CR 81579-81613 35 KX911187 Rathayibacter phage NCPPB3778, complete genome 7785-7819 8 0.771
NZ_LNVL01000006_1 1.91|81918|35|NZ_LNVL01000006|PILER-CR 81918-81952 35 MG757155 Gordonia phage Boneham, complete genome 26715-26749 8 0.771
NZ_LNVL01000006_1 1.91|81918|35|NZ_LNVL01000006|PILER-CR 81918-81952 35 NC_048820 Gordonia phage Jellybones, complete genome 26735-26769 8 0.771
NZ_LNVL01000006_1 1.91|81918|35|NZ_LNVL01000006|PILER-CR 81918-81952 35 MK433263 Gordonia phage FelixAlejandro, complete genome 26913-26947 8 0.771
NZ_LNVL01000006_1 1.91|81918|35|NZ_LNVL01000006|PILER-CR 81918-81952 35 MK359302 Gordonia phage Sombrero, complete genome 26744-26778 8 0.771
NZ_LNVL01000006_1 1.91|81918|35|NZ_LNVL01000006|PILER-CR 81918-81952 35 NC_047892 Gordonia phage BirksAndSocks, complete genome 26716-26750 8 0.771
NZ_LNVL01000006_1 1.91|81918|35|NZ_LNVL01000006|PILER-CR 81918-81952 35 MG770214 Gordonia phage SteveFrench, complete genome 27478-27512 8 0.771
NZ_LNVL01000006_1 1.91|81918|35|NZ_LNVL01000006|PILER-CR 81918-81952 35 MK433267 Gordonia phage Butterball, complete genome 26715-26749 8 0.771
NZ_LNVL01000006_1 1.103|82721|35|NZ_LNVL01000006|PILER-CR 82721-82755 35 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 181092-181126 8 0.771
NZ_LNVL01000006_1 1.109|83122|34|NZ_LNVL01000006|PILER-CR 83122-83155 34 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 68749-68782 8 0.765
NZ_LNVL01000006_1 1.6|80509|34|NZ_LNVL01000006|CRT 80509-80542 34 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 375386-375419 9 0.735
NZ_LNVL01000006_1 1.6|80509|34|NZ_LNVL01000006|CRT 80509-80542 34 NZ_CP039918 Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence 26901-26934 9 0.735
NZ_LNVL01000006_1 1.6|80509|34|NZ_LNVL01000006|CRT 80509-80542 34 NZ_CP039905 Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623a, complete sequence 20386-20419 9 0.735
NZ_LNVL01000006_1 1.6|80509|34|NZ_LNVL01000006|CRT 80509-80542 34 NZ_CP039909 Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence 215244-215277 9 0.735
NZ_LNVL01000006_1 1.16|81167|33|NZ_LNVL01000006|CRT,CRISPRCasFinder 81167-81199 33 KX752698 Mycobacterium phage Tonenili, complete genome 149552-149584 9 0.727
NZ_LNVL01000006_1 1.19|81362|34|NZ_LNVL01000006|CRT,CRISPRCasFinder 81362-81395 34 NZ_CP016462 Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence 97668-97701 9 0.735
NZ_LNVL01000006_1 1.21|81493|35|NZ_LNVL01000006|CRT,CRISPRCasFinder 81493-81527 35 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1689129-1689163 9 0.743
NZ_LNVL01000006_1 1.22|81559|35|NZ_LNVL01000006|CRT,CRISPRCasFinder 81559-81593 35 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 202811-202845 9 0.743
NZ_LNVL01000006_1 1.45|83079|34|NZ_LNVL01000006|CRT,CRISPRCasFinder 83079-83112 34 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 97058-97091 9 0.735
NZ_LNVL01000006_1 1.47|83209|34|NZ_LNVL01000006|CRT,CRISPRCasFinder 83209-83242 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2051325-2051358 9 0.735
NZ_LNVL01000006_1 1.47|83209|34|NZ_LNVL01000006|CRT,CRISPRCasFinder 83209-83242 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2062297-2062330 9 0.735
NZ_LNVL01000006_1 1.57|83874|34|NZ_LNVL01000006|CRT,CRISPRCasFinder 83874-83907 34 NZ_CP039640 Azospirillum sp. TSH100 plasmid p1, complete sequence 274754-274787 9 0.735
NZ_LNVL01000006_1 1.70|80514|34|NZ_LNVL01000006|PILER-CR 80514-80547 34 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 375386-375419 9 0.735
NZ_LNVL01000006_1 1.70|80514|34|NZ_LNVL01000006|PILER-CR 80514-80547 34 NZ_CP039918 Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence 26901-26934 9 0.735
NZ_LNVL01000006_1 1.70|80514|34|NZ_LNVL01000006|PILER-CR 80514-80547 34 NZ_CP039905 Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623a, complete sequence 20386-20419 9 0.735
NZ_LNVL01000006_1 1.70|80514|34|NZ_LNVL01000006|PILER-CR 80514-80547 34 NZ_CP039909 Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence 215244-215277 9 0.735
NZ_LNVL01000006_1 1.80|81181|33|NZ_LNVL01000006|PILER-CR 81181-81213 33 KX752698 Mycobacterium phage Tonenili, complete genome 149552-149584 9 0.727
NZ_LNVL01000006_1 1.83|81379|34|NZ_LNVL01000006|PILER-CR 81379-81412 34 NZ_CP016462 Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence 97668-97701 9 0.735
NZ_LNVL01000006_1 1.85|81512|35|NZ_LNVL01000006|PILER-CR 81512-81546 35 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1689129-1689163 9 0.743
NZ_LNVL01000006_1 1.86|81579|35|NZ_LNVL01000006|PILER-CR 81579-81613 35 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 202811-202845 9 0.743
NZ_LNVL01000006_1 1.109|83122|34|NZ_LNVL01000006|PILER-CR 83122-83155 34 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 97058-97091 9 0.735
NZ_LNVL01000006_1 1.111|83254|34|NZ_LNVL01000006|PILER-CR 83254-83287 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2051325-2051358 9 0.735
NZ_LNVL01000006_1 1.111|83254|34|NZ_LNVL01000006|PILER-CR 83254-83287 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2062297-2062330 9 0.735
NZ_LNVL01000006_1 1.121|83929|34|NZ_LNVL01000006|PILER-CR 83929-83962 34 NZ_CP039640 Azospirillum sp. TSH100 plasmid p1, complete sequence 274754-274787 9 0.735
NZ_LNVL01000006_1 1.6|80509|34|NZ_LNVL01000006|CRT 80509-80542 34 MT024859 Gordonia phage DumpsterDude, complete genome 13125-13158 10 0.706
NZ_LNVL01000006_1 1.18|81295|36|NZ_LNVL01000006|CRT,CRISPRCasFinder 81295-81330 36 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1477450-1477485 10 0.722
NZ_LNVL01000006_1 1.24|81692|37|NZ_LNVL01000006|CRT,CRISPRCasFinder 81692-81728 37 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 149194-149230 10 0.73
NZ_LNVL01000006_1 1.25|81760|35|NZ_LNVL01000006|CRT,CRISPRCasFinder 81760-81794 35 NZ_CP017242 Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence 50736-50770 10 0.714
NZ_LNVL01000006_1 1.37|82552|34|NZ_LNVL01000006|CRT,CRISPRCasFinder 82552-82585 34 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1906752-1906785 10 0.706
NZ_LNVL01000006_1 1.37|82552|34|NZ_LNVL01000006|CRT,CRISPRCasFinder 82552-82585 34 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 287381-287414 10 0.706
NZ_LNVL01000006_1 1.52|83542|35|NZ_LNVL01000006|CRT,CRISPRCasFinder 83542-83576 35 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 260935-260969 10 0.714
NZ_LNVL01000006_1 1.52|83542|35|NZ_LNVL01000006|CRT,CRISPRCasFinder 83542-83576 35 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 268047-268081 10 0.714
NZ_LNVL01000006_1 1.57|83874|34|NZ_LNVL01000006|CRT,CRISPRCasFinder 83874-83907 34 NZ_CP045120 Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence 138837-138870 10 0.706
NZ_LNVL01000006_1 1.70|80514|34|NZ_LNVL01000006|PILER-CR 80514-80547 34 MT024859 Gordonia phage DumpsterDude, complete genome 13125-13158 10 0.706
NZ_LNVL01000006_1 1.82|81311|36|NZ_LNVL01000006|PILER-CR 81311-81346 36 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1477450-1477485 10 0.722
NZ_LNVL01000006_1 1.88|81714|37|NZ_LNVL01000006|PILER-CR 81714-81750 37 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 149194-149230 10 0.73
NZ_LNVL01000006_1 1.89|81783|35|NZ_LNVL01000006|PILER-CR 81783-81817 35 NZ_CP017242 Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence 50736-50770 10 0.714
NZ_LNVL01000006_1 1.101|82587|34|NZ_LNVL01000006|PILER-CR 82587-82620 34 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1906752-1906785 10 0.706
NZ_LNVL01000006_1 1.101|82587|34|NZ_LNVL01000006|PILER-CR 82587-82620 34 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 287381-287414 10 0.706
NZ_LNVL01000006_1 1.116|83592|35|NZ_LNVL01000006|PILER-CR 83592-83626 35 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 260935-260969 10 0.714
NZ_LNVL01000006_1 1.116|83592|35|NZ_LNVL01000006|PILER-CR 83592-83626 35 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 268047-268081 10 0.714
NZ_LNVL01000006_1 1.121|83929|34|NZ_LNVL01000006|PILER-CR 83929-83962 34 NZ_CP045120 Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence 138837-138870 10 0.706
NZ_LNVL01000006_1 1.6|80509|34|NZ_LNVL01000006|CRT 80509-80542 34 NC_048019 Gordonia phage Ruthy, complete genome 13235-13268 11 0.676
NZ_LNVL01000006_1 1.14|81036|34|NZ_LNVL01000006|CRT,CRISPRCasFinder 81036-81069 34 MG518519 Streptomyces phage Manuel, complete genome 21300-21333 11 0.676
NZ_LNVL01000006_1 1.22|81559|35|NZ_LNVL01000006|CRT,CRISPRCasFinder 81559-81593 35 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4200703-4200737 11 0.686
NZ_LNVL01000006_1 1.37|82552|34|NZ_LNVL01000006|CRT,CRISPRCasFinder 82552-82585 34 MF360958 Salicola phage SCTP-2, complete genome 377440-377473 11 0.676
NZ_LNVL01000006_1 1.37|82552|34|NZ_LNVL01000006|CRT,CRISPRCasFinder 82552-82585 34 MK388689 Pantoea phage vB_PagM_LIET2, complete genome 3237-3270 11 0.676
NZ_LNVL01000006_1 1.45|83079|34|NZ_LNVL01000006|CRT,CRISPRCasFinder 83079-83112 34 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 715792-715825 11 0.676
NZ_LNVL01000006_1 1.45|83079|34|NZ_LNVL01000006|CRT,CRISPRCasFinder 83079-83112 34 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 772682-772715 11 0.676
NZ_LNVL01000006_1 1.59|84004|34|NZ_LNVL01000006|CRT,CRISPRCasFinder 84004-84037 34 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 608994-609027 11 0.676
NZ_LNVL01000006_1 1.70|80514|34|NZ_LNVL01000006|PILER-CR 80514-80547 34 NC_048019 Gordonia phage Ruthy, complete genome 13235-13268 11 0.676
NZ_LNVL01000006_1 1.78|81048|34|NZ_LNVL01000006|PILER-CR 81048-81081 34 MG518519 Streptomyces phage Manuel, complete genome 21300-21333 11 0.676
NZ_LNVL01000006_1 1.86|81579|35|NZ_LNVL01000006|PILER-CR 81579-81613 35 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4200703-4200737 11 0.686
NZ_LNVL01000006_1 1.101|82587|34|NZ_LNVL01000006|PILER-CR 82587-82620 34 MF360958 Salicola phage SCTP-2, complete genome 377440-377473 11 0.676
NZ_LNVL01000006_1 1.101|82587|34|NZ_LNVL01000006|PILER-CR 82587-82620 34 MK388689 Pantoea phage vB_PagM_LIET2, complete genome 3237-3270 11 0.676
NZ_LNVL01000006_1 1.109|83122|34|NZ_LNVL01000006|PILER-CR 83122-83155 34 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 715792-715825 11 0.676
NZ_LNVL01000006_1 1.109|83122|34|NZ_LNVL01000006|PILER-CR 83122-83155 34 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 772682-772715 11 0.676
NZ_LNVL01000006_1 1.123|84061|34|NZ_LNVL01000006|PILER-CR 84061-84094 34 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 608994-609027 11 0.676

1. spacer 1.36|82487|34|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 1, identity: 0.971

tcgacgagacggcccctcgctacggcggaaacct	CRISPR spacer
tggacgagacggcccctcgctacggcggaaacct	Protospacer
* ********************************

2. spacer 1.36|82487|34|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 1, identity: 0.971

tcgacgagacggcccctcgctacggcggaaacct	CRISPR spacer
tggacgagacggcccctcgctacggcggaaacct	Protospacer
* ********************************

3. spacer 1.100|82521|34|NZ_LNVL01000006|PILER-CR matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 1, identity: 0.971

tcgacgagacggcccctcgctacggcggaaacct	CRISPR spacer
tggacgagacggcccctcgctacggcggaaacct	Protospacer
* ********************************

4. spacer 1.100|82521|34|NZ_LNVL01000006|PILER-CR matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 1, identity: 0.971

tcgacgagacggcccctcgctacggcggaaacct	CRISPR spacer
tggacgagacggcccctcgctacggcggaaacct	Protospacer
* ********************************

5. spacer 1.49|83341|36|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 2, identity: 0.944

gtccacgtacatgccgttaaactcggcctcgatggt	CRISPR spacer
gtccacgtacatgccgttgtactcggcctcgatggt	Protospacer
******************. ****************

6. spacer 1.49|83341|36|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 2, identity: 0.944

gtccacgtacatgccgttaaactcggcctcgatggt	CRISPR spacer
gtccacgtacatgccgttgtactcggcctcgatggt	Protospacer
******************. ****************

7. spacer 1.113|83388|36|NZ_LNVL01000006|PILER-CR matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 2, identity: 0.944

gtccacgtacatgccgttaaactcggcctcgatggt	CRISPR spacer
gtccacgtacatgccgttgtactcggcctcgatggt	Protospacer
******************. ****************

8. spacer 1.113|83388|36|NZ_LNVL01000006|PILER-CR matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 2, identity: 0.944

gtccacgtacatgccgttaaactcggcctcgatggt	CRISPR spacer
gtccacgtacatgccgttgtactcggcctcgatggt	Protospacer
******************. ****************

9. spacer 1.43|82947|34|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to MN478375 (Bacteriophage Titan-X, complete genome) position: , mismatch: 3, identity: 0.912

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggtgctgcacactg	Protospacer
**********************.* ******** 

10. spacer 1.107|82988|34|NZ_LNVL01000006|PILER-CR matches to MN478375 (Bacteriophage Titan-X, complete genome) position: , mismatch: 3, identity: 0.912

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggtgctgcacactg	Protospacer
**********************.* ******** 

11. spacer 1.43|82947|34|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NC_047762 (Xanthomonas phage XAJ24, complete genome) position: , mismatch: 4, identity: 0.882

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggtgatgcacatac	Protospacer
**********************.********. .

12. spacer 1.107|82988|34|NZ_LNVL01000006|PILER-CR matches to NC_047762 (Xanthomonas phage XAJ24, complete genome) position: , mismatch: 4, identity: 0.882

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggtgatgcacatac	Protospacer
**********************.********. .

13. spacer 1.9|80708|35|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NC_020205 (Xanthomonas citri phage CP2 DNA, complete genome) position: , mismatch: 5, identity: 0.857

ctggaagtgaagaccagcaccaccaggttggccag	CRISPR spacer
ctgttcgtgaacaccagcacgaccaggttggccag	Protospacer
***   ***** ******** **************

14. spacer 1.43|82947|34|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NC_022982 (Xylella phage Paz, complete genome) position: , mismatch: 5, identity: 0.853

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggagatacacgcaa	Protospacer
********************** ***.***.*  

15. spacer 1.73|80715|35|NZ_LNVL01000006|PILER-CR matches to NC_020205 (Xanthomonas citri phage CP2 DNA, complete genome) position: , mismatch: 5, identity: 0.857

ctggaagtgaagaccagcaccaccaggttggccag	CRISPR spacer
ctgttcgtgaacaccagcacgaccaggttggccag	Protospacer
***   ***** ******** **************

16. spacer 1.107|82988|34|NZ_LNVL01000006|PILER-CR matches to NC_022982 (Xylella phage Paz, complete genome) position: , mismatch: 5, identity: 0.853

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggagatacacgcaa	Protospacer
********************** ***.***.*  

17. spacer 1.20|81427|35|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NC_023006 (Pseudomonas phage PPpW-3 DNA, complete sequence) position: , mismatch: 6, identity: 0.829

gacatg-gagccatgctagcctgtgcgccttgtaca	CRISPR spacer
-acaggcaagccatgcgagcttgtgcgccttgtact	Protospacer
 *** * .******** ***.************** 

18. spacer 1.84|81445|35|NZ_LNVL01000006|PILER-CR matches to NC_023006 (Pseudomonas phage PPpW-3 DNA, complete sequence) position: , mismatch: 6, identity: 0.829

gacatg-gagccatgctagcctgtgcgccttgtaca	CRISPR spacer
-acaggcaagccatgcgagcttgtgcgccttgtact	Protospacer
 *** * .******** ***.************** 

19. spacer 1.6|80509|34|NZ_LNVL01000006|CRT matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 7, identity: 0.794

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gccgcgccggcgccgcggcccttcccgagaatca	Protospacer
****************** ** ******     *

20. spacer 1.11|80840|34|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

21. spacer 1.11|80840|34|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

22. spacer 1.11|80840|34|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

23. spacer 1.11|80840|34|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to AF394895 (Actinophage Q5 replication protein gene, partial cds) position: , mismatch: 7, identity: 0.794

gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
gggcgacacagatttgccaggccgacccccacga	Protospacer
*******  *************** *  *  ***

24. spacer 1.25|81760|35|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 7, identity: 0.8

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcggtgacgatgacgtccatcggaatgtcatgcgg	Protospacer
************ ********* ****  ** . *

25. spacer 1.25|81760|35|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 7, identity: 0.8

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcggtgacgatgacgtccatcggaatgtcatgcgg	Protospacer
************ ********* ****  ** . *

26. spacer 1.70|80514|34|NZ_LNVL01000006|PILER-CR matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 7, identity: 0.794

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gccgcgccggcgccgcggcccttcccgagaatca	Protospacer
****************** ** ******     *

27. spacer 1.75|80849|34|NZ_LNVL01000006|PILER-CR matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

28. spacer 1.75|80849|34|NZ_LNVL01000006|PILER-CR matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

29. spacer 1.75|80849|34|NZ_LNVL01000006|PILER-CR matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

30. spacer 1.75|80849|34|NZ_LNVL01000006|PILER-CR matches to AF394895 (Actinophage Q5 replication protein gene, partial cds) position: , mismatch: 7, identity: 0.794

gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
gggcgacacagatttgccaggccgacccccacga	Protospacer
*******  *************** *  *  ***

31. spacer 1.89|81783|35|NZ_LNVL01000006|PILER-CR matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 7, identity: 0.8

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcggtgacgatgacgtccatcggaatgtcatgcgg	Protospacer
************ ********* ****  ** . *

32. spacer 1.89|81783|35|NZ_LNVL01000006|PILER-CR matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 7, identity: 0.8

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcggtgacgatgacgtccatcggaatgtcatgcgg	Protospacer
************ ********* ****  ** . *

33. spacer 1.6|80509|34|NZ_LNVL01000006|CRT matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gcctcgccggcgccgcggaccgtccattcgtgcc	Protospacer
*** *****************.***   * **  

34. spacer 1.6|80509|34|NZ_LNVL01000006|CRT matches to MN234185 (Mycobacterium phage Lemuria, complete genome) position: , mismatch: 8, identity: 0.765

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggagcgccggcgccgcggcccttcccgagaatga	Protospacer
*  *************** ** ******    **

35. spacer 1.18|81295|36|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.778

gcgcgcggcgtccacgacacccagcgc---cgcgtcccg	CRISPR spacer
ccgcgcggcgtcgacgacgcccagcgcctgcacatc---	Protospacer
 *********** *****.********   *.*.**   

36. spacer 1.19|81362|34|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

37. spacer 1.19|81362|34|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

38. spacer 1.19|81362|34|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

39. spacer 1.22|81559|35|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to KX911187 (Rathayibacter phage NCPPB3778, complete genome) position: , mismatch: 8, identity: 0.771

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
gtatcccggttaccggccttgctgctttcgcgcct	Protospacer
.  * * **** ************** ******.*

40. spacer 1.27|81893|35|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to MG757155 (Gordonia phage Boneham, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

41. spacer 1.27|81893|35|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NC_048820 (Gordonia phage Jellybones, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

42. spacer 1.27|81893|35|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to MK433263 (Gordonia phage FelixAlejandro, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

43. spacer 1.27|81893|35|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to MK359302 (Gordonia phage Sombrero, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

44. spacer 1.27|81893|35|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NC_047892 (Gordonia phage BirksAndSocks, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

45. spacer 1.27|81893|35|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to MG770214 (Gordonia phage SteveFrench, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

46. spacer 1.27|81893|35|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to MK433267 (Gordonia phage Butterball, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

47. spacer 1.39|82684|35|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 8, identity: 0.771

ctctctggtggcgagttcttcagcgaccgtgttca	CRISPR spacer
ttctgacagtgcgagttcttcggcgaccgtgttca	Protospacer
.***   .  ***********.*************

48. spacer 1.45|83079|34|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 8, identity: 0.765

tcgccgccaccagtgcctcggcccggcagtagta	CRISPR spacer
ccgccgccagctgtgcctcggcccggccaaaggc	Protospacer
.******** * *************** . **  

49. spacer 1.70|80514|34|NZ_LNVL01000006|PILER-CR matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gcctcgccggcgccgcggaccgtccattcgtgcc	Protospacer
*** *****************.***   * **  

50. spacer 1.70|80514|34|NZ_LNVL01000006|PILER-CR matches to MN234185 (Mycobacterium phage Lemuria, complete genome) position: , mismatch: 8, identity: 0.765

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggagcgccggcgccgcggcccttcccgagaatga	Protospacer
*  *************** ** ******    **

51. spacer 1.82|81311|36|NZ_LNVL01000006|PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.778

gcgcgcggcgtccacgacacccagcgc---cgcgtcccg	CRISPR spacer
ccgcgcggcgtcgacgacgcccagcgcctgcacatc---	Protospacer
 *********** *****.********   *.*.**   

52. spacer 1.83|81379|34|NZ_LNVL01000006|PILER-CR matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

53. spacer 1.83|81379|34|NZ_LNVL01000006|PILER-CR matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

54. spacer 1.83|81379|34|NZ_LNVL01000006|PILER-CR matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

55. spacer 1.86|81579|35|NZ_LNVL01000006|PILER-CR matches to KX911187 (Rathayibacter phage NCPPB3778, complete genome) position: , mismatch: 8, identity: 0.771

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
gtatcccggttaccggccttgctgctttcgcgcct	Protospacer
.  * * **** ************** ******.*

56. spacer 1.91|81918|35|NZ_LNVL01000006|PILER-CR matches to MG757155 (Gordonia phage Boneham, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

57. spacer 1.91|81918|35|NZ_LNVL01000006|PILER-CR matches to NC_048820 (Gordonia phage Jellybones, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

58. spacer 1.91|81918|35|NZ_LNVL01000006|PILER-CR matches to MK433263 (Gordonia phage FelixAlejandro, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

59. spacer 1.91|81918|35|NZ_LNVL01000006|PILER-CR matches to MK359302 (Gordonia phage Sombrero, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

60. spacer 1.91|81918|35|NZ_LNVL01000006|PILER-CR matches to NC_047892 (Gordonia phage BirksAndSocks, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

61. spacer 1.91|81918|35|NZ_LNVL01000006|PILER-CR matches to MG770214 (Gordonia phage SteveFrench, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

62. spacer 1.91|81918|35|NZ_LNVL01000006|PILER-CR matches to MK433267 (Gordonia phage Butterball, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

63. spacer 1.103|82721|35|NZ_LNVL01000006|PILER-CR matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 8, identity: 0.771

ctctctggtggcgagttcttcagcgaccgtgttca	CRISPR spacer
ttctgacagtgcgagttcttcggcgaccgtgttca	Protospacer
.***   .  ***********.*************

64. spacer 1.109|83122|34|NZ_LNVL01000006|PILER-CR matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 8, identity: 0.765

tcgccgccaccagtgcctcggcccggcagtagta	CRISPR spacer
ccgccgccagctgtgcctcggcccggccaaaggc	Protospacer
.******** * *************** . **  

65. spacer 1.6|80509|34|NZ_LNVL01000006|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
aagtcgccggcgccgcggacgaccccgacgctga	Protospacer
.   **************** *.****** . **

66. spacer 1.6|80509|34|NZ_LNVL01000006|CRT matches to NZ_CP039918 (Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

67. spacer 1.6|80509|34|NZ_LNVL01000006|CRT matches to NZ_CP039905 (Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623a, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

68. spacer 1.6|80509|34|NZ_LNVL01000006|CRT matches to NZ_CP039909 (Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

69. spacer 1.16|81167|33|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to KX752698 (Mycobacterium phage Tonenili, complete genome) position: , mismatch: 9, identity: 0.727

catcccagacatcgcccagcatcggatcaccgt	CRISPR spacer
tggcatcgacatcgcccagcagcgggtcaccgg	Protospacer
.. * . ************** ***.****** 

70. spacer 1.19|81362|34|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NZ_CP016462 (Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence) position: , mismatch: 9, identity: 0.735

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
ccgatctggacgaggccgatcttgcccgggccat	Protospacer
* *********** **** *******  . **. 

71. spacer 1.21|81493|35|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.743

gagcggttcagctcaatctccggcca-gagactgcg	CRISPR spacer
gagcggttcagcgcaatcttcggccgttcggtcgc-	Protospacer
************ ******.*****.   *...** 

72. spacer 1.22|81559|35|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.743

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
cgcacgatgttgccggccttgctgccgtcgcgcga	Protospacer
 **   * *** *************.*******  

73. spacer 1.45|83079|34|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 9, identity: 0.735

tcgccgccaccagtgcctcggcccgg----cagtagta	CRISPR spacer
cggccgccaccagtgcctcggccagggtcaccgc----	Protospacer
. ********************* **    * *.    

74. spacer 1.47|83209|34|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.735

gcgtggtcattaagcgcgcctgcgcgatggacaa	CRISPR spacer
ggatactgtttacgcgcgcctgggcgatggacac	Protospacer
* .*. *  *** ********* ********** 

75. spacer 1.47|83209|34|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.735

gcgtggtcattaagcgcgcctgcgcgatggacaa	CRISPR spacer
ggatactgtttacgcgcgcctgggcgatggacac	Protospacer
* .*. *  *** ********* ********** 

76. spacer 1.57|83874|34|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.735

accaaggccaacgcaagacgggccggcggccgag	CRISPR spacer
ccggaggccaacgcaagaccggtcggcgcggcag	Protospacer
 * .*************** **.*****    **

77. spacer 1.70|80514|34|NZ_LNVL01000006|PILER-CR matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
aagtcgccggcgccgcggacgaccccgacgctga	Protospacer
.   **************** *.****** . **

78. spacer 1.70|80514|34|NZ_LNVL01000006|PILER-CR matches to NZ_CP039918 (Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

79. spacer 1.70|80514|34|NZ_LNVL01000006|PILER-CR matches to NZ_CP039905 (Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623a, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

80. spacer 1.70|80514|34|NZ_LNVL01000006|PILER-CR matches to NZ_CP039909 (Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

81. spacer 1.80|81181|33|NZ_LNVL01000006|PILER-CR matches to KX752698 (Mycobacterium phage Tonenili, complete genome) position: , mismatch: 9, identity: 0.727

catcccagacatcgcccagcatcggatcaccgt	CRISPR spacer
tggcatcgacatcgcccagcagcgggtcaccgg	Protospacer
.. * . ************** ***.****** 

82. spacer 1.83|81379|34|NZ_LNVL01000006|PILER-CR matches to NZ_CP016462 (Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence) position: , mismatch: 9, identity: 0.735

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
ccgatctggacgaggccgatcttgcccgggccat	Protospacer
* *********** **** *******  . **. 

83. spacer 1.85|81512|35|NZ_LNVL01000006|PILER-CR matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.743

gagcggttcagctcaatctccggcca-gagactgcg	CRISPR spacer
gagcggttcagcgcaatcttcggccgttcggtcgc-	Protospacer
************ ******.*****.   *...** 

84. spacer 1.86|81579|35|NZ_LNVL01000006|PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.743

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
cgcacgatgttgccggccttgctgccgtcgcgcga	Protospacer
 **   * *** *************.*******  

85. spacer 1.109|83122|34|NZ_LNVL01000006|PILER-CR matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 9, identity: 0.735

tcgccgccaccagtgcctcggcccgg----cagtagta	CRISPR spacer
cggccgccaccagtgcctcggccagggtcaccgc----	Protospacer
. ********************* **    * *.    

86. spacer 1.111|83254|34|NZ_LNVL01000006|PILER-CR matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.735

gcgtggtcattaagcgcgcctgcgcgatggacaa	CRISPR spacer
ggatactgtttacgcgcgcctgggcgatggacac	Protospacer
* .*. *  *** ********* ********** 

87. spacer 1.111|83254|34|NZ_LNVL01000006|PILER-CR matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.735

gcgtggtcattaagcgcgcctgcgcgatggacaa	CRISPR spacer
ggatactgtttacgcgcgcctgggcgatggacac	Protospacer
* .*. *  *** ********* ********** 

88. spacer 1.121|83929|34|NZ_LNVL01000006|PILER-CR matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.735

accaaggccaacgcaagacgggccggcggccgag	CRISPR spacer
ccggaggccaacgcaagaccggtcggcgcggcag	Protospacer
 * .*************** **.*****    **

89. spacer 1.6|80509|34|NZ_LNVL01000006|CRT matches to MT024859 (Gordonia phage DumpsterDude, complete genome) position: , mismatch: 10, identity: 0.706

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggcccgccggcgccgcgcaccatgccgatcgcac	Protospacer
* * ************* ***** ****..  . 

90. spacer 1.18|81295|36|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 10, identity: 0.722

gcgcgcggcgtccacgacacccagcgccgcgtcccg	CRISPR spacer
catcttgacgaccacgacgcccagcgccgcgtccac	Protospacer
   * .*.** *******.***************  

91. spacer 1.24|81692|37|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.73

tggacctgcaggccgccgaactgcgccgcaagcaggt	CRISPR spacer
ccaacctgcagggcgccgacctgcgccgcggcatggt	Protospacer
. .********* ****** *********..   ***

92. spacer 1.25|81760|35|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NZ_CP017242 (Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence) position: , mismatch: 10, identity: 0.714

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcgttgaccatgtcgtccatcgtaaatccgtgcgg	Protospacer
*** **** ****************    .* . *

93. spacer 1.37|82552|34|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
accctcgggcgggctggtgatgaaggcgttcatg	Protospacer
..  * **************** ***.*** *  

94. spacer 1.37|82552|34|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
accctcgggcgggctggtgatgaaggcgttcatg	Protospacer
..  * **************** ***.*** *  

95. spacer 1.52|83542|35|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 10, identity: 0.714

tgctgctcgcggagctgggcggggccgcataccac	CRISPR spacer
tgctggtcgcggtgctgggcggggcgttgggcatc	Protospacer
***** ****** ************  .. .*  *

96. spacer 1.52|83542|35|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.714

tgctgctcgcggagctgggcggggccgcataccac	CRISPR spacer
ttgtgctggcggcgctgggcggggccgcgctcggt	Protospacer
*  **** **** ***************.. * ..

97. spacer 1.57|83874|34|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

accaaggccaacgcaagacgggccggcggccgag	CRISPR spacer
cttcgtcccgacgcaagacgggccggcggccggt	Protospacer
 .. .  **.**********************. 

98. spacer 1.70|80514|34|NZ_LNVL01000006|PILER-CR matches to MT024859 (Gordonia phage DumpsterDude, complete genome) position: , mismatch: 10, identity: 0.706

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggcccgccggcgccgcgcaccatgccgatcgcac	Protospacer
* * ************* ***** ****..  . 

99. spacer 1.82|81311|36|NZ_LNVL01000006|PILER-CR matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 10, identity: 0.722

gcgcgcggcgtccacgacacccagcgccgcgtcccg	CRISPR spacer
catcttgacgaccacgacgcccagcgccgcgtccac	Protospacer
   * .*.** *******.***************  

100. spacer 1.88|81714|37|NZ_LNVL01000006|PILER-CR matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.73

tggacctgcaggccgccgaactgcgccgcaagcaggt	CRISPR spacer
ccaacctgcagggcgccgacctgcgccgcggcatggt	Protospacer
. .********* ****** *********..   ***

101. spacer 1.89|81783|35|NZ_LNVL01000006|PILER-CR matches to NZ_CP017242 (Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence) position: , mismatch: 10, identity: 0.714

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcgttgaccatgtcgtccatcgtaaatccgtgcgg	Protospacer
*** **** ****************    .* . *

102. spacer 1.101|82587|34|NZ_LNVL01000006|PILER-CR matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
accctcgggcgggctggtgatgaaggcgttcatg	Protospacer
..  * **************** ***.*** *  

103. spacer 1.101|82587|34|NZ_LNVL01000006|PILER-CR matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
accctcgggcgggctggtgatgaaggcgttcatg	Protospacer
..  * **************** ***.*** *  

104. spacer 1.116|83592|35|NZ_LNVL01000006|PILER-CR matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 10, identity: 0.714

tgctgctcgcggagctgggcggggccgcataccac	CRISPR spacer
tgctggtcgcggtgctgggcggggcgttgggcatc	Protospacer
***** ****** ************  .. .*  *

105. spacer 1.116|83592|35|NZ_LNVL01000006|PILER-CR matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.714

tgctgctcgcggagctgggcggggccgcataccac	CRISPR spacer
ttgtgctggcggcgctgggcggggccgcgctcggt	Protospacer
*  **** **** ***************.. * ..

106. spacer 1.121|83929|34|NZ_LNVL01000006|PILER-CR matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

accaaggccaacgcaagacgggccggcggccgag	CRISPR spacer
cttcgtcccgacgcaagacgggccggcggccggt	Protospacer
 .. .  **.**********************. 

107. spacer 1.6|80509|34|NZ_LNVL01000006|CRT matches to NC_048019 (Gordonia phage Ruthy, complete genome) position: , mismatch: 11, identity: 0.676

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggaccgccggcgccgcgcaccatgccgatcgcac	Protospacer
*   ************* ***** ****..  . 

108. spacer 1.14|81036|34|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to MG518519 (Streptomyces phage Manuel, complete genome) position: , mismatch: 11, identity: 0.676

gaaaacggtgtagcactcgtcgaggatgatcacc	CRISPR spacer
acgacgggtgtagcacccgtcgatgatgatagga	Protospacer
. .*  **********.****** ****** .  

109. spacer 1.22|81559|35|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.686

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
gtgcccaggttccaggccttgctgatgtcggtcag	Protospacer
.  . ******** ********** *****  *  

110. spacer 1.37|82552|34|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to MF360958 (Salicola phage SCTP-2, complete genome) position: , mismatch: 11, identity: 0.676

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
tggcttatatggggtggtgatgaaggtgttgaat	Protospacer
  . * . ..*** ******** ***********

111. spacer 1.37|82552|34|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to MK388689 (Pantoea phage vB_PagM_LIET2, complete genome) position: , mismatch: 11, identity: 0.676

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
atactggggcgggctggtgatgcagcacggacag	Protospacer
.** *.*******************     . * 

112. spacer 1.45|83079|34|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 11, identity: 0.676

tcgccgccaccagtgcctcggcccggcagtagta----	CRISPR spacer
ccgccgccacctgcgcctcggccc----gcgccacctc	Protospacer
.********** *.**********    *.. .*    

113. spacer 1.45|83079|34|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676

tcgccgccaccagtgcctcggcccggcagtagta	CRISPR spacer
cagccgacgccagtgcctcggcccggttcgcgct	Protospacer
. **** *.*****************.    *. 

114. spacer 1.59|84004|34|NZ_LNVL01000006|CRT,CRISPRCasFinder matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 11, identity: 0.676

gccggcacaacgtgctggcccgggtccagaaggt	CRISPR spacer
cgaaggacaaggtgctgacccgggtccagatcta	Protospacer
   .* **** ******.************    

115. spacer 1.70|80514|34|NZ_LNVL01000006|PILER-CR matches to NC_048019 (Gordonia phage Ruthy, complete genome) position: , mismatch: 11, identity: 0.676

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggaccgccggcgccgcgcaccatgccgatcgcac	Protospacer
*   ************* ***** ****..  . 

116. spacer 1.78|81048|34|NZ_LNVL01000006|PILER-CR matches to MG518519 (Streptomyces phage Manuel, complete genome) position: , mismatch: 11, identity: 0.676

gaaaacggtgtagcactcgtcgaggatgatcacc	CRISPR spacer
acgacgggtgtagcacccgtcgatgatgatagga	Protospacer
. .*  **********.****** ****** .  

117. spacer 1.86|81579|35|NZ_LNVL01000006|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.686

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
gtgcccaggttccaggccttgctgatgtcggtcag	Protospacer
.  . ******** ********** *****  *  

118. spacer 1.101|82587|34|NZ_LNVL01000006|PILER-CR matches to MF360958 (Salicola phage SCTP-2, complete genome) position: , mismatch: 11, identity: 0.676

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
tggcttatatggggtggtgatgaaggtgttgaat	Protospacer
  . * . ..*** ******** ***********

119. spacer 1.101|82587|34|NZ_LNVL01000006|PILER-CR matches to MK388689 (Pantoea phage vB_PagM_LIET2, complete genome) position: , mismatch: 11, identity: 0.676

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
atactggggcgggctggtgatgcagcacggacag	Protospacer
.** *.*******************     . * 

120. spacer 1.109|83122|34|NZ_LNVL01000006|PILER-CR matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 11, identity: 0.676

tcgccgccaccagtgcctcggcccggcagtagta----	CRISPR spacer
ccgccgccacctgcgcctcggccc----gcgccacctc	Protospacer
.********** *.**********    *.. .*    

121. spacer 1.109|83122|34|NZ_LNVL01000006|PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676

tcgccgccaccagtgcctcggcccggcagtagta	CRISPR spacer
cagccgacgccagtgcctcggcccggttcgcgct	Protospacer
. **** *.*****************.    *. 

122. spacer 1.123|84061|34|NZ_LNVL01000006|PILER-CR matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 11, identity: 0.676

gccggcacaacgtgctggcccgggtccagaaggt	CRISPR spacer
cgaaggacaaggtgctgacccgggtccagatcta	Protospacer
   .* **** ******.************    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage