Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_LNVJ01000004 Xanthomonas translucens strain CR31 flattened_line_6, whole genome shotgun sequence 0 crisprs cas3,Cas9_archaeal 0 0 0 0
NZ_LNVJ01000240 Xanthomonas translucens strain CR31 flattened_line_479, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000263 Xanthomonas translucens strain CR31 flattened_line_525, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000265 Xanthomonas translucens strain CR31 flattened_line_529, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000244 Xanthomonas translucens strain CR31 flattened_line_487, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000107 Xanthomonas translucens strain CR31 flattened_line_214, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000113 Xanthomonas translucens strain CR31 flattened_line_226, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000045 Xanthomonas translucens strain CR31 flattened_line_88, whole genome shotgun sequence 0 crisprs DinG 0 0 0 0
NZ_LNVJ01000115 Xanthomonas translucens strain CR31 flattened_line_230, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000228 Xanthomonas translucens strain CR31 flattened_line_455, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000099 Xanthomonas translucens strain CR31 flattened_line_196, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000184 Xanthomonas translucens strain CR31 flattened_line_368, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000219 Xanthomonas translucens strain CR31 flattened_line_437, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000092 Xanthomonas translucens strain CR31 flattened_line_182, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000303 Xanthomonas translucens strain CR31 flattened_line_605, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000273 Xanthomonas translucens strain CR31 flattened_line_545, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000171 Xanthomonas translucens strain CR31 flattened_line_342, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000155 Xanthomonas translucens strain CR31 flattened_line_310, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000091 Xanthomonas translucens strain CR31 flattened_line_180, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000052 Xanthomonas translucens strain CR31 flattened_line_102, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000038 Xanthomonas translucens strain CR31 flattened_line_74, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000074 Xanthomonas translucens strain CR31 flattened_line_146, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_LNVJ01000050 Xanthomonas translucens strain CR31 flattened_line_98, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000295 Xanthomonas translucens strain CR31 flattened_line_589, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000083 Xanthomonas translucens strain CR31 flattened_line_164, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000095 Xanthomonas translucens strain CR31 flattened_line_188, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000160 Xanthomonas translucens strain CR31 flattened_line_320, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000048 Xanthomonas translucens strain CR31 flattened_line_94, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000237 Xanthomonas translucens strain CR31 flattened_line_473, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000159 Xanthomonas translucens strain CR31 flattened_line_318, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000090 Xanthomonas translucens strain CR31 flattened_line_178, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000144 Xanthomonas translucens strain CR31 flattened_line_288, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000213 Xanthomonas translucens strain CR31 flattened_line_425, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000027 Xanthomonas translucens strain CR31 flattened_line_52, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_LNVJ01000152 Xanthomonas translucens strain CR31 flattened_line_304, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000304 Xanthomonas translucens strain CR31 flattened_line_607, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000209 Xanthomonas translucens strain CR31 flattened_line_417, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000165 Xanthomonas translucens strain CR31 flattened_line_330, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000247 Xanthomonas translucens strain CR31 flattened_line_493, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000036 Xanthomonas translucens strain CR31 flattened_line_70, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000078 Xanthomonas translucens strain CR31 flattened_line_154, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000306 Xanthomonas translucens strain CR31 flattened_line_611, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000069 Xanthomonas translucens strain CR31 flattened_line_136, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000211 Xanthomonas translucens strain CR31 flattened_line_421, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000093 Xanthomonas translucens strain CR31 flattened_line_184, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000153 Xanthomonas translucens strain CR31 flattened_line_306, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000167 Xanthomonas translucens strain CR31 flattened_line_334, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000301 Xanthomonas translucens strain CR31 flattened_line_601, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000117 Xanthomonas translucens strain CR31 flattened_line_234, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000072 Xanthomonas translucens strain CR31 flattened_line_142, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000119 Xanthomonas translucens strain CR31 flattened_line_238, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000174 Xanthomonas translucens strain CR31 flattened_line_348, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000058 Xanthomonas translucens strain CR31 flattened_line_114, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000021 Xanthomonas translucens strain CR31 flattened_line_40, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000179 Xanthomonas translucens strain CR31 flattened_line_358, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000254 Xanthomonas translucens strain CR31 flattened_line_507, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000271 Xanthomonas translucens strain CR31 flattened_line_541, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000187 Xanthomonas translucens strain CR31 flattened_line_374, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000013 Xanthomonas translucens strain CR31 flattened_line_24, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000225 Xanthomonas translucens strain CR31 flattened_line_449, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000162 Xanthomonas translucens strain CR31 flattened_line_324, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000005 Xanthomonas translucens strain CR31 flattened_line_8, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_LNVJ01000185 Xanthomonas translucens strain CR31 flattened_line_370, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000158 Xanthomonas translucens strain CR31 flattened_line_316, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000128 Xanthomonas translucens strain CR31 flattened_line_256, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000280 Xanthomonas translucens strain CR31 flattened_line_559, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000060 Xanthomonas translucens strain CR31 flattened_line_118, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000070 Xanthomonas translucens strain CR31 flattened_line_138, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000214 Xanthomonas translucens strain CR31 flattened_line_427, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000059 Xanthomonas translucens strain CR31 flattened_line_116, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000253 Xanthomonas translucens strain CR31 flattened_line_505, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000293 Xanthomonas translucens strain CR31 flattened_line_585, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000239 Xanthomonas translucens strain CR31 flattened_line_477, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000154 Xanthomonas translucens strain CR31 flattened_line_308, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000121 Xanthomonas translucens strain CR31 flattened_line_242, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000148 Xanthomonas translucens strain CR31 flattened_line_296, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000236 Xanthomonas translucens strain CR31 flattened_line_471, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000061 Xanthomonas translucens strain CR31 flattened_line_120, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000294 Xanthomonas translucens strain CR31 flattened_line_587, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000250 Xanthomonas translucens strain CR31 flattened_line_499, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000143 Xanthomonas translucens strain CR31 flattened_line_286, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000276 Xanthomonas translucens strain CR31 flattened_line_551, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000079 Xanthomonas translucens strain CR31 flattened_line_156, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000242 Xanthomonas translucens strain CR31 flattened_line_483, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000238 Xanthomonas translucens strain CR31 flattened_line_475, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000087 Xanthomonas translucens strain CR31 flattened_line_172, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000278 Xanthomonas translucens strain CR31 flattened_line_555, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000208 Xanthomonas translucens strain CR31 flattened_line_415, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000020 Xanthomonas translucens strain CR31 flattened_line_38, whole genome shotgun sequence 1 crisprs DinG 0 0 0 0
NZ_LNVJ01000019 Xanthomonas translucens strain CR31 flattened_line_36, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000104 Xanthomonas translucens strain CR31 flattened_line_206, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000272 Xanthomonas translucens strain CR31 flattened_line_543, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000281 Xanthomonas translucens strain CR31 flattened_line_561, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000262 Xanthomonas translucens strain CR31 flattened_line_523, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000173 Xanthomonas translucens strain CR31 flattened_line_346, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000145 Xanthomonas translucens strain CR31 flattened_line_290, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000112 Xanthomonas translucens strain CR31 flattened_line_224, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000002 Xanthomonas translucens strain CR31 flattened_line_2, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000300 Xanthomonas translucens strain CR31 flattened_line_599, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000147 Xanthomonas translucens strain CR31 flattened_line_294, whole genome shotgun sequence 1 crisprs NA 2 14 0 0
NZ_LNVJ01000203 Xanthomonas translucens strain CR31 flattened_line_405, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000288 Xanthomonas translucens strain CR31 flattened_line_575, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000057 Xanthomonas translucens strain CR31 flattened_line_112, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000007 Xanthomonas translucens strain CR31 flattened_line_12, whole genome shotgun sequence 0 crisprs DEDDh,csa3 0 0 0 0
NZ_LNVJ01000130 Xanthomonas translucens strain CR31 flattened_line_260, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000022 Xanthomonas translucens strain CR31 flattened_line_42, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000014 Xanthomonas translucens strain CR31 flattened_line_26, whole genome shotgun sequence 0 crisprs WYL 0 0 0 0
NZ_LNVJ01000030 Xanthomonas translucens strain CR31 flattened_line_58, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000124 Xanthomonas translucens strain CR31 flattened_line_248, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000201 Xanthomonas translucens strain CR31 flattened_line_401, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000140 Xanthomonas translucens strain CR31 flattened_line_280, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000235 Xanthomonas translucens strain CR31 flattened_line_469, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000029 Xanthomonas translucens strain CR31 flattened_line_56, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000108 Xanthomonas translucens strain CR31 flattened_line_216, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000135 Xanthomonas translucens strain CR31 flattened_line_270, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000110 Xanthomonas translucens strain CR31 flattened_line_220, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000129 Xanthomonas translucens strain CR31 flattened_line_258, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000146 Xanthomonas translucens strain CR31 flattened_line_292, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000220 Xanthomonas translucens strain CR31 flattened_line_439, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000178 Xanthomonas translucens strain CR31 flattened_line_356, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000190 Xanthomonas translucens strain CR31 flattened_line_380, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000210 Xanthomonas translucens strain CR31 flattened_line_419, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000111 Xanthomonas translucens strain CR31 flattened_line_222, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_LNVJ01000191 Xanthomonas translucens strain CR31 flattened_line_382, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000025 Xanthomonas translucens strain CR31 flattened_line_48, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000257 Xanthomonas translucens strain CR31 flattened_line_513, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000114 Xanthomonas translucens strain CR31 flattened_line_228, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000234 Xanthomonas translucens strain CR31 flattened_line_467, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000275 Xanthomonas translucens strain CR31 flattened_line_549, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000037 Xanthomonas translucens strain CR31 flattened_line_72, whole genome shotgun sequence 0 crisprs cas3 0 0 0 0
NZ_LNVJ01000016 Xanthomonas translucens strain CR31 flattened_line_30, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000039 Xanthomonas translucens strain CR31 flattened_line_76, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000024 Xanthomonas translucens strain CR31 flattened_line_46, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000003 Xanthomonas translucens strain CR31 flattened_line_4, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000150 Xanthomonas translucens strain CR31 flattened_line_300, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000075 Xanthomonas translucens strain CR31 flattened_line_148, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000133 Xanthomonas translucens strain CR31 flattened_line_266, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000168 Xanthomonas translucens strain CR31 flattened_line_336, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000151 Xanthomonas translucens strain CR31 flattened_line_302, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000227 Xanthomonas translucens strain CR31 flattened_line_453, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000068 Xanthomonas translucens strain CR31 flattened_line_134, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000163 Xanthomonas translucens strain CR31 flattened_line_326, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000287 Xanthomonas translucens strain CR31 flattened_line_573, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000080 Xanthomonas translucens strain CR31 flattened_line_158, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_LNVJ01000283 Xanthomonas translucens strain CR31 flattened_line_565, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000199 Xanthomonas translucens strain CR31 flattened_line_397, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000183 Xanthomonas translucens strain CR31 flattened_line_366, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000161 Xanthomonas translucens strain CR31 flattened_line_322, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000149 Xanthomonas translucens strain CR31 flattened_line_298, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000261 Xanthomonas translucens strain CR31 flattened_line_521, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000269 Xanthomonas translucens strain CR31 flattened_line_537, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000177 Xanthomonas translucens strain CR31 flattened_line_354, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000217 Xanthomonas translucens strain CR31 flattened_line_433, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000132 Xanthomonas translucens strain CR31 flattened_line_264, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000231 Xanthomonas translucens strain CR31 flattened_line_461, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000292 Xanthomonas translucens strain CR31 flattened_line_583, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000258 Xanthomonas translucens strain CR31 flattened_line_515, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000260 Xanthomonas translucens strain CR31 flattened_line_519, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000067 Xanthomonas translucens strain CR31 flattened_line_132, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000296 Xanthomonas translucens strain CR31 flattened_line_591, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000049 Xanthomonas translucens strain CR31 flattened_line_96, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000028 Xanthomonas translucens strain CR31 flattened_line_54, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000096 Xanthomonas translucens strain CR31 flattened_line_190, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000054 Xanthomonas translucens strain CR31 flattened_line_106, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000131 Xanthomonas translucens strain CR31 flattened_line_262, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000290 Xanthomonas translucens strain CR31 flattened_line_579, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000289 Xanthomonas translucens strain CR31 flattened_line_577, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000139 Xanthomonas translucens strain CR31 flattened_line_278, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000056 Xanthomonas translucens strain CR31 flattened_line_110, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000194 Xanthomonas translucens strain CR31 flattened_line_388, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000195 Xanthomonas translucens strain CR31 flattened_line_390, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000042 Xanthomonas translucens strain CR31 flattened_line_82, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000255 Xanthomonas translucens strain CR31 flattened_line_509, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000120 Xanthomonas translucens strain CR31 flattened_line_240, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000197 Xanthomonas translucens strain CR31 flattened_line_393, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000248 Xanthomonas translucens strain CR31 flattened_line_495, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000033 Xanthomonas translucens strain CR31 flattened_line_64, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000047 Xanthomonas translucens strain CR31 flattened_line_92, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000206 Xanthomonas translucens strain CR31 flattened_line_411, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000116 Xanthomonas translucens strain CR31 flattened_line_232, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000259 Xanthomonas translucens strain CR31 flattened_line_517, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000017 Xanthomonas translucens strain CR31 flattened_line_32, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000138 Xanthomonas translucens strain CR31 flattened_line_276, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000100 Xanthomonas translucens strain CR31 flattened_line_198, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000172 Xanthomonas translucens strain CR31 flattened_line_344, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000222 Xanthomonas translucens strain CR31 flattened_line_443, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000009 Xanthomonas translucens strain CR31 flattened_line_16, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000053 Xanthomonas translucens strain CR31 flattened_line_104, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000302 Xanthomonas translucens strain CR31 flattened_line_603, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000267 Xanthomonas translucens strain CR31 flattened_line_533, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000305 Xanthomonas translucens strain CR31 flattened_line_609, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000181 Xanthomonas translucens strain CR31 flattened_line_362, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000109 Xanthomonas translucens strain CR31 flattened_line_218, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000156 Xanthomonas translucens strain CR31 flattened_line_312, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000270 Xanthomonas translucens strain CR31 flattened_line_539, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000188 Xanthomonas translucens strain CR31 flattened_line_376, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000215 Xanthomonas translucens strain CR31 flattened_line_429, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000196 Xanthomonas translucens strain CR31 flattened_line_391, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000224 Xanthomonas translucens strain CR31 flattened_line_447, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000298 Xanthomonas translucens strain CR31 flattened_line_595, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000299 Xanthomonas translucens strain CR31 flattened_line_597, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000198 Xanthomonas translucens strain CR31 flattened_line_395, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000136 Xanthomonas translucens strain CR31 flattened_line_272, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000041 Xanthomonas translucens strain CR31 flattened_line_80, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000274 Xanthomonas translucens strain CR31 flattened_line_547, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000134 Xanthomonas translucens strain CR31 flattened_line_268, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000279 Xanthomonas translucens strain CR31 flattened_line_557, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000204 Xanthomonas translucens strain CR31 flattened_line_407, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000064 Xanthomonas translucens strain CR31 flattened_line_126, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000137 Xanthomonas translucens strain CR31 flattened_line_274, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000202 Xanthomonas translucens strain CR31 flattened_line_403, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000252 Xanthomonas translucens strain CR31 flattened_line_503, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000207 Xanthomonas translucens strain CR31 flattened_line_413, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000142 Xanthomonas translucens strain CR31 flattened_line_284, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000221 Xanthomonas translucens strain CR31 flattened_line_441, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000125 Xanthomonas translucens strain CR31 flattened_line_250, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000081 Xanthomonas translucens strain CR31 flattened_line_160, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000073 Xanthomonas translucens strain CR31 flattened_line_144, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000291 Xanthomonas translucens strain CR31 flattened_line_581, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000084 Xanthomonas translucens strain CR31 flattened_line_166, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000205 Xanthomonas translucens strain CR31 flattened_line_409, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000026 Xanthomonas translucens strain CR31 flattened_line_50, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000046 Xanthomonas translucens strain CR31 flattened_line_90, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000118 Xanthomonas translucens strain CR31 flattened_line_236, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000012 Xanthomonas translucens strain CR31 flattened_line_22, whole genome shotgun sequence 0 crisprs DEDDh 0 0 0 0
NZ_LNVJ01000175 Xanthomonas translucens strain CR31 flattened_line_350, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000011 Xanthomonas translucens strain CR31 flattened_line_20, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000232 Xanthomonas translucens strain CR31 flattened_line_463, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000044 Xanthomonas translucens strain CR31 flattened_line_86, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000277 Xanthomonas translucens strain CR31 flattened_line_553, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000170 Xanthomonas translucens strain CR31 flattened_line_340, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000076 Xanthomonas translucens strain CR31 flattened_line_150, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000245 Xanthomonas translucens strain CR31 flattened_line_489, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000123 Xanthomonas translucens strain CR31 flattened_line_246, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000086 Xanthomonas translucens strain CR31 flattened_line_170, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000268 Xanthomonas translucens strain CR31 flattened_line_535, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000015 Xanthomonas translucens strain CR31 flattened_line_28, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_LNVJ01000241 Xanthomonas translucens strain CR31 flattened_line_481, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000285 Xanthomonas translucens strain CR31 flattened_line_569, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000071 Xanthomonas translucens strain CR31 flattened_line_140, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000065 Xanthomonas translucens strain CR31 flattened_line_128, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000097 Xanthomonas translucens strain CR31 flattened_line_192, whole genome shotgun sequence 0 crisprs NA 0 0 0 1
NZ_LNVJ01000251 Xanthomonas translucens strain CR31 flattened_line_501, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000126 Xanthomonas translucens strain CR31 flattened_line_252, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000223 Xanthomonas translucens strain CR31 flattened_line_445, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000266 Xanthomonas translucens strain CR31 flattened_line_531, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000243 Xanthomonas translucens strain CR31 flattened_line_485, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000182 Xanthomonas translucens strain CR31 flattened_line_364, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000189 Xanthomonas translucens strain CR31 flattened_line_378, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000169 Xanthomonas translucens strain CR31 flattened_line_338, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000282 Xanthomonas translucens strain CR31 flattened_line_563, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000233 Xanthomonas translucens strain CR31 flattened_line_465, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000043 Xanthomonas translucens strain CR31 flattened_line_84, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000192 Xanthomonas translucens strain CR31 flattened_line_384, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000200 Xanthomonas translucens strain CR31 flattened_line_399, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000051 Xanthomonas translucens strain CR31 flattened_line_100, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_LNVJ01000023 Xanthomonas translucens strain CR31 flattened_line_44, whole genome shotgun sequence 3 crisprs NA 0 54 0 0
NZ_LNVJ01000035 Xanthomonas translucens strain CR31 flattened_line_68, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_LNVJ01000180 Xanthomonas translucens strain CR31 flattened_line_360, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000226 Xanthomonas translucens strain CR31 flattened_line_451, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000127 Xanthomonas translucens strain CR31 flattened_line_254, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000230 Xanthomonas translucens strain CR31 flattened_line_459, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000077 Xanthomonas translucens strain CR31 flattened_line_152, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000085 Xanthomonas translucens strain CR31 flattened_line_168, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000031 Xanthomonas translucens strain CR31 flattened_line_60, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000101 Xanthomonas translucens strain CR31 flattened_line_200, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000018 Xanthomonas translucens strain CR31 flattened_line_34, whole genome shotgun sequence 1 crisprs cas2,cas1,cas4,cas7,cas8c,cas5,cas3 17 46 0 0
NZ_LNVJ01000216 Xanthomonas translucens strain CR31 flattened_line_431, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000094 Xanthomonas translucens strain CR31 flattened_line_186, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000001 Xanthomonas translucens strain CR31 flattened_line_0, whole genome shotgun sequence 0 crisprs NA 0 0 1 0
NZ_LNVJ01000246 Xanthomonas translucens strain CR31 flattened_line_491, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000103 Xanthomonas translucens strain CR31 flattened_line_204, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000229 Xanthomonas translucens strain CR31 flattened_line_457, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000082 Xanthomonas translucens strain CR31 flattened_line_162, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000193 Xanthomonas translucens strain CR31 flattened_line_386, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000102 Xanthomonas translucens strain CR31 flattened_line_202, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000098 Xanthomonas translucens strain CR31 flattened_line_194, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000006 Xanthomonas translucens strain CR31 flattened_line_10, whole genome shotgun sequence 1 crisprs NA 0 0 0 0
NZ_LNVJ01000218 Xanthomonas translucens strain CR31 flattened_line_435, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000264 Xanthomonas translucens strain CR31 flattened_line_527, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000062 Xanthomonas translucens strain CR31 flattened_line_122, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000055 Xanthomonas translucens strain CR31 flattened_line_108, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000034 Xanthomonas translucens strain CR31 flattened_line_66, whole genome shotgun sequence 0 crisprs NA 0 0 1 1
NZ_LNVJ01000284 Xanthomonas translucens strain CR31 flattened_line_567, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000088 Xanthomonas translucens strain CR31 flattened_line_174, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000164 Xanthomonas translucens strain CR31 flattened_line_328, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000157 Xanthomonas translucens strain CR31 flattened_line_314, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000066 Xanthomonas translucens strain CR31 flattened_line_130, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000256 Xanthomonas translucens strain CR31 flattened_line_511, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000176 Xanthomonas translucens strain CR31 flattened_line_352, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000040 Xanthomonas translucens strain CR31 flattened_line_78, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000166 Xanthomonas translucens strain CR31 flattened_line_332, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000032 Xanthomonas translucens strain CR31 flattened_line_62, whole genome shotgun sequence 0 crisprs csa3 0 0 0 0
NZ_LNVJ01000105 Xanthomonas translucens strain CR31 flattened_line_208, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000186 Xanthomonas translucens strain CR31 flattened_line_372, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000089 Xanthomonas translucens strain CR31 flattened_line_176, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000286 Xanthomonas translucens strain CR31 flattened_line_571, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000010 Xanthomonas translucens strain CR31 flattened_line_18, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000212 Xanthomonas translucens strain CR31 flattened_line_423, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000141 Xanthomonas translucens strain CR31 flattened_line_282, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000249 Xanthomonas translucens strain CR31 flattened_line_497, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000106 Xanthomonas translucens strain CR31 flattened_line_210, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000122 Xanthomonas translucens strain CR31 flattened_line_244, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000008 Xanthomonas translucens strain CR31 flattened_line_14, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000063 Xanthomonas translucens strain CR31 flattened_line_124, whole genome shotgun sequence 0 crisprs NA 0 0 0 0
NZ_LNVJ01000297 Xanthomonas translucens strain CR31 flattened_line_593, whole genome shotgun sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_LNVJ01000018
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNVJ01000018_1 52876-57187 TypeI I-C
65 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_LNVJ01000018_1 1.1|52907|35|NZ_LNVJ01000018|CRISPRCasFinder,CRT 52907-52941 35 NZ_LNVJ01000034.1 45014-45048 1 0.971
NZ_LNVJ01000018_1 1.2|52973|33|NZ_LNVJ01000018|CRISPRCasFinder,CRT 52973-53005 33 NZ_LNVJ01000034.1 40189-40221 0 1.0
NZ_LNVJ01000018_1 1.6|53236|34|NZ_LNVJ01000018|CRT 53236-53269 34 NZ_LNVJ01000034.1 20430-20463 0 1.0
NZ_LNVJ01000018_1 1.19|54089|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder 54089-54122 34 NZ_LNVJ01000034.1 23887-23920 0 1.0
NZ_LNVJ01000018_1 1.21|54220|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder 54220-54254 35 NZ_LNVJ01000034.1 26204-26238 0 1.0
NZ_LNVJ01000018_1 1.30|54819|37|NZ_LNVJ01000018|CRT,CRISPRCasFinder 54819-54855 37 NZ_LNVJ01000130.1 490-526 2 0.946
NZ_LNVJ01000018_1 1.50|56135|36|NZ_LNVJ01000018|CRT,CRISPRCasFinder 56135-56170 36 NZ_LNVJ01000119.1 3019-3054 1 0.972
NZ_LNVJ01000018_1 1.53|56335|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder 56335-56369 35 NZ_LNVJ01000182.1 146-180 0 1.0
NZ_LNVJ01000018_1 1.59|56731|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder 56731-56764 34 NZ_LNVJ01000119.1 2436-2469 2 0.941
NZ_LNVJ01000018_1 1.66|52974|33|NZ_LNVJ01000018|PILER-CR 52974-53006 33 NZ_LNVJ01000034.1 40189-40221 0 1.0
NZ_LNVJ01000018_1 1.70|53241|34|NZ_LNVJ01000018|PILER-CR 53241-53274 34 NZ_LNVJ01000034.1 20430-20463 0 1.0
NZ_LNVJ01000018_1 1.83|54106|34|NZ_LNVJ01000018|PILER-CR 54106-54139 34 NZ_LNVJ01000034.1 23887-23920 0 1.0
NZ_LNVJ01000018_1 1.85|54239|35|NZ_LNVJ01000018|PILER-CR 54239-54273 35 NZ_LNVJ01000034.1 26204-26238 0 1.0
NZ_LNVJ01000018_1 1.94|54847|37|NZ_LNVJ01000018|PILER-CR 54847-54883 37 NZ_LNVJ01000130.1 490-526 2 0.946
NZ_LNVJ01000018_1 1.114|56183|36|NZ_LNVJ01000018|PILER-CR 56183-56218 36 NZ_LNVJ01000119.1 3019-3054 1 0.972
NZ_LNVJ01000018_1 1.117|56386|35|NZ_LNVJ01000018|PILER-CR 56386-56420 35 NZ_LNVJ01000182.1 146-180 0 1.0
NZ_LNVJ01000018_1 1.123|56788|34|NZ_LNVJ01000018|PILER-CR 56788-56821 34 NZ_LNVJ01000119.1 2436-2469 2 0.941

1. spacer 1.1|52907|35|NZ_LNVJ01000018|CRISPRCasFinder,CRT matches to position: 45014-45048, mismatch: 1, identity: 0.971

gatgtcgagtggcgccgggacgacatggcatgggt	CRISPR spacer
gatgtcgagtggcgccgggacgacatggcttgggt	Protospacer
***************************** *****

2. spacer 1.2|52973|33|NZ_LNVJ01000018|CRISPRCasFinder,CRT matches to position: 40189-40221, mismatch: 0, identity: 1.0

accaccctcgaagttgccggtgacgtagtacgg	CRISPR spacer
accaccctcgaagttgccggtgacgtagtacgg	Protospacer
*********************************

3. spacer 1.6|53236|34|NZ_LNVJ01000018|CRT matches to position: 20430-20463, mismatch: 0, identity: 1.0

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gccgcgccggcgccgcggaccatcccgacttgga	Protospacer
**********************************

4. spacer 1.19|54089|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to position: 23887-23920, mismatch: 0, identity: 1.0

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgccgctcttgccacatccga	Protospacer
**********************************

5. spacer 1.21|54220|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to position: 26204-26238, mismatch: 0, identity: 1.0

gagcggttcagctcaatctccggccagagactgcg	CRISPR spacer
gagcggttcagctcaatctccggccagagactgcg	Protospacer
***********************************

6. spacer 1.30|54819|37|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to position: 490-526, mismatch: 2, identity: 0.946

gcggcgatggtggccctggcccggcacagttgggagg	CRISPR spacer
gcggcgatggtggccctggcccgccacagctgggagg	Protospacer
*********************** *****.*******

7. spacer 1.50|56135|36|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to position: 3019-3054, mismatch: 1, identity: 0.972

atacttgccgtcctcggtgtgcttgatttcgcccat	CRISPR spacer
atacttgccgtcctcgctgtgcttgatttcgcccat	Protospacer
**************** *******************

8. spacer 1.53|56335|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to position: 146-180, mismatch: 0, identity: 1.0

gcggaaggtctgcggtctcccggccagcacatgct	CRISPR spacer
gcggaaggtctgcggtctcccggccagcacatgct	Protospacer
***********************************

9. spacer 1.59|56731|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to position: 2436-2469, mismatch: 2, identity: 0.941

gccggcacaacgtgctggcccgggtccagaaggt	CRISPR spacer
gccggcacaacgtgctggcccgggtgcggaaggt	Protospacer
************************* *.******

10. spacer 1.66|52974|33|NZ_LNVJ01000018|PILER-CR matches to position: 40189-40221, mismatch: 0, identity: 1.0

accaccctcgaagttgccggtgacgtagtacgg	CRISPR spacer
accaccctcgaagttgccggtgacgtagtacgg	Protospacer
*********************************

11. spacer 1.70|53241|34|NZ_LNVJ01000018|PILER-CR matches to position: 20430-20463, mismatch: 0, identity: 1.0

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gccgcgccggcgccgcggaccatcccgacttgga	Protospacer
**********************************

12. spacer 1.83|54106|34|NZ_LNVJ01000018|PILER-CR matches to position: 23887-23920, mismatch: 0, identity: 1.0

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgccgctcttgccacatccga	Protospacer
**********************************

13. spacer 1.85|54239|35|NZ_LNVJ01000018|PILER-CR matches to position: 26204-26238, mismatch: 0, identity: 1.0

gagcggttcagctcaatctccggccagagactgcg	CRISPR spacer
gagcggttcagctcaatctccggccagagactgcg	Protospacer
***********************************

14. spacer 1.94|54847|37|NZ_LNVJ01000018|PILER-CR matches to position: 490-526, mismatch: 2, identity: 0.946

gcggcgatggtggccctggcccggcacagttgggagg	CRISPR spacer
gcggcgatggtggccctggcccgccacagctgggagg	Protospacer
*********************** *****.*******

15. spacer 1.114|56183|36|NZ_LNVJ01000018|PILER-CR matches to position: 3019-3054, mismatch: 1, identity: 0.972

atacttgccgtcctcggtgtgcttgatttcgcccat	CRISPR spacer
atacttgccgtcctcgctgtgcttgatttcgcccat	Protospacer
**************** *******************

16. spacer 1.117|56386|35|NZ_LNVJ01000018|PILER-CR matches to position: 146-180, mismatch: 0, identity: 1.0

gcggaaggtctgcggtctcccggccagcacatgct	CRISPR spacer
gcggaaggtctgcggtctcccggccagcacatgct	Protospacer
***********************************

17. spacer 1.123|56788|34|NZ_LNVJ01000018|PILER-CR matches to position: 2436-2469, mismatch: 2, identity: 0.941

gccggcacaacgtgctggcccgggtccagaaggt	CRISPR spacer
gccggcacaacgtgctggcccgggtgcggaaggt	Protospacer
************************* *.******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LNVJ01000018_1 1.36|55214|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder 55214-55247 34 NC_030937 Xanthomonas phage f30-Xaj, complete genome 27643-27676 1 0.971
NZ_LNVJ01000018_1 1.36|55214|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder 55214-55247 34 NC_030928 Xanthomonas phage f20-Xaj, complete genome 41357-41390 1 0.971
NZ_LNVJ01000018_1 1.100|55248|34|NZ_LNVJ01000018|PILER-CR 55248-55281 34 NC_030937 Xanthomonas phage f30-Xaj, complete genome 27643-27676 1 0.971
NZ_LNVJ01000018_1 1.100|55248|34|NZ_LNVJ01000018|PILER-CR 55248-55281 34 NC_030928 Xanthomonas phage f20-Xaj, complete genome 41357-41390 1 0.971
NZ_LNVJ01000018_1 1.49|56068|36|NZ_LNVJ01000018|CRT,CRISPRCasFinder 56068-56103 36 NC_030937 Xanthomonas phage f30-Xaj, complete genome 27393-27428 2 0.944
NZ_LNVJ01000018_1 1.49|56068|36|NZ_LNVJ01000018|CRT,CRISPRCasFinder 56068-56103 36 NC_030928 Xanthomonas phage f20-Xaj, complete genome 41107-41142 2 0.944
NZ_LNVJ01000018_1 1.113|56115|36|NZ_LNVJ01000018|PILER-CR 56115-56150 36 NC_030937 Xanthomonas phage f30-Xaj, complete genome 27393-27428 2 0.944
NZ_LNVJ01000018_1 1.113|56115|36|NZ_LNVJ01000018|PILER-CR 56115-56150 36 NC_030928 Xanthomonas phage f20-Xaj, complete genome 41107-41142 2 0.944
NZ_LNVJ01000018_1 1.43|55674|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder 55674-55707 34 MN478375 Bacteriophage Titan-X, complete genome 2144-2177 3 0.912
NZ_LNVJ01000018_1 1.107|55715|34|NZ_LNVJ01000018|PILER-CR 55715-55748 34 MN478375 Bacteriophage Titan-X, complete genome 2144-2177 3 0.912
NZ_LNVJ01000018_1 1.43|55674|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder 55674-55707 34 NC_047762 Xanthomonas phage XAJ24, complete genome 2208-2241 4 0.882
NZ_LNVJ01000018_1 1.107|55715|34|NZ_LNVJ01000018|PILER-CR 55715-55748 34 NC_047762 Xanthomonas phage XAJ24, complete genome 2208-2241 4 0.882
NZ_LNVJ01000018_1 1.9|53435|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder 53435-53469 35 NC_020205 Xanthomonas citri phage CP2 DNA, complete genome 6091-6125 5 0.857
NZ_LNVJ01000018_1 1.43|55674|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder 55674-55707 34 NC_022982 Xylella phage Paz, complete genome 2387-2420 5 0.853
NZ_LNVJ01000018_1 1.73|53442|35|NZ_LNVJ01000018|PILER-CR 53442-53476 35 NC_020205 Xanthomonas citri phage CP2 DNA, complete genome 6091-6125 5 0.857
NZ_LNVJ01000018_1 1.107|55715|34|NZ_LNVJ01000018|PILER-CR 55715-55748 34 NC_022982 Xylella phage Paz, complete genome 2387-2420 5 0.853
NZ_LNVJ01000018_1 1.20|54154|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder 54154-54188 35 NC_023006 Pseudomonas phage PPpW-3 DNA, complete sequence 36701-36735 6 0.829
NZ_LNVJ01000018_1 1.84|54172|35|NZ_LNVJ01000018|PILER-CR 54172-54206 35 NC_023006 Pseudomonas phage PPpW-3 DNA, complete sequence 36701-36735 6 0.829
NZ_LNVJ01000018_1 1.6|53236|34|NZ_LNVJ01000018|CRT 53236-53269 34 MN234219 Mycobacterium phage Mercurio, complete genome 14561-14594 7 0.794
NZ_LNVJ01000018_1 1.11|53567|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder 53567-53600 34 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 359039-359072 7 0.794
NZ_LNVJ01000018_1 1.11|53567|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder 53567-53600 34 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 376258-376291 7 0.794
NZ_LNVJ01000018_1 1.11|53567|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder 53567-53600 34 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 199796-199829 7 0.794
NZ_LNVJ01000018_1 1.11|53567|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder 53567-53600 34 AF394895 Actinophage Q5 replication protein gene, partial cds 638-671 7 0.794
NZ_LNVJ01000018_1 1.25|54487|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder 54487-54521 35 NZ_CP028969 Aminobacter sp. MSH1 plasmid pUSP1, complete sequence 363031-363065 7 0.8
NZ_LNVJ01000018_1 1.25|54487|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder 54487-54521 35 NZ_CP026266 Aminobacter sp. MSH1 plasmid pAM01, complete sequence 360217-360251 7 0.8
NZ_LNVJ01000018_1 1.70|53241|34|NZ_LNVJ01000018|PILER-CR 53241-53274 34 MN234219 Mycobacterium phage Mercurio, complete genome 14561-14594 7 0.794
NZ_LNVJ01000018_1 1.75|53576|34|NZ_LNVJ01000018|PILER-CR 53576-53609 34 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 359039-359072 7 0.794
NZ_LNVJ01000018_1 1.75|53576|34|NZ_LNVJ01000018|PILER-CR 53576-53609 34 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 376258-376291 7 0.794
NZ_LNVJ01000018_1 1.75|53576|34|NZ_LNVJ01000018|PILER-CR 53576-53609 34 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 199796-199829 7 0.794
NZ_LNVJ01000018_1 1.75|53576|34|NZ_LNVJ01000018|PILER-CR 53576-53609 34 AF394895 Actinophage Q5 replication protein gene, partial cds 638-671 7 0.794
NZ_LNVJ01000018_1 1.89|54510|35|NZ_LNVJ01000018|PILER-CR 54510-54544 35 NZ_CP028969 Aminobacter sp. MSH1 plasmid pUSP1, complete sequence 363031-363065 7 0.8
NZ_LNVJ01000018_1 1.89|54510|35|NZ_LNVJ01000018|PILER-CR 54510-54544 35 NZ_CP026266 Aminobacter sp. MSH1 plasmid pAM01, complete sequence 360217-360251 7 0.8
NZ_LNVJ01000018_1 1.6|53236|34|NZ_LNVJ01000018|CRT 53236-53269 34 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 35823-35856 8 0.765
NZ_LNVJ01000018_1 1.6|53236|34|NZ_LNVJ01000018|CRT 53236-53269 34 MN234185 Mycobacterium phage Lemuria, complete genome 13917-13950 8 0.765
NZ_LNVJ01000018_1 1.18|54022|36|NZ_LNVJ01000018|CRT,CRISPRCasFinder 54022-54057 36 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 726279-726314 8 0.778
NZ_LNVJ01000018_1 1.19|54089|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder 54089-54122 34 NZ_CP050105 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence 189496-189529 8 0.765
NZ_LNVJ01000018_1 1.19|54089|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder 54089-54122 34 NZ_CP050110 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence 189498-189531 8 0.765
NZ_LNVJ01000018_1 1.19|54089|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder 54089-54122 34 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 76281-76314 8 0.765
NZ_LNVJ01000018_1 1.22|54286|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder 54286-54320 35 KX911187 Rathayibacter phage NCPPB3778, complete genome 7785-7819 8 0.771
NZ_LNVJ01000018_1 1.27|54620|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder 54620-54654 35 MG757155 Gordonia phage Boneham, complete genome 26715-26749 8 0.771
NZ_LNVJ01000018_1 1.27|54620|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder 54620-54654 35 NC_048820 Gordonia phage Jellybones, complete genome 26735-26769 8 0.771
NZ_LNVJ01000018_1 1.27|54620|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder 54620-54654 35 MK433263 Gordonia phage FelixAlejandro, complete genome 26913-26947 8 0.771
NZ_LNVJ01000018_1 1.27|54620|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder 54620-54654 35 MK359302 Gordonia phage Sombrero, complete genome 26744-26778 8 0.771
NZ_LNVJ01000018_1 1.27|54620|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder 54620-54654 35 NC_047892 Gordonia phage BirksAndSocks, complete genome 26716-26750 8 0.771
NZ_LNVJ01000018_1 1.27|54620|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder 54620-54654 35 MG770214 Gordonia phage SteveFrench, complete genome 27478-27512 8 0.771
NZ_LNVJ01000018_1 1.27|54620|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder 54620-54654 35 MK433267 Gordonia phage Butterball, complete genome 26715-26749 8 0.771
NZ_LNVJ01000018_1 1.39|55411|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder 55411-55445 35 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 181092-181126 8 0.771
NZ_LNVJ01000018_1 1.45|55806|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder 55806-55839 34 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 68749-68782 8 0.765
NZ_LNVJ01000018_1 1.70|53241|34|NZ_LNVJ01000018|PILER-CR 53241-53274 34 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 35823-35856 8 0.765
NZ_LNVJ01000018_1 1.70|53241|34|NZ_LNVJ01000018|PILER-CR 53241-53274 34 MN234185 Mycobacterium phage Lemuria, complete genome 13917-13950 8 0.765
NZ_LNVJ01000018_1 1.82|54038|36|NZ_LNVJ01000018|PILER-CR 54038-54073 36 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 726279-726314 8 0.778
NZ_LNVJ01000018_1 1.83|54106|34|NZ_LNVJ01000018|PILER-CR 54106-54139 34 NZ_CP050105 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence 189496-189529 8 0.765
NZ_LNVJ01000018_1 1.83|54106|34|NZ_LNVJ01000018|PILER-CR 54106-54139 34 NZ_CP050110 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence 189498-189531 8 0.765
NZ_LNVJ01000018_1 1.83|54106|34|NZ_LNVJ01000018|PILER-CR 54106-54139 34 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 76281-76314 8 0.765
NZ_LNVJ01000018_1 1.86|54306|35|NZ_LNVJ01000018|PILER-CR 54306-54340 35 KX911187 Rathayibacter phage NCPPB3778, complete genome 7785-7819 8 0.771
NZ_LNVJ01000018_1 1.91|54645|35|NZ_LNVJ01000018|PILER-CR 54645-54679 35 MG757155 Gordonia phage Boneham, complete genome 26715-26749 8 0.771
NZ_LNVJ01000018_1 1.91|54645|35|NZ_LNVJ01000018|PILER-CR 54645-54679 35 NC_048820 Gordonia phage Jellybones, complete genome 26735-26769 8 0.771
NZ_LNVJ01000018_1 1.91|54645|35|NZ_LNVJ01000018|PILER-CR 54645-54679 35 MK433263 Gordonia phage FelixAlejandro, complete genome 26913-26947 8 0.771
NZ_LNVJ01000018_1 1.91|54645|35|NZ_LNVJ01000018|PILER-CR 54645-54679 35 MK359302 Gordonia phage Sombrero, complete genome 26744-26778 8 0.771
NZ_LNVJ01000018_1 1.91|54645|35|NZ_LNVJ01000018|PILER-CR 54645-54679 35 NC_047892 Gordonia phage BirksAndSocks, complete genome 26716-26750 8 0.771
NZ_LNVJ01000018_1 1.91|54645|35|NZ_LNVJ01000018|PILER-CR 54645-54679 35 MG770214 Gordonia phage SteveFrench, complete genome 27478-27512 8 0.771
NZ_LNVJ01000018_1 1.91|54645|35|NZ_LNVJ01000018|PILER-CR 54645-54679 35 MK433267 Gordonia phage Butterball, complete genome 26715-26749 8 0.771
NZ_LNVJ01000018_1 1.103|55448|35|NZ_LNVJ01000018|PILER-CR 55448-55482 35 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 181092-181126 8 0.771
NZ_LNVJ01000018_1 1.109|55849|34|NZ_LNVJ01000018|PILER-CR 55849-55882 34 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 68749-68782 8 0.765
NZ_LNVJ01000018_1 1.6|53236|34|NZ_LNVJ01000018|CRT 53236-53269 34 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 375386-375419 9 0.735
NZ_LNVJ01000018_1 1.6|53236|34|NZ_LNVJ01000018|CRT 53236-53269 34 NZ_CP039918 Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence 26901-26934 9 0.735
NZ_LNVJ01000018_1 1.6|53236|34|NZ_LNVJ01000018|CRT 53236-53269 34 NZ_CP039905 Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623a, complete sequence 20386-20419 9 0.735
NZ_LNVJ01000018_1 1.6|53236|34|NZ_LNVJ01000018|CRT 53236-53269 34 NZ_CP039909 Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence 215244-215277 9 0.735
NZ_LNVJ01000018_1 1.16|53894|33|NZ_LNVJ01000018|CRT,CRISPRCasFinder 53894-53926 33 KX752698 Mycobacterium phage Tonenili, complete genome 149552-149584 9 0.727
NZ_LNVJ01000018_1 1.19|54089|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder 54089-54122 34 NZ_CP016462 Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence 97668-97701 9 0.735
NZ_LNVJ01000018_1 1.21|54220|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder 54220-54254 35 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1689129-1689163 9 0.743
NZ_LNVJ01000018_1 1.22|54286|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder 54286-54320 35 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 202811-202845 9 0.743
NZ_LNVJ01000018_1 1.45|55806|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder 55806-55839 34 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 97058-97091 9 0.735
NZ_LNVJ01000018_1 1.47|55936|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder 55936-55969 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2051325-2051358 9 0.735
NZ_LNVJ01000018_1 1.47|55936|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder 55936-55969 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2062297-2062330 9 0.735
NZ_LNVJ01000018_1 1.57|56601|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder 56601-56634 34 NZ_CP039640 Azospirillum sp. TSH100 plasmid p1, complete sequence 274754-274787 9 0.735
NZ_LNVJ01000018_1 1.70|53241|34|NZ_LNVJ01000018|PILER-CR 53241-53274 34 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 375386-375419 9 0.735
NZ_LNVJ01000018_1 1.70|53241|34|NZ_LNVJ01000018|PILER-CR 53241-53274 34 NZ_CP039918 Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence 26901-26934 9 0.735
NZ_LNVJ01000018_1 1.70|53241|34|NZ_LNVJ01000018|PILER-CR 53241-53274 34 NZ_CP039905 Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623a, complete sequence 20386-20419 9 0.735
NZ_LNVJ01000018_1 1.70|53241|34|NZ_LNVJ01000018|PILER-CR 53241-53274 34 NZ_CP039909 Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence 215244-215277 9 0.735
NZ_LNVJ01000018_1 1.80|53908|33|NZ_LNVJ01000018|PILER-CR 53908-53940 33 KX752698 Mycobacterium phage Tonenili, complete genome 149552-149584 9 0.727
NZ_LNVJ01000018_1 1.83|54106|34|NZ_LNVJ01000018|PILER-CR 54106-54139 34 NZ_CP016462 Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence 97668-97701 9 0.735
NZ_LNVJ01000018_1 1.85|54239|35|NZ_LNVJ01000018|PILER-CR 54239-54273 35 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1689129-1689163 9 0.743
NZ_LNVJ01000018_1 1.86|54306|35|NZ_LNVJ01000018|PILER-CR 54306-54340 35 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 202811-202845 9 0.743
NZ_LNVJ01000018_1 1.109|55849|34|NZ_LNVJ01000018|PILER-CR 55849-55882 34 NZ_CP010863 Marinovum algicola DG 898 plasmid pMaD8, complete sequence 97058-97091 9 0.735
NZ_LNVJ01000018_1 1.111|55981|34|NZ_LNVJ01000018|PILER-CR 55981-56014 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2051325-2051358 9 0.735
NZ_LNVJ01000018_1 1.111|55981|34|NZ_LNVJ01000018|PILER-CR 55981-56014 34 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 2062297-2062330 9 0.735
NZ_LNVJ01000018_1 1.121|56656|34|NZ_LNVJ01000018|PILER-CR 56656-56689 34 NZ_CP039640 Azospirillum sp. TSH100 plasmid p1, complete sequence 274754-274787 9 0.735
NZ_LNVJ01000018_1 1.6|53236|34|NZ_LNVJ01000018|CRT 53236-53269 34 MT024859 Gordonia phage DumpsterDude, complete genome 13125-13158 10 0.706
NZ_LNVJ01000018_1 1.18|54022|36|NZ_LNVJ01000018|CRT,CRISPRCasFinder 54022-54057 36 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1477450-1477485 10 0.722
NZ_LNVJ01000018_1 1.24|54419|37|NZ_LNVJ01000018|CRT,CRISPRCasFinder 54419-54455 37 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 149194-149230 10 0.73
NZ_LNVJ01000018_1 1.25|54487|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder 54487-54521 35 NZ_CP017242 Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence 50736-50770 10 0.714
NZ_LNVJ01000018_1 1.37|55279|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder 55279-55312 34 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1906752-1906785 10 0.706
NZ_LNVJ01000018_1 1.37|55279|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder 55279-55312 34 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 287381-287414 10 0.706
NZ_LNVJ01000018_1 1.52|56269|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder 56269-56303 35 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 260935-260969 10 0.714
NZ_LNVJ01000018_1 1.52|56269|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder 56269-56303 35 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 268047-268081 10 0.714
NZ_LNVJ01000018_1 1.57|56601|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder 56601-56634 34 NZ_CP045120 Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence 138837-138870 10 0.706
NZ_LNVJ01000018_1 1.70|53241|34|NZ_LNVJ01000018|PILER-CR 53241-53274 34 MT024859 Gordonia phage DumpsterDude, complete genome 13125-13158 10 0.706
NZ_LNVJ01000018_1 1.82|54038|36|NZ_LNVJ01000018|PILER-CR 54038-54073 36 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1477450-1477485 10 0.722
NZ_LNVJ01000018_1 1.88|54441|37|NZ_LNVJ01000018|PILER-CR 54441-54477 37 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 149194-149230 10 0.73
NZ_LNVJ01000018_1 1.89|54510|35|NZ_LNVJ01000018|PILER-CR 54510-54544 35 NZ_CP017242 Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence 50736-50770 10 0.714
NZ_LNVJ01000018_1 1.101|55314|34|NZ_LNVJ01000018|PILER-CR 55314-55347 34 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1906752-1906785 10 0.706
NZ_LNVJ01000018_1 1.101|55314|34|NZ_LNVJ01000018|PILER-CR 55314-55347 34 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 287381-287414 10 0.706
NZ_LNVJ01000018_1 1.116|56319|35|NZ_LNVJ01000018|PILER-CR 56319-56353 35 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 260935-260969 10 0.714
NZ_LNVJ01000018_1 1.116|56319|35|NZ_LNVJ01000018|PILER-CR 56319-56353 35 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 268047-268081 10 0.714
NZ_LNVJ01000018_1 1.121|56656|34|NZ_LNVJ01000018|PILER-CR 56656-56689 34 NZ_CP045120 Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence 138837-138870 10 0.706
NZ_LNVJ01000018_1 1.6|53236|34|NZ_LNVJ01000018|CRT 53236-53269 34 NC_048019 Gordonia phage Ruthy, complete genome 13235-13268 11 0.676
NZ_LNVJ01000018_1 1.14|53763|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder 53763-53796 34 MG518519 Streptomyces phage Manuel, complete genome 21300-21333 11 0.676
NZ_LNVJ01000018_1 1.22|54286|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder 54286-54320 35 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4200703-4200737 11 0.686
NZ_LNVJ01000018_1 1.37|55279|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder 55279-55312 34 MF360958 Salicola phage SCTP-2, complete genome 377440-377473 11 0.676
NZ_LNVJ01000018_1 1.37|55279|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder 55279-55312 34 MK388689 Pantoea phage vB_PagM_LIET2, complete genome 3237-3270 11 0.676
NZ_LNVJ01000018_1 1.45|55806|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder 55806-55839 34 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 715792-715825 11 0.676
NZ_LNVJ01000018_1 1.45|55806|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder 55806-55839 34 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 772682-772715 11 0.676
NZ_LNVJ01000018_1 1.59|56731|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder 56731-56764 34 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 608994-609027 11 0.676
NZ_LNVJ01000018_1 1.70|53241|34|NZ_LNVJ01000018|PILER-CR 53241-53274 34 NC_048019 Gordonia phage Ruthy, complete genome 13235-13268 11 0.676
NZ_LNVJ01000018_1 1.78|53775|34|NZ_LNVJ01000018|PILER-CR 53775-53808 34 MG518519 Streptomyces phage Manuel, complete genome 21300-21333 11 0.676
NZ_LNVJ01000018_1 1.86|54306|35|NZ_LNVJ01000018|PILER-CR 54306-54340 35 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4200703-4200737 11 0.686
NZ_LNVJ01000018_1 1.101|55314|34|NZ_LNVJ01000018|PILER-CR 55314-55347 34 MF360958 Salicola phage SCTP-2, complete genome 377440-377473 11 0.676
NZ_LNVJ01000018_1 1.101|55314|34|NZ_LNVJ01000018|PILER-CR 55314-55347 34 MK388689 Pantoea phage vB_PagM_LIET2, complete genome 3237-3270 11 0.676
NZ_LNVJ01000018_1 1.109|55849|34|NZ_LNVJ01000018|PILER-CR 55849-55882 34 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 715792-715825 11 0.676
NZ_LNVJ01000018_1 1.109|55849|34|NZ_LNVJ01000018|PILER-CR 55849-55882 34 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 772682-772715 11 0.676
NZ_LNVJ01000018_1 1.123|56788|34|NZ_LNVJ01000018|PILER-CR 56788-56821 34 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 608994-609027 11 0.676

1. spacer 1.36|55214|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 1, identity: 0.971

tcgacgagacggcccctcgctacggcggaaacct	CRISPR spacer
tggacgagacggcccctcgctacggcggaaacct	Protospacer
* ********************************

2. spacer 1.36|55214|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 1, identity: 0.971

tcgacgagacggcccctcgctacggcggaaacct	CRISPR spacer
tggacgagacggcccctcgctacggcggaaacct	Protospacer
* ********************************

3. spacer 1.100|55248|34|NZ_LNVJ01000018|PILER-CR matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 1, identity: 0.971

tcgacgagacggcccctcgctacggcggaaacct	CRISPR spacer
tggacgagacggcccctcgctacggcggaaacct	Protospacer
* ********************************

4. spacer 1.100|55248|34|NZ_LNVJ01000018|PILER-CR matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 1, identity: 0.971

tcgacgagacggcccctcgctacggcggaaacct	CRISPR spacer
tggacgagacggcccctcgctacggcggaaacct	Protospacer
* ********************************

5. spacer 1.49|56068|36|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 2, identity: 0.944

gtccacgtacatgccgttaaactcggcctcgatggt	CRISPR spacer
gtccacgtacatgccgttgtactcggcctcgatggt	Protospacer
******************. ****************

6. spacer 1.49|56068|36|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 2, identity: 0.944

gtccacgtacatgccgttaaactcggcctcgatggt	CRISPR spacer
gtccacgtacatgccgttgtactcggcctcgatggt	Protospacer
******************. ****************

7. spacer 1.113|56115|36|NZ_LNVJ01000018|PILER-CR matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 2, identity: 0.944

gtccacgtacatgccgttaaactcggcctcgatggt	CRISPR spacer
gtccacgtacatgccgttgtactcggcctcgatggt	Protospacer
******************. ****************

8. spacer 1.113|56115|36|NZ_LNVJ01000018|PILER-CR matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 2, identity: 0.944

gtccacgtacatgccgttaaactcggcctcgatggt	CRISPR spacer
gtccacgtacatgccgttgtactcggcctcgatggt	Protospacer
******************. ****************

9. spacer 1.43|55674|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to MN478375 (Bacteriophage Titan-X, complete genome) position: , mismatch: 3, identity: 0.912

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggtgctgcacactg	Protospacer
**********************.* ******** 

10. spacer 1.107|55715|34|NZ_LNVJ01000018|PILER-CR matches to MN478375 (Bacteriophage Titan-X, complete genome) position: , mismatch: 3, identity: 0.912

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggtgctgcacactg	Protospacer
**********************.* ******** 

11. spacer 1.43|55674|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NC_047762 (Xanthomonas phage XAJ24, complete genome) position: , mismatch: 4, identity: 0.882

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggtgatgcacatac	Protospacer
**********************.********. .

12. spacer 1.107|55715|34|NZ_LNVJ01000018|PILER-CR matches to NC_047762 (Xanthomonas phage XAJ24, complete genome) position: , mismatch: 4, identity: 0.882

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggtgatgcacatac	Protospacer
**********************.********. .

13. spacer 1.9|53435|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NC_020205 (Xanthomonas citri phage CP2 DNA, complete genome) position: , mismatch: 5, identity: 0.857

ctggaagtgaagaccagcaccaccaggttggccag	CRISPR spacer
ctgttcgtgaacaccagcacgaccaggttggccag	Protospacer
***   ***** ******** **************

14. spacer 1.43|55674|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NC_022982 (Xylella phage Paz, complete genome) position: , mismatch: 5, identity: 0.853

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggagatacacgcaa	Protospacer
********************** ***.***.*  

15. spacer 1.73|53442|35|NZ_LNVJ01000018|PILER-CR matches to NC_020205 (Xanthomonas citri phage CP2 DNA, complete genome) position: , mismatch: 5, identity: 0.857

ctggaagtgaagaccagcaccaccaggttggccag	CRISPR spacer
ctgttcgtgaacaccagcacgaccaggttggccag	Protospacer
***   ***** ******** **************

16. spacer 1.107|55715|34|NZ_LNVJ01000018|PILER-CR matches to NC_022982 (Xylella phage Paz, complete genome) position: , mismatch: 5, identity: 0.853

cccttcgcaagaggggccacggcgatgcacactt	CRISPR spacer
cccttcgcaagaggggccacggagatacacgcaa	Protospacer
********************** ***.***.*  

17. spacer 1.20|54154|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NC_023006 (Pseudomonas phage PPpW-3 DNA, complete sequence) position: , mismatch: 6, identity: 0.829

gacatg-gagccatgctagcctgtgcgccttgtaca	CRISPR spacer
-acaggcaagccatgcgagcttgtgcgccttgtact	Protospacer
 *** * .******** ***.************** 

18. spacer 1.84|54172|35|NZ_LNVJ01000018|PILER-CR matches to NC_023006 (Pseudomonas phage PPpW-3 DNA, complete sequence) position: , mismatch: 6, identity: 0.829

gacatg-gagccatgctagcctgtgcgccttgtaca	CRISPR spacer
-acaggcaagccatgcgagcttgtgcgccttgtact	Protospacer
 *** * .******** ***.************** 

19. spacer 1.6|53236|34|NZ_LNVJ01000018|CRT matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 7, identity: 0.794

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gccgcgccggcgccgcggcccttcccgagaatca	Protospacer
****************** ** ******     *

20. spacer 1.11|53567|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

21. spacer 1.11|53567|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

22. spacer 1.11|53567|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

23. spacer 1.11|53567|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to AF394895 (Actinophage Q5 replication protein gene, partial cds) position: , mismatch: 7, identity: 0.794

gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
gggcgacacagatttgccaggccgacccccacga	Protospacer
*******  *************** *  *  ***

24. spacer 1.25|54487|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 7, identity: 0.8

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcggtgacgatgacgtccatcggaatgtcatgcgg	Protospacer
************ ********* ****  ** . *

25. spacer 1.25|54487|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 7, identity: 0.8

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcggtgacgatgacgtccatcggaatgtcatgcgg	Protospacer
************ ********* ****  ** . *

26. spacer 1.70|53241|34|NZ_LNVJ01000018|PILER-CR matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 7, identity: 0.794

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gccgcgccggcgccgcggcccttcccgagaatca	Protospacer
****************** ** ******     *

27. spacer 1.75|53576|34|NZ_LNVJ01000018|PILER-CR matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

28. spacer 1.75|53576|34|NZ_LNVJ01000018|PILER-CR matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

29. spacer 1.75|53576|34|NZ_LNVJ01000018|PILER-CR matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.794

---gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
tccgcgcg---cagacttgccaggccgccgggatcga	Protospacer
   * ***    ***.*************** *****

30. spacer 1.75|53576|34|NZ_LNVJ01000018|PILER-CR matches to AF394895 (Actinophage Q5 replication protein gene, partial cds) position: , mismatch: 7, identity: 0.794

gggcgactgagatttgccaggccgccggcatcga	CRISPR spacer
gggcgacacagatttgccaggccgacccccacga	Protospacer
*******  *************** *  *  ***

31. spacer 1.89|54510|35|NZ_LNVJ01000018|PILER-CR matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 7, identity: 0.8

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcggtgacgatgacgtccatcggaatgtcatgcgg	Protospacer
************ ********* ****  ** . *

32. spacer 1.89|54510|35|NZ_LNVJ01000018|PILER-CR matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 7, identity: 0.8

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcggtgacgatgacgtccatcggaatgtcatgcgg	Protospacer
************ ********* ****  ** . *

33. spacer 1.6|53236|34|NZ_LNVJ01000018|CRT matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gcctcgccggcgccgcggaccgtccattcgtgcc	Protospacer
*** *****************.***   * **  

34. spacer 1.6|53236|34|NZ_LNVJ01000018|CRT matches to MN234185 (Mycobacterium phage Lemuria, complete genome) position: , mismatch: 8, identity: 0.765

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggagcgccggcgccgcggcccttcccgagaatga	Protospacer
*  *************** ** ******    **

35. spacer 1.18|54022|36|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.778

gcgcgcggcgtccacgacacccagcgc---cgcgtcccg	CRISPR spacer
ccgcgcggcgtcgacgacgcccagcgcctgcacatc---	Protospacer
 *********** *****.********   *.*.**   

36. spacer 1.19|54089|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

37. spacer 1.19|54089|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

38. spacer 1.19|54089|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

39. spacer 1.22|54286|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to KX911187 (Rathayibacter phage NCPPB3778, complete genome) position: , mismatch: 8, identity: 0.771

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
gtatcccggttaccggccttgctgctttcgcgcct	Protospacer
.  * * **** ************** ******.*

40. spacer 1.27|54620|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to MG757155 (Gordonia phage Boneham, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

41. spacer 1.27|54620|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NC_048820 (Gordonia phage Jellybones, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

42. spacer 1.27|54620|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to MK433263 (Gordonia phage FelixAlejandro, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

43. spacer 1.27|54620|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to MK359302 (Gordonia phage Sombrero, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

44. spacer 1.27|54620|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NC_047892 (Gordonia phage BirksAndSocks, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

45. spacer 1.27|54620|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to MG770214 (Gordonia phage SteveFrench, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

46. spacer 1.27|54620|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to MK433267 (Gordonia phage Butterball, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

47. spacer 1.39|55411|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 8, identity: 0.771

ctctctggtggcgagttcttcagcgaccgtgttca	CRISPR spacer
ttctgacagtgcgagttcttcggcgaccgtgttca	Protospacer
.***   .  ***********.*************

48. spacer 1.45|55806|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 8, identity: 0.765

tcgccgccaccagtgcctcggcccggcagtagta	CRISPR spacer
ccgccgccagctgtgcctcggcccggccaaaggc	Protospacer
.******** * *************** . **  

49. spacer 1.70|53241|34|NZ_LNVJ01000018|PILER-CR matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
gcctcgccggcgccgcggaccgtccattcgtgcc	Protospacer
*** *****************.***   * **  

50. spacer 1.70|53241|34|NZ_LNVJ01000018|PILER-CR matches to MN234185 (Mycobacterium phage Lemuria, complete genome) position: , mismatch: 8, identity: 0.765

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggagcgccggcgccgcggcccttcccgagaatga	Protospacer
*  *************** ** ******    **

51. spacer 1.82|54038|36|NZ_LNVJ01000018|PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.778

gcgcgcggcgtccacgacacccagcgc---cgcgtcccg	CRISPR spacer
ccgcgcggcgtcgacgacgcccagcgcctgcacatc---	Protospacer
 *********** *****.********   *.*.**   

52. spacer 1.83|54106|34|NZ_LNVJ01000018|PILER-CR matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

53. spacer 1.83|54106|34|NZ_LNVJ01000018|PILER-CR matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

54. spacer 1.83|54106|34|NZ_LNVJ01000018|PILER-CR matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.765

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
cggatctggacgacgaggctcttggcggccgcga	Protospacer
***************  ******* *.  . ***

55. spacer 1.86|54306|35|NZ_LNVJ01000018|PILER-CR matches to KX911187 (Rathayibacter phage NCPPB3778, complete genome) position: , mismatch: 8, identity: 0.771

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
gtatcccggttaccggccttgctgctttcgcgcct	Protospacer
.  * * **** ************** ******.*

56. spacer 1.91|54645|35|NZ_LNVJ01000018|PILER-CR matches to MG757155 (Gordonia phage Boneham, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

57. spacer 1.91|54645|35|NZ_LNVJ01000018|PILER-CR matches to NC_048820 (Gordonia phage Jellybones, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

58. spacer 1.91|54645|35|NZ_LNVJ01000018|PILER-CR matches to MK433263 (Gordonia phage FelixAlejandro, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

59. spacer 1.91|54645|35|NZ_LNVJ01000018|PILER-CR matches to MK359302 (Gordonia phage Sombrero, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

60. spacer 1.91|54645|35|NZ_LNVJ01000018|PILER-CR matches to NC_047892 (Gordonia phage BirksAndSocks, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

61. spacer 1.91|54645|35|NZ_LNVJ01000018|PILER-CR matches to MG770214 (Gordonia phage SteveFrench, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

62. spacer 1.91|54645|35|NZ_LNVJ01000018|PILER-CR matches to MK433267 (Gordonia phage Butterball, complete genome) position: , mismatch: 8, identity: 0.771

tacttgccatcggcgctgtgcttgatttcgcccat	CRISPR spacer
cgaatgccatcggcgcagtgcttgacttcgccaag	Protospacer
..  ************ ********.****** * 

63. spacer 1.103|55448|35|NZ_LNVJ01000018|PILER-CR matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 8, identity: 0.771

ctctctggtggcgagttcttcagcgaccgtgttca	CRISPR spacer
ttctgacagtgcgagttcttcggcgaccgtgttca	Protospacer
.***   .  ***********.*************

64. spacer 1.109|55849|34|NZ_LNVJ01000018|PILER-CR matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 8, identity: 0.765

tcgccgccaccagtgcctcggcccggcagtagta	CRISPR spacer
ccgccgccagctgtgcctcggcccggccaaaggc	Protospacer
.******** * *************** . **  

65. spacer 1.6|53236|34|NZ_LNVJ01000018|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
aagtcgccggcgccgcggacgaccccgacgctga	Protospacer
.   **************** *.****** . **

66. spacer 1.6|53236|34|NZ_LNVJ01000018|CRT matches to NZ_CP039918 (Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

67. spacer 1.6|53236|34|NZ_LNVJ01000018|CRT matches to NZ_CP039905 (Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623a, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

68. spacer 1.6|53236|34|NZ_LNVJ01000018|CRT matches to NZ_CP039909 (Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

69. spacer 1.16|53894|33|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to KX752698 (Mycobacterium phage Tonenili, complete genome) position: , mismatch: 9, identity: 0.727

catcccagacatcgcccagcatcggatcaccgt	CRISPR spacer
tggcatcgacatcgcccagcagcgggtcaccgg	Protospacer
.. * . ************** ***.****** 

70. spacer 1.19|54089|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NZ_CP016462 (Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence) position: , mismatch: 9, identity: 0.735

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
ccgatctggacgaggccgatcttgcccgggccat	Protospacer
* *********** **** *******  . **. 

71. spacer 1.21|54220|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.743

gagcggttcagctcaatctccggcca-gagactgcg	CRISPR spacer
gagcggttcagcgcaatcttcggccgttcggtcgc-	Protospacer
************ ******.*****.   *...** 

72. spacer 1.22|54286|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.743

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
cgcacgatgttgccggccttgctgccgtcgcgcga	Protospacer
 **   * *** *************.*******  

73. spacer 1.45|55806|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 9, identity: 0.735

tcgccgccaccagtgcctcggcccgg----cagtagta	CRISPR spacer
cggccgccaccagtgcctcggccagggtcaccgc----	Protospacer
. ********************* **    * *.    

74. spacer 1.47|55936|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.735

gcgtggtcattaagcgcgcctgcgcgatggacaa	CRISPR spacer
ggatactgtttacgcgcgcctgggcgatggacac	Protospacer
* .*. *  *** ********* ********** 

75. spacer 1.47|55936|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.735

gcgtggtcattaagcgcgcctgcgcgatggacaa	CRISPR spacer
ggatactgtttacgcgcgcctgggcgatggacac	Protospacer
* .*. *  *** ********* ********** 

76. spacer 1.57|56601|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.735

accaaggccaacgcaagacgggccggcggccgag	CRISPR spacer
ccggaggccaacgcaagaccggtcggcgcggcag	Protospacer
 * .*************** **.*****    **

77. spacer 1.70|53241|34|NZ_LNVJ01000018|PILER-CR matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
aagtcgccggcgccgcggacgaccccgacgctga	Protospacer
.   **************** *.****** . **

78. spacer 1.70|53241|34|NZ_LNVJ01000018|PILER-CR matches to NZ_CP039918 (Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

79. spacer 1.70|53241|34|NZ_LNVJ01000018|PILER-CR matches to NZ_CP039905 (Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623a, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

80. spacer 1.70|53241|34|NZ_LNVJ01000018|PILER-CR matches to NZ_CP039909 (Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence) position: , mismatch: 9, identity: 0.735

gccgcgccggcgccgcggaccatcccga---cttgga	CRISPR spacer
tctacgcctacgccgcggaccatcccgaagcctc---	Protospacer
 *..**** .******************   **.   

81. spacer 1.80|53908|33|NZ_LNVJ01000018|PILER-CR matches to KX752698 (Mycobacterium phage Tonenili, complete genome) position: , mismatch: 9, identity: 0.727

catcccagacatcgcccagcatcggatcaccgt	CRISPR spacer
tggcatcgacatcgcccagcagcgggtcaccgg	Protospacer
.. * . ************** ***.****** 

82. spacer 1.83|54106|34|NZ_LNVJ01000018|PILER-CR matches to NZ_CP016462 (Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence) position: , mismatch: 9, identity: 0.735

cggatctggacgacgccgctcttgccacatccga	CRISPR spacer
ccgatctggacgaggccgatcttgcccgggccat	Protospacer
* *********** **** *******  . **. 

83. spacer 1.85|54239|35|NZ_LNVJ01000018|PILER-CR matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.743

gagcggttcagctcaatctccggcca-gagactgcg	CRISPR spacer
gagcggttcagcgcaatcttcggccgttcggtcgc-	Protospacer
************ ******.*****.   *...** 

84. spacer 1.86|54306|35|NZ_LNVJ01000018|PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.743

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
cgcacgatgttgccggccttgctgccgtcgcgcga	Protospacer
 **   * *** *************.*******  

85. spacer 1.109|55849|34|NZ_LNVJ01000018|PILER-CR matches to NZ_CP010863 (Marinovum algicola DG 898 plasmid pMaD8, complete sequence) position: , mismatch: 9, identity: 0.735

tcgccgccaccagtgcctcggcccgg----cagtagta	CRISPR spacer
cggccgccaccagtgcctcggccagggtcaccgc----	Protospacer
. ********************* **    * *.    

86. spacer 1.111|55981|34|NZ_LNVJ01000018|PILER-CR matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.735

gcgtggtcattaagcgcgcctgcgcgatggacaa	CRISPR spacer
ggatactgtttacgcgcgcctgggcgatggacac	Protospacer
* .*. *  *** ********* ********** 

87. spacer 1.111|55981|34|NZ_LNVJ01000018|PILER-CR matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.735

gcgtggtcattaagcgcgcctgcgcgatggacaa	CRISPR spacer
ggatactgtttacgcgcgcctgggcgatggacac	Protospacer
* .*. *  *** ********* ********** 

88. spacer 1.121|56656|34|NZ_LNVJ01000018|PILER-CR matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.735

accaaggccaacgcaagacgggccggcggccgag	CRISPR spacer
ccggaggccaacgcaagaccggtcggcgcggcag	Protospacer
 * .*************** **.*****    **

89. spacer 1.6|53236|34|NZ_LNVJ01000018|CRT matches to MT024859 (Gordonia phage DumpsterDude, complete genome) position: , mismatch: 10, identity: 0.706

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggcccgccggcgccgcgcaccatgccgatcgcac	Protospacer
* * ************* ***** ****..  . 

90. spacer 1.18|54022|36|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 10, identity: 0.722

gcgcgcggcgtccacgacacccagcgccgcgtcccg	CRISPR spacer
catcttgacgaccacgacgcccagcgccgcgtccac	Protospacer
   * .*.** *******.***************  

91. spacer 1.24|54419|37|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.73

tggacctgcaggccgccgaactgcgccgcaagcaggt	CRISPR spacer
ccaacctgcagggcgccgacctgcgccgcggcatggt	Protospacer
. .********* ****** *********..   ***

92. spacer 1.25|54487|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NZ_CP017242 (Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence) position: , mismatch: 10, identity: 0.714

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcgttgaccatgtcgtccatcgtaaatccgtgcgg	Protospacer
*** **** ****************    .* . *

93. spacer 1.37|55279|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
accctcgggcgggctggtgatgaaggcgttcatg	Protospacer
..  * **************** ***.*** *  

94. spacer 1.37|55279|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
accctcgggcgggctggtgatgaaggcgttcatg	Protospacer
..  * **************** ***.*** *  

95. spacer 1.52|56269|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 10, identity: 0.714

tgctgctcgcggagctgggcggggccgcataccac	CRISPR spacer
tgctggtcgcggtgctgggcggggcgttgggcatc	Protospacer
***** ****** ************  .. .*  *

96. spacer 1.52|56269|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.714

tgctgctcgcggagctgggcggggccgcataccac	CRISPR spacer
ttgtgctggcggcgctgggcggggccgcgctcggt	Protospacer
*  **** **** ***************.. * ..

97. spacer 1.57|56601|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

accaaggccaacgcaagacgggccggcggccgag	CRISPR spacer
cttcgtcccgacgcaagacgggccggcggccggt	Protospacer
 .. .  **.**********************. 

98. spacer 1.70|53241|34|NZ_LNVJ01000018|PILER-CR matches to MT024859 (Gordonia phage DumpsterDude, complete genome) position: , mismatch: 10, identity: 0.706

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggcccgccggcgccgcgcaccatgccgatcgcac	Protospacer
* * ************* ***** ****..  . 

99. spacer 1.82|54038|36|NZ_LNVJ01000018|PILER-CR matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 10, identity: 0.722

gcgcgcggcgtccacgacacccagcgccgcgtcccg	CRISPR spacer
catcttgacgaccacgacgcccagcgccgcgtccac	Protospacer
   * .*.** *******.***************  

100. spacer 1.88|54441|37|NZ_LNVJ01000018|PILER-CR matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.73

tggacctgcaggccgccgaactgcgccgcaagcaggt	CRISPR spacer
ccaacctgcagggcgccgacctgcgccgcggcatggt	Protospacer
. .********* ****** *********..   ***

101. spacer 1.89|54510|35|NZ_LNVJ01000018|PILER-CR matches to NZ_CP017242 (Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence) position: , mismatch: 10, identity: 0.714

tcggtgacgatgtcgtccatcgtaatgaaattttg	CRISPR spacer
tcgttgaccatgtcgtccatcgtaaatccgtgcgg	Protospacer
*** **** ****************    .* . *

102. spacer 1.101|55314|34|NZ_LNVJ01000018|PILER-CR matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
accctcgggcgggctggtgatgaaggcgttcatg	Protospacer
..  * **************** ***.*** *  

103. spacer 1.101|55314|34|NZ_LNVJ01000018|PILER-CR matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
accctcgggcgggctggtgatgaaggcgttcatg	Protospacer
..  * **************** ***.*** *  

104. spacer 1.116|56319|35|NZ_LNVJ01000018|PILER-CR matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 10, identity: 0.714

tgctgctcgcggagctgggcggggccgcataccac	CRISPR spacer
tgctggtcgcggtgctgggcggggcgttgggcatc	Protospacer
***** ****** ************  .. .*  *

105. spacer 1.116|56319|35|NZ_LNVJ01000018|PILER-CR matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.714

tgctgctcgcggagctgggcggggccgcataccac	CRISPR spacer
ttgtgctggcggcgctgggcggggccgcgctcggt	Protospacer
*  **** **** ***************.. * ..

106. spacer 1.121|56656|34|NZ_LNVJ01000018|PILER-CR matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

accaaggccaacgcaagacgggccggcggccgag	CRISPR spacer
cttcgtcccgacgcaagacgggccggcggccggt	Protospacer
 .. .  **.**********************. 

107. spacer 1.6|53236|34|NZ_LNVJ01000018|CRT matches to NC_048019 (Gordonia phage Ruthy, complete genome) position: , mismatch: 11, identity: 0.676

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggaccgccggcgccgcgcaccatgccgatcgcac	Protospacer
*   ************* ***** ****..  . 

108. spacer 1.14|53763|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to MG518519 (Streptomyces phage Manuel, complete genome) position: , mismatch: 11, identity: 0.676

gaaaacggtgtagcactcgtcgaggatgatcacc	CRISPR spacer
acgacgggtgtagcacccgtcgatgatgatagga	Protospacer
. .*  **********.****** ****** .  

109. spacer 1.22|54286|35|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.686

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
gtgcccaggttccaggccttgctgatgtcggtcag	Protospacer
.  . ******** ********** *****  *  

110. spacer 1.37|55279|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to MF360958 (Salicola phage SCTP-2, complete genome) position: , mismatch: 11, identity: 0.676

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
tggcttatatggggtggtgatgaaggtgttgaat	Protospacer
  . * . ..*** ******** ***********

111. spacer 1.37|55279|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to MK388689 (Pantoea phage vB_PagM_LIET2, complete genome) position: , mismatch: 11, identity: 0.676

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
atactggggcgggctggtgatgcagcacggacag	Protospacer
.** *.*******************     . * 

112. spacer 1.45|55806|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 11, identity: 0.676

tcgccgccaccagtgcctcggcccggcagtagta----	CRISPR spacer
ccgccgccacctgcgcctcggccc----gcgccacctc	Protospacer
.********** *.**********    *.. .*    

113. spacer 1.45|55806|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676

tcgccgccaccagtgcctcggcccggcagtagta	CRISPR spacer
cagccgacgccagtgcctcggcccggttcgcgct	Protospacer
. **** *.*****************.    *. 

114. spacer 1.59|56731|34|NZ_LNVJ01000018|CRT,CRISPRCasFinder matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 11, identity: 0.676

gccggcacaacgtgctggcccgggtccagaaggt	CRISPR spacer
cgaaggacaaggtgctgacccgggtccagatcta	Protospacer
   .* **** ******.************    

115. spacer 1.70|53241|34|NZ_LNVJ01000018|PILER-CR matches to NC_048019 (Gordonia phage Ruthy, complete genome) position: , mismatch: 11, identity: 0.676

gccgcgccggcgccgcggaccatcccgacttgga	CRISPR spacer
ggaccgccggcgccgcgcaccatgccgatcgcac	Protospacer
*   ************* ***** ****..  . 

116. spacer 1.78|53775|34|NZ_LNVJ01000018|PILER-CR matches to MG518519 (Streptomyces phage Manuel, complete genome) position: , mismatch: 11, identity: 0.676

gaaaacggtgtagcactcgtcgaggatgatcacc	CRISPR spacer
acgacgggtgtagcacccgtcgatgatgatagga	Protospacer
. .*  **********.****** ****** .  

117. spacer 1.86|54306|35|NZ_LNVJ01000018|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.686

agctgcaggttcccggccttgctgctgtcgcgctt	CRISPR spacer
gtgcccaggttccaggccttgctgatgtcggtcag	Protospacer
.  . ******** ********** *****  *  

118. spacer 1.101|55314|34|NZ_LNVJ01000018|PILER-CR matches to MF360958 (Salicola phage SCTP-2, complete genome) position: , mismatch: 11, identity: 0.676

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
tggcttatatggggtggtgatgaaggtgttgaat	Protospacer
  . * . ..*** ******** ***********

119. spacer 1.101|55314|34|NZ_LNVJ01000018|PILER-CR matches to MK388689 (Pantoea phage vB_PagM_LIET2, complete genome) position: , mismatch: 11, identity: 0.676

gtagtagggcgggctggtgatgcaggtgttgaat	CRISPR spacer
atactggggcgggctggtgatgcagcacggacag	Protospacer
.** *.*******************     . * 

120. spacer 1.109|55849|34|NZ_LNVJ01000018|PILER-CR matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 11, identity: 0.676

tcgccgccaccagtgcctcggcccggcagtagta----	CRISPR spacer
ccgccgccacctgcgcctcggccc----gcgccacctc	Protospacer
.********** *.**********    *.. .*    

121. spacer 1.109|55849|34|NZ_LNVJ01000018|PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676

tcgccgccaccagtgcctcggcccggcagtagta	CRISPR spacer
cagccgacgccagtgcctcggcccggttcgcgct	Protospacer
. **** *.*****************.    *. 

122. spacer 1.123|56788|34|NZ_LNVJ01000018|PILER-CR matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 11, identity: 0.676

gccggcacaacgtgctggcccgggtccagaaggt	CRISPR spacer
cgaaggacaaggtgctgacccgggtccagatcta	Protospacer
   .* **** ******.************    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_LNVJ01000001
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 64501 : 116999 44 Staphylococcus_phage(28.57%) tRNA,protease,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_LNVJ01000147
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNVJ01000147_1 10-2280 Orphan I-C
34 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NZ_LNVJ01000147_1 1.32|2084|36|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder 2084-2119 36 NZ_LNVJ01000034.1 40616-40651 1 0.972
NZ_LNVJ01000147_1 1.66|2083|37|NZ_LNVJ01000147|CRT 2083-2119 37 NZ_LNVJ01000034.1 40615-40651 1 0.973

1. spacer 1.32|2084|36|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder matches to position: 40616-40651, mismatch: 1, identity: 0.972

gtgatcacgcccgagagcaagcagcgcgagcagcat	CRISPR spacer
gtgatcacgcccgagagcaagcggcgcgagcagcat	Protospacer
**********************.*************

2. spacer 1.66|2083|37|NZ_LNVJ01000147|CRT matches to position: 40615-40651, mismatch: 1, identity: 0.973

cgtgatcacgcccgagagcaagcagcgcgagcagcat	CRISPR spacer
cgtgatcacgcccgagagcaagcggcgcgagcagcat	Protospacer
***********************.*************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LNVJ01000147_1 1.29|1888|34|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder 1888-1921 34 NC_020205 Xanthomonas citri phage CP2 DNA, complete genome 26126-26159 0 1.0
NZ_LNVJ01000147_1 1.63|1887|35|NZ_LNVJ01000147|CRT 1887-1921 35 NC_020205 Xanthomonas citri phage CP2 DNA, complete genome 26126-26160 1 0.971
NZ_LNVJ01000147_1 1.25|1626|34|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder 1626-1659 34 LR743523 Xylella phage Usme genome assembly, chromosome: 1 1421-1454 2 0.941
NZ_LNVJ01000147_1 1.29|1888|34|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder 1888-1921 34 LR743529 Xanthomonas phage Sopo genome assembly, chromosome: 1 19513-19546 2 0.941
NZ_LNVJ01000147_1 1.29|1888|34|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder 1888-1921 34 LR743528 Xanthomonas phage Tabio genome assembly, chromosome: 1 19321-19354 2 0.941
NZ_LNVJ01000147_1 1.29|1888|34|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder 1888-1921 34 LR743531 Xanthomonas phage Tenjo genome assembly, chromosome: 1 18855-18888 2 0.941
NZ_LNVJ01000147_1 1.59|1625|35|NZ_LNVJ01000147|CRT 1625-1659 35 LR743523 Xylella phage Usme genome assembly, chromosome: 1 1421-1455 2 0.943
NZ_LNVJ01000147_1 1.19|1229|36|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder 1229-1264 36 LR743531 Xanthomonas phage Tenjo genome assembly, chromosome: 1 36675-36710 3 0.917
NZ_LNVJ01000147_1 1.19|1229|36|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder 1229-1264 36 NC_020205 Xanthomonas citri phage CP2 DNA, complete genome 1411-1446 3 0.917
NZ_LNVJ01000147_1 1.53|1228|37|NZ_LNVJ01000147|CRT 1228-1264 37 LR743531 Xanthomonas phage Tenjo genome assembly, chromosome: 1 36675-36711 3 0.919
NZ_LNVJ01000147_1 1.53|1228|37|NZ_LNVJ01000147|CRT 1228-1264 37 NC_020205 Xanthomonas citri phage CP2 DNA, complete genome 1411-1447 3 0.919
NZ_LNVJ01000147_1 1.63|1887|35|NZ_LNVJ01000147|CRT 1887-1921 35 LR743529 Xanthomonas phage Sopo genome assembly, chromosome: 1 19513-19547 3 0.914
NZ_LNVJ01000147_1 1.63|1887|35|NZ_LNVJ01000147|CRT 1887-1921 35 LR743528 Xanthomonas phage Tabio genome assembly, chromosome: 1 19321-19355 3 0.914
NZ_LNVJ01000147_1 1.63|1887|35|NZ_LNVJ01000147|CRT 1887-1921 35 LR743531 Xanthomonas phage Tenjo genome assembly, chromosome: 1 18855-18889 3 0.914
NZ_LNVJ01000147_1 1.17|1098|34|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder 1098-1131 34 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 1407407-1407440 6 0.824
NZ_LNVJ01000147_1 1.17|1098|34|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder 1098-1131 34 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 192962-192995 6 0.824
NZ_LNVJ01000147_1 1.51|1097|35|NZ_LNVJ01000147|CRT 1097-1131 35 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 1407407-1407441 6 0.829
NZ_LNVJ01000147_1 1.51|1097|35|NZ_LNVJ01000147|CRT 1097-1131 35 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 192962-192996 6 0.829
NZ_LNVJ01000147_1 1.17|1098|34|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder 1098-1131 34 NC_008308 Sphingomonas sp. KA1 plasmid pCAR3 DNA, complete sequence 163565-163598 7 0.794
NZ_LNVJ01000147_1 1.17|1098|34|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder 1098-1131 34 NC_022235 Sphingomonas sp. ERG5 plasmid pCADAB1, complete sequence 44455-44488 7 0.794
NZ_LNVJ01000147_1 1.17|1098|34|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder 1098-1131 34 NZ_CP029341 Streptomyces sp. SM17 plasmid pSM17C, complete sequence 532-565 8 0.765
NZ_LNVJ01000147_1 1.17|1098|34|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder 1098-1131 34 NZ_CP012918 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence 121772-121805 8 0.765
NZ_LNVJ01000147_1 1.30|1953|35|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder 1953-1987 35 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1232649-1232683 8 0.771
NZ_LNVJ01000147_1 1.51|1097|35|NZ_LNVJ01000147|CRT 1097-1131 35 NC_008308 Sphingomonas sp. KA1 plasmid pCAR3 DNA, complete sequence 163564-163598 8 0.771
NZ_LNVJ01000147_1 1.51|1097|35|NZ_LNVJ01000147|CRT 1097-1131 35 NZ_CP029341 Streptomyces sp. SM17 plasmid pSM17C, complete sequence 532-566 8 0.771
NZ_LNVJ01000147_1 1.51|1097|35|NZ_LNVJ01000147|CRT 1097-1131 35 NC_022235 Sphingomonas sp. ERG5 plasmid pCADAB1, complete sequence 44454-44488 8 0.771
NZ_LNVJ01000147_1 1.28|1824|33|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder 1824-1856 33 NZ_CP050088 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence 575038-575070 9 0.727
NZ_LNVJ01000147_1 1.29|1888|34|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder 1888-1921 34 NZ_CP015203 Rhodococcus sp. 008 plasmid pR8L1, complete sequence 457040-457073 9 0.735
NZ_LNVJ01000147_1 1.62|1823|34|NZ_LNVJ01000147|CRT 1823-1856 34 NZ_LR723673 Rhizobium flavum strain YW14 plasmid 4 85342-85375 9 0.735
NZ_LNVJ01000147_1 1.64|1952|36|NZ_LNVJ01000147|CRT 1952-1987 36 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1232649-1232684 9 0.75
NZ_LNVJ01000147_1 1.27|1756|37|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder 1756-1792 37 NC_031068 Pectobacterium phage PP16, complete genome 6978-7014 10 0.73
NZ_LNVJ01000147_1 1.27|1756|37|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder 1756-1792 37 AP014684 Pseudomonas phage PS-1 DNA, complete sequence 44861-44897 10 0.73
NZ_LNVJ01000147_1 1.29|1888|34|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder 1888-1921 34 NZ_KR997898 Mycobacterium avium subsp. hominissuis strain 88Br plasmid pMA100, complete sequence 96191-96224 10 0.706
NZ_LNVJ01000147_1 1.61|1755|38|NZ_LNVJ01000147|CRT 1755-1792 38 NC_031068 Pectobacterium phage PP16, complete genome 6977-7014 10 0.737
NZ_LNVJ01000147_1 1.61|1755|38|NZ_LNVJ01000147|CRT 1755-1792 38 AP014684 Pseudomonas phage PS-1 DNA, complete sequence 44861-44898 10 0.737
NZ_LNVJ01000147_1 1.62|1823|34|NZ_LNVJ01000147|CRT 1823-1856 34 NZ_CP050088 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence 575037-575070 10 0.706
NZ_LNVJ01000147_1 1.63|1887|35|NZ_LNVJ01000147|CRT 1887-1921 35 NZ_KR997898 Mycobacterium avium subsp. hominissuis strain 88Br plasmid pMA100, complete sequence 96190-96224 11 0.686

1. spacer 1.29|1888|34|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder matches to NC_020205 (Xanthomonas citri phage CP2 DNA, complete genome) position: , mismatch: 0, identity: 1.0

tcaccagcgattcgatcaactcgcgcccggaccc	CRISPR spacer
tcaccagcgattcgatcaactcgcgcccggaccc	Protospacer
**********************************

2. spacer 1.63|1887|35|NZ_LNVJ01000147|CRT matches to NC_020205 (Xanthomonas citri phage CP2 DNA, complete genome) position: , mismatch: 1, identity: 0.971

ctcaccagcgattcgatcaactcgcgcccggaccc	CRISPR spacer
ttcaccagcgattcgatcaactcgcgcccggaccc	Protospacer
.**********************************

3. spacer 1.25|1626|34|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder matches to LR743523 (Xylella phage Usme genome assembly, chromosome: 1) position: , mismatch: 2, identity: 0.941

atacgtcaatgccgcggcgtctgaacggtcaggt	CRISPR spacer
atacgtcaacgccgcggcgtctgaacggtccggt	Protospacer
*********.******************** ***

4. spacer 1.29|1888|34|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder matches to LR743529 (Xanthomonas phage Sopo genome assembly, chromosome: 1) position: , mismatch: 2, identity: 0.941

tcaccagcgattcgatcaactcgcgcccggaccc	CRISPR spacer
tcaccagcgattcgatcaattcgcggccggaccc	Protospacer
*******************.***** ********

5. spacer 1.29|1888|34|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder matches to LR743528 (Xanthomonas phage Tabio genome assembly, chromosome: 1) position: , mismatch: 2, identity: 0.941

tcaccagcgattcgatcaactcgcgcccggaccc	CRISPR spacer
tcaccagcgattcgatcaattcgcggccggaccc	Protospacer
*******************.***** ********

6. spacer 1.29|1888|34|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder matches to LR743531 (Xanthomonas phage Tenjo genome assembly, chromosome: 1) position: , mismatch: 2, identity: 0.941

tcaccagcgattcgatcaactcgcgcccggaccc	CRISPR spacer
tcaccagcgattcgatcaattcgcggccggaccc	Protospacer
*******************.***** ********

7. spacer 1.59|1625|35|NZ_LNVJ01000147|CRT matches to LR743523 (Xylella phage Usme genome assembly, chromosome: 1) position: , mismatch: 2, identity: 0.943

catacgtcaatgccgcggcgtctgaacggtcaggt	CRISPR spacer
catacgtcaacgccgcggcgtctgaacggtccggt	Protospacer
**********.******************** ***

8. spacer 1.19|1229|36|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder matches to LR743531 (Xanthomonas phage Tenjo genome assembly, chromosome: 1) position: , mismatch: 3, identity: 0.917

atgtaaacgtagcgccgcgcgatcttgcgcgttgtt	CRISPR spacer
atgtagacgtagcgccgcgcgatcttgcgcgtggtc	Protospacer
*****.************************** **.

9. spacer 1.19|1229|36|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder matches to NC_020205 (Xanthomonas citri phage CP2 DNA, complete genome) position: , mismatch: 3, identity: 0.917

atgtaaacgtagcgccgcgcgatcttgcgcgttgtt	CRISPR spacer
atgtagacgtagcgccgcgcgatcttgcgcgtggtc	Protospacer
*****.************************** **.

10. spacer 1.53|1228|37|NZ_LNVJ01000147|CRT matches to LR743531 (Xanthomonas phage Tenjo genome assembly, chromosome: 1) position: , mismatch: 3, identity: 0.919

catgtaaacgtagcgccgcgcgatcttgcgcgttgtt	CRISPR spacer
catgtagacgtagcgccgcgcgatcttgcgcgtggtc	Protospacer
******.************************** **.

11. spacer 1.53|1228|37|NZ_LNVJ01000147|CRT matches to NC_020205 (Xanthomonas citri phage CP2 DNA, complete genome) position: , mismatch: 3, identity: 0.919

catgtaaacgtagcgccgcgcgatcttgcgcgttgtt	CRISPR spacer
catgtagacgtagcgccgcgcgatcttgcgcgtggtc	Protospacer
******.************************** **.

12. spacer 1.63|1887|35|NZ_LNVJ01000147|CRT matches to LR743529 (Xanthomonas phage Sopo genome assembly, chromosome: 1) position: , mismatch: 3, identity: 0.914

ctcaccagcgattcgatcaactcgcgcccggaccc	CRISPR spacer
ttcaccagcgattcgatcaattcgcggccggaccc	Protospacer
.*******************.***** ********

13. spacer 1.63|1887|35|NZ_LNVJ01000147|CRT matches to LR743528 (Xanthomonas phage Tabio genome assembly, chromosome: 1) position: , mismatch: 3, identity: 0.914

ctcaccagcgattcgatcaactcgcgcccggaccc	CRISPR spacer
ttcaccagcgattcgatcaattcgcggccggaccc	Protospacer
.*******************.***** ********

14. spacer 1.63|1887|35|NZ_LNVJ01000147|CRT matches to LR743531 (Xanthomonas phage Tenjo genome assembly, chromosome: 1) position: , mismatch: 3, identity: 0.914

ctcaccagcgattcgatcaactcgcgcccggaccc	CRISPR spacer
ttcaccagcgattcgatcaattcgcggccggaccc	Protospacer
.*******************.***** ********

15. spacer 1.17|1098|34|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.824

ccttgccggccgccgcgcgtccctcgcccacgtt	CRISPR spacer
ccttgccggccgcgtcgcgtccctcgaagacgat	Protospacer
*************  ***********   *** *

16. spacer 1.17|1098|34|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 6, identity: 0.824

ccttgccggccgccgcgcgtccctcgcccacgtt	CRISPR spacer
ccttgccggccgcgtcgcgtccctcgaagacgat	Protospacer
*************  ***********   *** *

17. spacer 1.51|1097|35|NZ_LNVJ01000147|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.829

cccttgccggccgccgcgcgtccctcgcccacgtt	CRISPR spacer
cccttgccggccgcgtcgcgtccctcgaagacgat	Protospacer
**************  ***********   *** *

18. spacer 1.51|1097|35|NZ_LNVJ01000147|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 6, identity: 0.829

cccttgccggccgccgcgcgtccctcgcccacgtt	CRISPR spacer
cccttgccggccgcgtcgcgtccctcgaagacgat	Protospacer
**************  ***********   *** *

19. spacer 1.17|1098|34|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder matches to NC_008308 (Sphingomonas sp. KA1 plasmid pCAR3 DNA, complete sequence) position: , mismatch: 7, identity: 0.794

ccttgccggccgccgcgcgtccctcgcccacgtt	CRISPR spacer
ccgggcccgccgccgcgcggccctcgcccgggtc	Protospacer
**  *** *********** *********. **.

20. spacer 1.17|1098|34|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder matches to NC_022235 (Sphingomonas sp. ERG5 plasmid pCADAB1, complete sequence) position: , mismatch: 7, identity: 0.794

ccttgccggccgccgcgcgtccctcgcccacgtt	CRISPR spacer
ccgggcccgccgccgcgcggccctcgcccgggtc	Protospacer
**  *** *********** *********. **.

21. spacer 1.17|1098|34|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder matches to NZ_CP029341 (Streptomyces sp. SM17 plasmid pSM17C, complete sequence) position: , mismatch: 8, identity: 0.765

ccttgccggccgccgcgcgtccctcgcccacgtt	CRISPR spacer
cggagtcgcccgccgcacgtccctcgcccacatc	Protospacer
*   *.** *******.**************.*.

22. spacer 1.17|1098|34|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder matches to NZ_CP012918 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence) position: , mismatch: 8, identity: 0.765

ccttgccggccgccgcgcgtccctcgcccacgtt	CRISPR spacer
accggccggccgccgcgcctccctggccgtcgct	Protospacer
 *. ************** ***** ***  **.*

23. spacer 1.30|1953|35|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 8, identity: 0.771

ccgcggataaactcgccgcgcatgtccg---gcagatt	CRISPR spacer
gtgcggataaaatcgccgcgcaggtccgcgaccag---	Protospacer
 .********* ********** *****    ***   

24. spacer 1.51|1097|35|NZ_LNVJ01000147|CRT matches to NC_008308 (Sphingomonas sp. KA1 plasmid pCAR3 DNA, complete sequence) position: , mismatch: 8, identity: 0.771

cccttgccggccgccgcgcgtccctcgcccacgtt	CRISPR spacer
tccgggcccgccgccgcgcggccctcgcccgggtc	Protospacer
.**  *** *********** *********. **.

25. spacer 1.51|1097|35|NZ_LNVJ01000147|CRT matches to NZ_CP029341 (Streptomyces sp. SM17 plasmid pSM17C, complete sequence) position: , mismatch: 8, identity: 0.771

cccttgccggccgccgcgcgtccctcgcccacgtt	CRISPR spacer
ccggagtcgcccgccgcacgtccctcgcccacatc	Protospacer
**   *.** *******.**************.*.

26. spacer 1.51|1097|35|NZ_LNVJ01000147|CRT matches to NC_022235 (Sphingomonas sp. ERG5 plasmid pCADAB1, complete sequence) position: , mismatch: 8, identity: 0.771

cccttgccggccgccgcgcgtccctcgcccacgtt	CRISPR spacer
tccgggcccgccgccgcgcggccctcgcccgggtc	Protospacer
.**  *** *********** *********. **.

27. spacer 1.28|1824|33|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 9, identity: 0.727

gccttcacgctggttcgtcggcgcctcagtgat	CRISPR spacer
atgttcatgatggttcgtcggcgcctcaggcgc	Protospacer
.. ****.* *******************  ..

28. spacer 1.29|1888|34|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder matches to NZ_CP015203 (Rhodococcus sp. 008 plasmid pR8L1, complete sequence) position: , mismatch: 9, identity: 0.735

tcaccagcgattcgatcaactcgcgcccggaccc	CRISPR spacer
cccgcatgcattcgatcaaatggcgcccggacca	Protospacer
.*  **   ********** * *********** 

29. spacer 1.62|1823|34|NZ_LNVJ01000147|CRT matches to NZ_LR723673 (Rhizobium flavum strain YW14 plasmid 4) position: , mismatch: 9, identity: 0.735

cgccttcacgctggttcgtcggcgcctcagtgat	CRISPR spacer
cgtcttcacgctggttcgtccgcgtcgccagaaa	Protospacer
**.***************** ***.* * . .* 

30. spacer 1.64|1952|36|NZ_LNVJ01000147|CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 9, identity: 0.75

cccgcggataaactcgccgcgcatgtccg---gcagatt	CRISPR spacer
ggtgcggataaaatcgccgcgcaggtccgcgaccag---	Protospacer
  .********* ********** *****    ***   

31. spacer 1.27|1756|37|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder matches to NC_031068 (Pectobacterium phage PP16, complete genome) position: , mismatch: 10, identity: 0.73

ctctgggcgaggtcgaccacattgacggcaatcgttt	CRISPR spacer
tacctgcacaggttgaccacattaacggcaatcgttc	Protospacer
. *. *   ****.*********.************.

32. spacer 1.27|1756|37|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder matches to AP014684 (Pseudomonas phage PS-1 DNA, complete sequence) position: , mismatch: 10, identity: 0.73

ctctgggcgaggtcgaccacattgacggcaatcgttt	CRISPR spacer
caagcggcgagatcgaccacgttgacggcaatgcgct	Protospacer
*    ******.********.***********   .*

33. spacer 1.29|1888|34|NZ_LNVJ01000147|PILER-CR,CRISPRCasFinder matches to NZ_KR997898 (Mycobacterium avium subsp. hominissuis strain 88Br plasmid pMA100, complete sequence) position: , mismatch: 10, identity: 0.706

tcaccagcgattcgatcaactcgcgcccggaccc	CRISPR spacer
acatcagcgattcgatcaacgcgcgcagcatcat	Protospacer
 **.**************** *****   . * .

34. spacer 1.61|1755|38|NZ_LNVJ01000147|CRT matches to NC_031068 (Pectobacterium phage PP16, complete genome) position: , mismatch: 10, identity: 0.737

cctctgggcgaggtcgaccacattgacggcaatcgttt	CRISPR spacer
ctacctgcacaggttgaccacattaacggcaatcgttc	Protospacer
*. *. *   ****.*********.************.

35. spacer 1.61|1755|38|NZ_LNVJ01000147|CRT matches to AP014684 (Pseudomonas phage PS-1 DNA, complete sequence) position: , mismatch: 10, identity: 0.737

cctctgggcgaggtcgaccacattgacggcaatcgttt	CRISPR spacer
ccaagcggcgagatcgaccacgttgacggcaatgcgct	Protospacer
**    ******.********.***********   .*

36. spacer 1.62|1823|34|NZ_LNVJ01000147|CRT matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 10, identity: 0.706

cgccttcacgctggttcgtcggcgcctcagtgat	CRISPR spacer
gatgttcatgatggttcgtcggcgcctcaggcgc	Protospacer
 .. ****.* *******************  ..

37. spacer 1.63|1887|35|NZ_LNVJ01000147|CRT matches to NZ_KR997898 (Mycobacterium avium subsp. hominissuis strain 88Br plasmid pMA100, complete sequence) position: , mismatch: 11, identity: 0.686

ctcaccagcgattcgatcaactcgcgcccggaccc	CRISPR spacer
aacatcagcgattcgatcaacgcgcgcagcatcat	Protospacer
  **.**************** *****   . * .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_LNVJ01000051
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNVJ01000051_1 28604-28706 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NZ_LNVJ01000130
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NZ_LNVJ01000015
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 58668 : 65013 6 Escherichia_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NZ_LNVJ01000080
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNVJ01000080_1 12228-12339 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NZ_LNVJ01000023
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNVJ01000023_1 8870-11675 Orphan NA
58 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNVJ01000023_2 12031-12126 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNVJ01000023_3 12223-12653 Orphan NA
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_LNVJ01000023_1 1.7|9180|26|NZ_LNVJ01000023|CRT 9180-9205 26 NZ_AP018921 Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence 47099-47124 2 0.923
NZ_LNVJ01000023_1 1.7|9180|26|NZ_LNVJ01000023|CRT 9180-9205 26 NZ_AP018921 Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence 201045-201070 2 0.923
NZ_LNVJ01000023_1 1.7|9180|26|NZ_LNVJ01000023|CRT 9180-9205 26 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 487851-487876 3 0.885
NZ_LNVJ01000023_1 1.7|9180|26|NZ_LNVJ01000023|CRT 9180-9205 26 NZ_CP029986 Sphingomonas sp. FARSPH plasmid p01, complete sequence 10880-10905 3 0.885
NZ_LNVJ01000023_1 1.7|9180|26|NZ_LNVJ01000023|CRT 9180-9205 26 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 823175-823200 3 0.885
NZ_LNVJ01000023_1 1.7|9180|26|NZ_LNVJ01000023|CRT 9180-9205 26 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 782223-782248 3 0.885
NZ_LNVJ01000023_1 1.8|9228|26|NZ_LNVJ01000023|CRT 9228-9253 26 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 520146-520171 3 0.885
NZ_LNVJ01000023_1 1.8|9228|26|NZ_LNVJ01000023|CRT 9228-9253 26 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 17268-17293 3 0.885
NZ_LNVJ01000023_1 1.8|9228|26|NZ_LNVJ01000023|CRT 9228-9253 26 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 533379-533404 3 0.885
NZ_LNVJ01000023_1 1.8|9228|26|NZ_LNVJ01000023|CRT 9228-9253 26 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 222780-222805 3 0.885
NZ_LNVJ01000023_1 1.16|9612|26|NZ_LNVJ01000023|CRT 9612-9637 26 NZ_CP029986 Sphingomonas sp. FARSPH plasmid p01, complete sequence 10880-10905 3 0.885
NZ_LNVJ01000023_1 1.16|9612|26|NZ_LNVJ01000023|CRT 9612-9637 26 NZ_AP018921 Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence 47099-47124 3 0.885
NZ_LNVJ01000023_1 1.16|9612|26|NZ_LNVJ01000023|CRT 9612-9637 26 NZ_AP018921 Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence 201045-201070 3 0.885
NZ_LNVJ01000023_1 1.17|9660|26|NZ_LNVJ01000023|CRT 9660-9685 26 NZ_CP010682 Phaeobacter piscinae strain P14 plasmid pP14_a, complete sequence 206583-206608 3 0.885
NZ_LNVJ01000023_1 1.17|9660|26|NZ_LNVJ01000023|CRT 9660-9685 26 NZ_CP010644 Phaeobacter piscinae strain P36 plasmid pP36_a, complete sequence 206685-206710 3 0.885
NZ_LNVJ01000023_1 1.25|10044|26|NZ_LNVJ01000023|CRT 10044-10069 26 NC_009427 Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence 260284-260309 3 0.885
NZ_LNVJ01000023_1 1.25|10044|26|NZ_LNVJ01000023|CRT 10044-10069 26 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 107729-107754 3 0.885
NZ_LNVJ01000023_1 1.25|10044|26|NZ_LNVJ01000023|CRT 10044-10069 26 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 501213-501238 3 0.885
NZ_LNVJ01000023_1 1.27|10140|26|NZ_LNVJ01000023|CRT 10140-10165 26 MN694784 Marine virus AFVG_250M786, complete genome 29983-30008 3 0.885
NZ_LNVJ01000023_1 1.28|10188|26|NZ_LNVJ01000023|CRT 10188-10213 26 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 408821-408846 3 0.885
NZ_LNVJ01000023_1 1.30|10284|26|NZ_LNVJ01000023|CRT 10284-10309 26 MN694784 Marine virus AFVG_250M786, complete genome 29983-30008 3 0.885
NZ_LNVJ01000023_1 1.31|10332|26|NZ_LNVJ01000023|CRT 10332-10357 26 NZ_CP025508 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence 370642-370667 3 0.885
NZ_LNVJ01000023_1 1.31|10332|26|NZ_LNVJ01000023|CRT 10332-10357 26 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 302074-302099 3 0.885
NZ_LNVJ01000023_1 1.31|10332|26|NZ_LNVJ01000023|CRT 10332-10357 26 NZ_CP022667 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence 267010-267035 3 0.885
NZ_LNVJ01000023_1 1.31|10332|26|NZ_LNVJ01000023|CRT 10332-10357 26 NZ_CP050087 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence 370629-370654 3 0.885
NZ_LNVJ01000023_1 1.34|10476|26|NZ_LNVJ01000023|CRT 10476-10501 26 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 408821-408846 3 0.885
NZ_LNVJ01000023_1 1.38|10668|26|NZ_LNVJ01000023|CRT 10668-10693 26 NZ_CP048816 Caulobacter rhizosphaerae strain KCTC 52515 plasmid unnamed 140314-140339 3 0.885
NZ_LNVJ01000023_1 1.40|10764|26|NZ_LNVJ01000023|CRT 10764-10789 26 NC_009427 Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence 260284-260309 3 0.885
NZ_LNVJ01000023_1 1.40|10764|26|NZ_LNVJ01000023|CRT 10764-10789 26 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 107729-107754 3 0.885
NZ_LNVJ01000023_1 1.40|10764|26|NZ_LNVJ01000023|CRT 10764-10789 26 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 501213-501238 3 0.885
NZ_LNVJ01000023_1 1.46|11052|26|NZ_LNVJ01000023|CRT 11052-11077 26 CP054922 Streptomyces sp. NA03103 plasmid unnamed2, complete sequence 113352-113377 3 0.885
NZ_LNVJ01000023_1 1.49|11196|26|NZ_LNVJ01000023|CRT 11196-11221 26 NC_009427 Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence 260284-260309 3 0.885
NZ_LNVJ01000023_1 1.49|11196|26|NZ_LNVJ01000023|CRT 11196-11221 26 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 107729-107754 3 0.885
NZ_LNVJ01000023_1 1.49|11196|26|NZ_LNVJ01000023|CRT 11196-11221 26 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 501213-501238 3 0.885
NZ_LNVJ01000023_1 1.53|11388|26|NZ_LNVJ01000023|CRT 11388-11413 26 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 673011-673036 3 0.885
NZ_LNVJ01000023_1 1.55|11484|26|NZ_LNVJ01000023|CRT 11484-11509 26 NZ_CP015203 Rhodococcus sp. 008 plasmid pR8L1, complete sequence 546047-546072 3 0.885
NZ_LNVJ01000023_1 1.55|11484|26|NZ_LNVJ01000023|CRT 11484-11509 26 NZ_CP034156 Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence 342233-342258 3 0.885
NZ_LNVJ01000023_3 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder 12462-12486 25 MT889372 Microbacterium phage Avocadoman, complete genome 23120-23144 3 0.88
NZ_LNVJ01000023_3 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder 12462-12486 25 MT639649 Microbacterium phage Burritobowl, complete genome 23512-23536 3 0.88
NZ_LNVJ01000023_3 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder 12462-12486 25 MN062714 Microbacterium Phage DirtyBubble, complete genome 24364-24388 3 0.88
NZ_LNVJ01000023_3 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder 12462-12486 25 MT889389 Microbacterium phage DickRichards, complete genome 23841-23865 3 0.88
NZ_LNVJ01000023_3 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder 12462-12486 25 MT024860 Microbacterium phage Stromboli, complete genome 24734-24758 3 0.88
NZ_LNVJ01000023_3 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder 12462-12486 25 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 281166-281190 3 0.88
NZ_LNVJ01000023_3 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder 12462-12486 25 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 766061-766085 3 0.88
NZ_LNVJ01000023_3 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder 12462-12486 25 NC_010997 Rhizobium etli CIAT 652 plasmid pC, complete sequence 194425-194449 3 0.88
NZ_LNVJ01000023_3 3.8|12606|25|NZ_LNVJ01000023|CRISPRCasFinder 12606-12630 25 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 328038-328062 3 0.88
NZ_LNVJ01000023_3 3.8|12606|25|NZ_LNVJ01000023|CRISPRCasFinder 12606-12630 25 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1960062-1960086 3 0.88
NZ_LNVJ01000023_3 3.8|12606|25|NZ_LNVJ01000023|CRISPRCasFinder 12606-12630 25 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1125643-1125667 3 0.88
NZ_LNVJ01000023_1 1.3|8988|26|NZ_LNVJ01000023|CRT 8988-9013 26 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 387646-387671 4 0.846
NZ_LNVJ01000023_1 1.7|9180|26|NZ_LNVJ01000023|CRT 9180-9205 26 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1107033-1107058 4 0.846
NZ_LNVJ01000023_1 1.7|9180|26|NZ_LNVJ01000023|CRT 9180-9205 26 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 154155-154180 4 0.846
NZ_LNVJ01000023_1 1.7|9180|26|NZ_LNVJ01000023|CRT 9180-9205 26 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 621505-621530 4 0.846
NZ_LNVJ01000023_1 1.7|9180|26|NZ_LNVJ01000023|CRT 9180-9205 26 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1294328-1294353 4 0.846
NZ_LNVJ01000023_1 1.8|9228|26|NZ_LNVJ01000023|CRT 9228-9253 26 NZ_CP039640 Azospirillum sp. TSH100 plasmid p1, complete sequence 268728-268753 4 0.846
NZ_LNVJ01000023_1 1.10|9324|26|NZ_LNVJ01000023|CRT 9324-9349 26 NZ_CP017422 Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence 108324-108349 4 0.846
NZ_LNVJ01000023_1 1.13|9468|26|NZ_LNVJ01000023|CRT 9468-9493 26 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 823175-823200 4 0.846
NZ_LNVJ01000023_1 1.13|9468|26|NZ_LNVJ01000023|CRT 9468-9493 26 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 782223-782248 4 0.846
NZ_LNVJ01000023_1 1.14|9516|26|NZ_LNVJ01000023|CRT 9516-9541 26 NZ_CP013482 Pandoraea apista strain DSM 16535 plasmid pPA35, complete sequence 48902-48927 4 0.846
NZ_LNVJ01000023_1 1.15|9564|26|NZ_LNVJ01000023|CRT 9564-9589 26 NZ_CP031960 Phaeobacter sp. LSS9 plasmid unnamed4, complete sequence 15787-15812 4 0.846
NZ_LNVJ01000023_1 1.15|9564|26|NZ_LNVJ01000023|CRT 9564-9589 26 NZ_CP010602 Phaeobacter inhibens strain P83 plasmid pP83_c, complete sequence 108240-108265 4 0.846
NZ_LNVJ01000023_1 1.15|9564|26|NZ_LNVJ01000023|CRT 9564-9589 26 NZ_CP010769 Phaeobacter piscinae strain P13 plasmid pP13_b, complete sequence 126397-126422 4 0.846
NZ_LNVJ01000023_1 1.15|9564|26|NZ_LNVJ01000023|CRT 9564-9589 26 NZ_CP010708 Phaeobacter inhibens strain P66 plasmid pP66_c, complete sequence 108237-108262 4 0.846
NZ_LNVJ01000023_1 1.15|9564|26|NZ_LNVJ01000023|CRT 9564-9589 26 NZ_CP010737 Phaeobacter inhibens strain P72 plasmid pP72_b, complete sequence 176590-176615 4 0.846
NZ_LNVJ01000023_1 1.16|9612|26|NZ_LNVJ01000023|CRT 9612-9637 26 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 487851-487876 4 0.846
NZ_LNVJ01000023_1 1.18|9708|26|NZ_LNVJ01000023|CRT 9708-9733 26 NZ_CP036488 Rahnella aquatilis strain MEM40 plasmid pMEM40-1, complete sequence 265342-265367 4 0.846
NZ_LNVJ01000023_1 1.18|9708|26|NZ_LNVJ01000023|CRT 9708-9733 26 NC_017060 Rahnella aquatilis HX2 plasmid PRA1, complete sequence 337760-337785 4 0.846
NZ_LNVJ01000023_1 1.18|9708|26|NZ_LNVJ01000023|CRT 9708-9733 26 NC_015062 Rahnella sp. Y9602 plasmid pRAHAQ01, complete sequence 340582-340607 4 0.846
NZ_LNVJ01000023_1 1.20|9804|26|NZ_LNVJ01000023|CRT 9804-9829 26 MN035618 Leviviridae sp. isolate H1_Rhizo_Litter_1_scaffold_1030_e_381 hypothetical protein (H1RhizoL11030e381_000001) and RNA-dependent RNA polymerase (H1RhizoL11030e381_000002) genes, complete cds 390-415 4 0.846
NZ_LNVJ01000023_1 1.23|9948|26|NZ_LNVJ01000023|CRT 9948-9973 26 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 1260828-1260853 4 0.846
NZ_LNVJ01000023_1 1.25|10044|26|NZ_LNVJ01000023|CRT 10044-10069 26 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 325313-325338 4 0.846
NZ_LNVJ01000023_1 1.25|10044|26|NZ_LNVJ01000023|CRT 10044-10069 26 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 475253-475278 4 0.846
NZ_LNVJ01000023_1 1.25|10044|26|NZ_LNVJ01000023|CRT 10044-10069 26 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 497431-497456 4 0.846
NZ_LNVJ01000023_1 1.25|10044|26|NZ_LNVJ01000023|CRT 10044-10069 26 NZ_CP045074 Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence 12931-12956 4 0.846
NZ_LNVJ01000023_1 1.25|10044|26|NZ_LNVJ01000023|CRT 10044-10069 26 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 783845-783870 4 0.846
NZ_LNVJ01000023_1 1.25|10044|26|NZ_LNVJ01000023|CRT 10044-10069 26 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 445755-445780 4 0.846
NZ_LNVJ01000023_1 1.25|10044|26|NZ_LNVJ01000023|CRT 10044-10069 26 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 270965-270990 4 0.846
NZ_LNVJ01000023_1 1.27|10140|26|NZ_LNVJ01000023|CRT 10140-10165 26 NZ_CP033429 Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence 135039-135064 4 0.846
NZ_LNVJ01000023_1 1.28|10188|26|NZ_LNVJ01000023|CRT 10188-10213 26 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 487851-487876 4 0.846
NZ_LNVJ01000023_1 1.28|10188|26|NZ_LNVJ01000023|CRT 10188-10213 26 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 744000-744025 4 0.846
NZ_LNVJ01000023_1 1.28|10188|26|NZ_LNVJ01000023|CRT 10188-10213 26 NZ_CP017422 Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence 108324-108349 4 0.846
NZ_LNVJ01000023_1 1.28|10188|26|NZ_LNVJ01000023|CRT 10188-10213 26 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 341354-341379 4 0.846
NZ_LNVJ01000023_1 1.29|10236|26|NZ_LNVJ01000023|CRT 10236-10261 26 MT114166 Microbacterium phage Nike, complete genome 27400-27425 4 0.846
NZ_LNVJ01000023_1 1.29|10236|26|NZ_LNVJ01000023|CRT 10236-10261 26 NC_047973 Microbacterium phage Hyperion, complete genome 27181-27206 4 0.846
NZ_LNVJ01000023_1 1.29|10236|26|NZ_LNVJ01000023|CRT 10236-10261 26 MT657333 Microbacterium phage Casend, complete genome 27308-27333 4 0.846
NZ_LNVJ01000023_1 1.29|10236|26|NZ_LNVJ01000023|CRT 10236-10261 26 NC_047975 Microbacterium phage Squash, complete genome 27411-27436 4 0.846
NZ_LNVJ01000023_1 1.30|10284|26|NZ_LNVJ01000023|CRT 10284-10309 26 NZ_CP033429 Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence 135039-135064 4 0.846
NZ_LNVJ01000023_1 1.31|10332|26|NZ_LNVJ01000023|CRT 10332-10357 26 NZ_CP025014 Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence 386159-386184 4 0.846
NZ_LNVJ01000023_1 1.31|10332|26|NZ_LNVJ01000023|CRT 10332-10357 26 NZ_CP018230 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence 90478-90503 4 0.846
NZ_LNVJ01000023_1 1.31|10332|26|NZ_LNVJ01000023|CRT 10332-10357 26 NZ_CP048282 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence 321672-321697 4 0.846
NZ_LNVJ01000023_1 1.31|10332|26|NZ_LNVJ01000023|CRT 10332-10357 26 NZ_CP054023 Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence 60637-60662 4 0.846
NZ_LNVJ01000023_1 1.31|10332|26|NZ_LNVJ01000023|CRT 10332-10357 26 NZ_CP054033 Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence 213942-213967 4 0.846
NZ_LNVJ01000023_1 1.31|10332|26|NZ_LNVJ01000023|CRT 10332-10357 26 NZ_CP022566 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence 495119-495144 4 0.846
NZ_LNVJ01000023_1 1.31|10332|26|NZ_LNVJ01000023|CRT 10332-10357 26 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 843111-843136 4 0.846
NZ_LNVJ01000023_1 1.31|10332|26|NZ_LNVJ01000023|CRT 10332-10357 26 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 691120-691145 4 0.846
NZ_LNVJ01000023_1 1.31|10332|26|NZ_LNVJ01000023|CRT 10332-10357 26 NZ_CP018080 Sulfitobacter sp. AM1-D1 plasmid unnamed4, complete sequence 157091-157116 4 0.846
NZ_LNVJ01000023_1 1.32|10380|26|NZ_LNVJ01000023|CRT 10380-10405 26 MT114166 Microbacterium phage Nike, complete genome 27400-27425 4 0.846
NZ_LNVJ01000023_1 1.32|10380|26|NZ_LNVJ01000023|CRT 10380-10405 26 NC_047973 Microbacterium phage Hyperion, complete genome 27181-27206 4 0.846
NZ_LNVJ01000023_1 1.32|10380|26|NZ_LNVJ01000023|CRT 10380-10405 26 MT657333 Microbacterium phage Casend, complete genome 27308-27333 4 0.846
NZ_LNVJ01000023_1 1.32|10380|26|NZ_LNVJ01000023|CRT 10380-10405 26 NC_047975 Microbacterium phage Squash, complete genome 27411-27436 4 0.846
NZ_LNVJ01000023_1 1.34|10476|26|NZ_LNVJ01000023|CRT 10476-10501 26 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 487851-487876 4 0.846
NZ_LNVJ01000023_1 1.34|10476|26|NZ_LNVJ01000023|CRT 10476-10501 26 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 744000-744025 4 0.846
NZ_LNVJ01000023_1 1.34|10476|26|NZ_LNVJ01000023|CRT 10476-10501 26 NZ_CP017422 Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence 108324-108349 4 0.846
NZ_LNVJ01000023_1 1.34|10476|26|NZ_LNVJ01000023|CRT 10476-10501 26 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 341354-341379 4 0.846
NZ_LNVJ01000023_1 1.35|10524|26|NZ_LNVJ01000023|CRT 10524-10549 26 MT114166 Microbacterium phage Nike, complete genome 27400-27425 4 0.846
NZ_LNVJ01000023_1 1.35|10524|26|NZ_LNVJ01000023|CRT 10524-10549 26 NC_047973 Microbacterium phage Hyperion, complete genome 27181-27206 4 0.846
NZ_LNVJ01000023_1 1.35|10524|26|NZ_LNVJ01000023|CRT 10524-10549 26 MT657333 Microbacterium phage Casend, complete genome 27308-27333 4 0.846
NZ_LNVJ01000023_1 1.35|10524|26|NZ_LNVJ01000023|CRT 10524-10549 26 NC_047975 Microbacterium phage Squash, complete genome 27411-27436 4 0.846
NZ_LNVJ01000023_1 1.36|10572|26|NZ_LNVJ01000023|CRT 10572-10597 26 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 1148986-1149011 4 0.846
NZ_LNVJ01000023_1 1.37|10620|26|NZ_LNVJ01000023|CRT 10620-10645 26 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 487851-487876 4 0.846
NZ_LNVJ01000023_1 1.37|10620|26|NZ_LNVJ01000023|CRT 10620-10645 26 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 379093-379118 4 0.846
NZ_LNVJ01000023_1 1.38|10668|26|NZ_LNVJ01000023|CRT 10668-10693 26 NZ_AP021845 Azospira sp. I09 plasmid pAZI09, complete sequence 80122-80147 4 0.846
NZ_LNVJ01000023_1 1.38|10668|26|NZ_LNVJ01000023|CRT 10668-10693 26 NZ_CP044348 Escherichia coli strain P225M plasmid pP225M-2, complete sequence 64172-64197 4 0.846
NZ_LNVJ01000023_1 1.38|10668|26|NZ_LNVJ01000023|CRT 10668-10693 26 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 774222-774247 4 0.846
NZ_LNVJ01000023_1 1.39|10716|26|NZ_LNVJ01000023|CRT 10716-10741 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 16802-16827 4 0.846
NZ_LNVJ01000023_1 1.39|10716|26|NZ_LNVJ01000023|CRT 10716-10741 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 111044-111069 4 0.846
NZ_LNVJ01000023_1 1.39|10716|26|NZ_LNVJ01000023|CRT 10716-10741 26 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 3898-3923 4 0.846
NZ_LNVJ01000023_1 1.40|10764|26|NZ_LNVJ01000023|CRT 10764-10789 26 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 325313-325338 4 0.846
NZ_LNVJ01000023_1 1.40|10764|26|NZ_LNVJ01000023|CRT 10764-10789 26 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 475253-475278 4 0.846
NZ_LNVJ01000023_1 1.40|10764|26|NZ_LNVJ01000023|CRT 10764-10789 26 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 497431-497456 4 0.846
NZ_LNVJ01000023_1 1.40|10764|26|NZ_LNVJ01000023|CRT 10764-10789 26 NZ_CP045074 Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence 12931-12956 4 0.846
NZ_LNVJ01000023_1 1.40|10764|26|NZ_LNVJ01000023|CRT 10764-10789 26 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 783845-783870 4 0.846
NZ_LNVJ01000023_1 1.40|10764|26|NZ_LNVJ01000023|CRT 10764-10789 26 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 445755-445780 4 0.846
NZ_LNVJ01000023_1 1.40|10764|26|NZ_LNVJ01000023|CRT 10764-10789 26 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 270965-270990 4 0.846
NZ_LNVJ01000023_1 1.41|10812|26|NZ_LNVJ01000023|CRT 10812-10837 26 NZ_CP032326 Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence 173114-173139 4 0.846
NZ_LNVJ01000023_1 1.41|10812|26|NZ_LNVJ01000023|CRT 10812-10837 26 NZ_CP012918 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence 27098-27123 4 0.846
NZ_LNVJ01000023_1 1.42|10860|26|NZ_LNVJ01000023|CRT 10860-10885 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 16802-16827 4 0.846
NZ_LNVJ01000023_1 1.42|10860|26|NZ_LNVJ01000023|CRT 10860-10885 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 111044-111069 4 0.846
NZ_LNVJ01000023_1 1.42|10860|26|NZ_LNVJ01000023|CRT 10860-10885 26 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 34684-34709 4 0.846
NZ_LNVJ01000023_1 1.43|10908|26|NZ_LNVJ01000023|CRT 10908-10933 26 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 408821-408846 4 0.846
NZ_LNVJ01000023_1 1.44|10956|26|NZ_LNVJ01000023|CRT 10956-10981 26 NZ_CP044348 Escherichia coli strain P225M plasmid pP225M-2, complete sequence 64172-64197 4 0.846
NZ_LNVJ01000023_1 1.45|11004|26|NZ_LNVJ01000023|CRT 11004-11029 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 16802-16827 4 0.846
NZ_LNVJ01000023_1 1.45|11004|26|NZ_LNVJ01000023|CRT 11004-11029 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 111044-111069 4 0.846
NZ_LNVJ01000023_1 1.45|11004|26|NZ_LNVJ01000023|CRT 11004-11029 26 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 3898-3923 4 0.846
NZ_LNVJ01000023_1 1.46|11052|26|NZ_LNVJ01000023|CRT 11052-11077 26 NZ_LR594668 Variovorax sp. SRS16 plasmid 3 83523-83548 4 0.846
NZ_LNVJ01000023_1 1.46|11052|26|NZ_LNVJ01000023|CRT 11052-11077 26 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 112115-112140 4 0.846
NZ_LNVJ01000023_1 1.46|11052|26|NZ_LNVJ01000023|CRT 11052-11077 26 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 487851-487876 4 0.846
NZ_LNVJ01000023_1 1.46|11052|26|NZ_LNVJ01000023|CRT 11052-11077 26 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 1130149-1130174 4 0.846
NZ_LNVJ01000023_1 1.46|11052|26|NZ_LNVJ01000023|CRT 11052-11077 26 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 987306-987331 4 0.846
NZ_LNVJ01000023_1 1.47|11100|26|NZ_LNVJ01000023|CRT 11100-11125 26 NZ_CP045406 Roseovarius sp. THAF9 plasmid pTHAF9_b, complete sequence 5141-5166 4 0.846
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1555871-1555896 4 0.846
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 618528-618553 4 0.846
NZ_LNVJ01000023_1 1.49|11196|26|NZ_LNVJ01000023|CRT 11196-11221 26 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 325313-325338 4 0.846
NZ_LNVJ01000023_1 1.49|11196|26|NZ_LNVJ01000023|CRT 11196-11221 26 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 475253-475278 4 0.846
NZ_LNVJ01000023_1 1.49|11196|26|NZ_LNVJ01000023|CRT 11196-11221 26 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 497431-497456 4 0.846
NZ_LNVJ01000023_1 1.49|11196|26|NZ_LNVJ01000023|CRT 11196-11221 26 NZ_CP045074 Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence 12931-12956 4 0.846
NZ_LNVJ01000023_1 1.49|11196|26|NZ_LNVJ01000023|CRT 11196-11221 26 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 783845-783870 4 0.846
NZ_LNVJ01000023_1 1.49|11196|26|NZ_LNVJ01000023|CRT 11196-11221 26 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 445755-445780 4 0.846
NZ_LNVJ01000023_1 1.49|11196|26|NZ_LNVJ01000023|CRT 11196-11221 26 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 270965-270990 4 0.846
NZ_LNVJ01000023_1 1.50|11244|26|NZ_LNVJ01000023|CRT 11244-11269 26 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 673011-673036 4 0.846
NZ_LNVJ01000023_1 1.50|11244|26|NZ_LNVJ01000023|CRT 11244-11269 26 NZ_CP032326 Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence 173114-173139 4 0.846
NZ_LNVJ01000023_1 1.50|11244|26|NZ_LNVJ01000023|CRT 11244-11269 26 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1641960-1641985 4 0.846
NZ_LNVJ01000023_1 1.50|11244|26|NZ_LNVJ01000023|CRT 11244-11269 26 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1659506-1659531 4 0.846
NZ_LNVJ01000023_1 1.50|11244|26|NZ_LNVJ01000023|CRT 11244-11269 26 NZ_CP015232 Epibacterium mobile F1926 plasmid unnamed2, complete sequence 140917-140942 4 0.846
NZ_LNVJ01000023_1 1.50|11244|26|NZ_LNVJ01000023|CRT 11244-11269 26 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 359535-359560 4 0.846
NZ_LNVJ01000023_1 1.50|11244|26|NZ_LNVJ01000023|CRT 11244-11269 26 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 359522-359547 4 0.846
NZ_LNVJ01000023_1 1.50|11244|26|NZ_LNVJ01000023|CRT 11244-11269 26 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1624841-1624866 4 0.846
NZ_LNVJ01000023_1 1.50|11244|26|NZ_LNVJ01000023|CRT 11244-11269 26 NZ_CP012918 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence 27098-27123 4 0.846
NZ_LNVJ01000023_1 1.50|11244|26|NZ_LNVJ01000023|CRT 11244-11269 26 NZ_LR027555 Epibacterium mobile isolate EPIB1 plasmid 3, complete sequence 61582-61607 4 0.846
NZ_LNVJ01000023_1 1.51|11292|26|NZ_LNVJ01000023|CRT 11292-11317 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 16802-16827 4 0.846
NZ_LNVJ01000023_1 1.51|11292|26|NZ_LNVJ01000023|CRT 11292-11317 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 111044-111069 4 0.846
NZ_LNVJ01000023_1 1.51|11292|26|NZ_LNVJ01000023|CRT 11292-11317 26 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 34684-34709 4 0.846
NZ_LNVJ01000023_1 1.53|11388|26|NZ_LNVJ01000023|CRT 11388-11413 26 NZ_CP015232 Epibacterium mobile F1926 plasmid unnamed2, complete sequence 140917-140942 4 0.846
NZ_LNVJ01000023_1 1.54|11436|26|NZ_LNVJ01000023|CRT 11436-11461 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 16802-16827 4 0.846
NZ_LNVJ01000023_1 1.54|11436|26|NZ_LNVJ01000023|CRT 11436-11461 26 NZ_CP018759 Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence 111044-111069 4 0.846
NZ_LNVJ01000023_1 1.54|11436|26|NZ_LNVJ01000023|CRT 11436-11461 26 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 34684-34709 4 0.846
NZ_LNVJ01000023_1 1.55|11484|26|NZ_LNVJ01000023|CRT 11484-11509 26 NZ_CP014942 Rhodococcus sp. BH4 plasmid, complete sequence 548034-548059 4 0.846
NZ_LNVJ01000023_1 1.55|11484|26|NZ_LNVJ01000023|CRT 11484-11509 26 NZ_CP007256 Rhodococcus erythropolis R138 plasmid pCRE138, complete sequence 70971-70996 4 0.846
NZ_LNVJ01000023_1 1.55|11484|26|NZ_LNVJ01000023|CRT 11484-11509 26 NZ_CP017242 Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence 6332-6357 4 0.846
NZ_LNVJ01000023_1 1.57|11580|26|NZ_LNVJ01000023|CRT 11580-11605 26 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 436690-436715 4 0.846
NZ_LNVJ01000023_1 1.57|11580|26|NZ_LNVJ01000023|CRT 11580-11605 26 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 614174-614199 4 0.846
NZ_LNVJ01000023_1 1.58|11628|26|NZ_LNVJ01000023|CRT 11628-11653 26 NZ_CP023738 Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence 195900-195925 4 0.846
NZ_LNVJ01000023_3 3.3|12366|25|NZ_LNVJ01000023|CRISPRCasFinder 12366-12390 25 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 351846-351870 4 0.84
NZ_LNVJ01000023_3 3.4|12414|25|NZ_LNVJ01000023|CRISPRCasFinder 12414-12438 25 MK757446 Mycobacterium phage Candle, complete genome 9162-9186 4 0.84
NZ_LNVJ01000023_3 3.4|12414|25|NZ_LNVJ01000023|CRISPRCasFinder 12414-12438 25 KY969628 Mycobacterium phage Zenon, complete genome 9164-9188 4 0.84
NZ_LNVJ01000023_3 3.4|12414|25|NZ_LNVJ01000023|CRISPRCasFinder 12414-12438 25 MH926059 Mycobacterium phage Riparian, complete genome 8620-8644 4 0.84
NZ_LNVJ01000023_3 3.4|12414|25|NZ_LNVJ01000023|CRISPRCasFinder 12414-12438 25 JF704112 Mycobacterium phage Send513, complete sequence 9162-9186 4 0.84
NZ_LNVJ01000023_3 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder 12462-12486 25 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 884327-884351 4 0.84
NZ_LNVJ01000023_3 3.6|12510|25|NZ_LNVJ01000023|CRISPRCasFinder 12510-12534 25 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 1379972-1379996 4 0.84
NZ_LNVJ01000023_3 3.6|12510|25|NZ_LNVJ01000023|CRISPRCasFinder 12510-12534 25 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 1379950-1379974 4 0.84
NZ_LNVJ01000023_3 3.7|12558|25|NZ_LNVJ01000023|CRISPRCasFinder 12558-12582 25 NZ_CP010990 Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence 60660-60684 4 0.84
NZ_LNVJ01000023_3 3.8|12606|25|NZ_LNVJ01000023|CRISPRCasFinder 12606-12630 25 NZ_CP045549 Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence 19015-19039 4 0.84
NZ_LNVJ01000023_1 1.1|8892|26|NZ_LNVJ01000023|CRT 8892-8917 26 NZ_CP021373 Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence 14156-14181 5 0.808
NZ_LNVJ01000023_1 1.3|8988|26|NZ_LNVJ01000023|CRT 8988-9013 26 NZ_CP047178 Rathayibacter sp. VKM Ac-2759 plasmid unnamed2, complete sequence 11775-11800 5 0.808
NZ_LNVJ01000023_1 1.4|9036|26|NZ_LNVJ01000023|CRT 9036-9061 26 NZ_CP027551 Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence 9301-9326 5 0.808
NZ_LNVJ01000023_1 1.4|9036|26|NZ_LNVJ01000023|CRT 9036-9061 26 NZ_CP027551 Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence 45532-45557 5 0.808
NZ_LNVJ01000023_1 1.4|9036|26|NZ_LNVJ01000023|CRT 9036-9061 26 NZ_CP027551 Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence 53542-53567 5 0.808
NZ_LNVJ01000023_1 1.4|9036|26|NZ_LNVJ01000023|CRT 9036-9061 26 NZ_CP027551 Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence 58047-58072 5 0.808
NZ_LNVJ01000023_1 1.4|9036|26|NZ_LNVJ01000023|CRT 9036-9061 26 NZ_CP027551 Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence 67068-67093 5 0.808
NZ_LNVJ01000023_1 1.5|9084|26|NZ_LNVJ01000023|CRT 9084-9109 26 NC_015057 Granulicella tundricola MP5ACTX9 plasmid pACIX901, complete sequence 208837-208862 5 0.808
NZ_LNVJ01000023_1 1.7|9180|26|NZ_LNVJ01000023|CRT 9180-9205 26 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 112115-112140 5 0.808
NZ_LNVJ01000023_1 1.7|9180|26|NZ_LNVJ01000023|CRT 9180-9205 26 NZ_CP029209 Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence 294347-294372 5 0.808
NZ_LNVJ01000023_1 1.8|9228|26|NZ_LNVJ01000023|CRT 9228-9253 26 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 899336-899361 5 0.808
NZ_LNVJ01000023_1 1.8|9228|26|NZ_LNVJ01000023|CRT 9228-9253 26 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 295595-295620 5 0.808
NZ_LNVJ01000023_1 1.8|9228|26|NZ_LNVJ01000023|CRT 9228-9253 26 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 501105-501130 5 0.808
NZ_LNVJ01000023_1 1.8|9228|26|NZ_LNVJ01000023|CRT 9228-9253 26 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 158361-158386 5 0.808
NZ_LNVJ01000023_1 1.8|9228|26|NZ_LNVJ01000023|CRT 9228-9253 26 MF375456 Xanthomonas phage phi Xc10, complete genome 25609-25634 5 0.808
NZ_LNVJ01000023_1 1.8|9228|26|NZ_LNVJ01000023|CRT 9228-9253 26 NC_030937 Xanthomonas phage f30-Xaj, complete genome 11639-11664 5 0.808
NZ_LNVJ01000023_1 1.8|9228|26|NZ_LNVJ01000023|CRT 9228-9253 26 MK903278 Xanthomonas phage Pagan, complete genome 25833-25858 5 0.808
NZ_LNVJ01000023_1 1.8|9228|26|NZ_LNVJ01000023|CRT 9228-9253 26 NC_030928 Xanthomonas phage f20-Xaj, complete genome 25560-25585 5 0.808
NZ_LNVJ01000023_1 1.10|9324|26|NZ_LNVJ01000023|CRT 9324-9349 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 67570-67595 5 0.808
NZ_LNVJ01000023_1 1.10|9324|26|NZ_LNVJ01000023|CRT 9324-9349 26 NZ_CP049116 Pantoea stewartii strain ZJ-FGZX1 plasmid unnamed1, complete sequence 269956-269981 5 0.808
NZ_LNVJ01000023_1 1.10|9324|26|NZ_LNVJ01000023|CRT 9324-9349 26 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 25845-25870 5 0.808
NZ_LNVJ01000023_1 1.12|9420|26|NZ_LNVJ01000023|CRT 9420-9445 26 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 595383-595408 5 0.808
NZ_LNVJ01000023_1 1.12|9420|26|NZ_LNVJ01000023|CRT 9420-9445 26 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 180300-180325 5 0.808
NZ_LNVJ01000023_1 1.13|9468|26|NZ_LNVJ01000023|CRT 9468-9493 26 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1294328-1294353 5 0.808
NZ_LNVJ01000023_1 1.15|9564|26|NZ_LNVJ01000023|CRT 9564-9589 26 NZ_LT984809 Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence 134799-134824 5 0.808
NZ_LNVJ01000023_1 1.15|9564|26|NZ_LNVJ01000023|CRT 9564-9589 26 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 4571-4596 5 0.808
NZ_LNVJ01000023_1 1.16|9612|26|NZ_LNVJ01000023|CRT 9612-9637 26 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1107033-1107058 5 0.808
NZ_LNVJ01000023_1 1.23|9948|26|NZ_LNVJ01000023|CRT 9948-9973 26 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4359911-4359936 5 0.808
NZ_LNVJ01000023_1 1.25|10044|26|NZ_LNVJ01000023|CRT 10044-10069 26 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 513479-513504 5 0.808
NZ_LNVJ01000023_1 1.25|10044|26|NZ_LNVJ01000023|CRT 10044-10069 26 NC_008308 Sphingomonas sp. KA1 plasmid pCAR3 DNA, complete sequence 118376-118401 5 0.808
NZ_LNVJ01000023_1 1.25|10044|26|NZ_LNVJ01000023|CRT 10044-10069 26 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 371854-371879 5 0.808
NZ_LNVJ01000023_1 1.25|10044|26|NZ_LNVJ01000023|CRT 10044-10069 26 NC_015597 Sinorhizobium meliloti AK83 plasmid pSINME01, complete sequence 166575-166600 5 0.808
NZ_LNVJ01000023_1 1.25|10044|26|NZ_LNVJ01000023|CRT 10044-10069 26 NZ_CP018064 Rhodococcus sp. 2G plasmid p1, complete sequence 323169-323194 5 0.808
NZ_LNVJ01000023_1 1.25|10044|26|NZ_LNVJ01000023|CRT 10044-10069 26 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 1168608-1168633 5 0.808
NZ_LNVJ01000023_1 1.25|10044|26|NZ_LNVJ01000023|CRT 10044-10069 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 67570-67595 5 0.808
NZ_LNVJ01000023_1 1.25|10044|26|NZ_LNVJ01000023|CRT 10044-10069 26 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 1286344-1286369 5 0.808
NZ_LNVJ01000023_1 1.25|10044|26|NZ_LNVJ01000023|CRT 10044-10069 26 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 249721-249746 5 0.808
NZ_LNVJ01000023_1 1.25|10044|26|NZ_LNVJ01000023|CRT 10044-10069 26 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 535597-535622 5 0.808
NZ_LNVJ01000023_1 1.25|10044|26|NZ_LNVJ01000023|CRT 10044-10069 26 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 89825-89850 5 0.808
NZ_LNVJ01000023_1 1.25|10044|26|NZ_LNVJ01000023|CRT 10044-10069 26 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 175304-175329 5 0.808
NZ_LNVJ01000023_1 1.25|10044|26|NZ_LNVJ01000023|CRT 10044-10069 26 NZ_CP019483 Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence 1050790-1050815 5 0.808
NZ_LNVJ01000023_1 1.25|10044|26|NZ_LNVJ01000023|CRT 10044-10069 26 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 25845-25870 5 0.808
NZ_LNVJ01000023_1 1.25|10044|26|NZ_LNVJ01000023|CRT 10044-10069 26 NZ_CP019486 Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence 1005013-1005038 5 0.808
NZ_LNVJ01000023_1 1.25|10044|26|NZ_LNVJ01000023|CRT 10044-10069 26 NZ_CP024891 Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence 84391-84416 5 0.808
NZ_LNVJ01000023_1 1.28|10188|26|NZ_LNVJ01000023|CRT 10188-10213 26 NZ_CP045122 Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence 210197-210222 5 0.808
NZ_LNVJ01000023_1 1.28|10188|26|NZ_LNVJ01000023|CRT 10188-10213 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 67570-67595 5 0.808
NZ_LNVJ01000023_1 1.28|10188|26|NZ_LNVJ01000023|CRT 10188-10213 26 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 25845-25870 5 0.808
NZ_LNVJ01000023_1 1.28|10188|26|NZ_LNVJ01000023|CRT 10188-10213 26 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 45322-45347 5 0.808
NZ_LNVJ01000023_1 1.29|10236|26|NZ_LNVJ01000023|CRT 10236-10261 26 MN183284 Microbacterium phage Mashley, complete genome 26997-27022 5 0.808
NZ_LNVJ01000023_1 1.31|10332|26|NZ_LNVJ01000023|CRT 10332-10357 26 NZ_CP045122 Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence 210197-210222 5 0.808
NZ_LNVJ01000023_1 1.31|10332|26|NZ_LNVJ01000023|CRT 10332-10357 26 NZ_CP016289 Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence 6045-6070 5 0.808
NZ_LNVJ01000023_1 1.32|10380|26|NZ_LNVJ01000023|CRT 10380-10405 26 MN183284 Microbacterium phage Mashley, complete genome 26997-27022 5 0.808
NZ_LNVJ01000023_1 1.34|10476|26|NZ_LNVJ01000023|CRT 10476-10501 26 NZ_CP045122 Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence 210197-210222 5 0.808
NZ_LNVJ01000023_1 1.34|10476|26|NZ_LNVJ01000023|CRT 10476-10501 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 67570-67595 5 0.808
NZ_LNVJ01000023_1 1.34|10476|26|NZ_LNVJ01000023|CRT 10476-10501 26 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 25845-25870 5 0.808
NZ_LNVJ01000023_1 1.34|10476|26|NZ_LNVJ01000023|CRT 10476-10501 26 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 45322-45347 5 0.808
NZ_LNVJ01000023_1 1.35|10524|26|NZ_LNVJ01000023|CRT 10524-10549 26 MN183284 Microbacterium phage Mashley, complete genome 26997-27022 5 0.808
NZ_LNVJ01000023_1 1.37|10620|26|NZ_LNVJ01000023|CRT 10620-10645 26 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 112115-112140 5 0.808
NZ_LNVJ01000023_1 1.38|10668|26|NZ_LNVJ01000023|CRT 10668-10693 26 NZ_CP019315 Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-3, complete sequence 11628-11653 5 0.808
NZ_LNVJ01000023_1 1.39|10716|26|NZ_LNVJ01000023|CRT 10716-10741 26 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 344688-344713 5 0.808
NZ_LNVJ01000023_1 1.39|10716|26|NZ_LNVJ01000023|CRT 10716-10741 26 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 702721-702746 5 0.808
NZ_LNVJ01000023_1 1.40|10764|26|NZ_LNVJ01000023|CRT 10764-10789 26 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 513479-513504 5 0.808
NZ_LNVJ01000023_1 1.40|10764|26|NZ_LNVJ01000023|CRT 10764-10789 26 NC_008308 Sphingomonas sp. KA1 plasmid pCAR3 DNA, complete sequence 118376-118401 5 0.808
NZ_LNVJ01000023_1 1.40|10764|26|NZ_LNVJ01000023|CRT 10764-10789 26 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 371854-371879 5 0.808
NZ_LNVJ01000023_1 1.40|10764|26|NZ_LNVJ01000023|CRT 10764-10789 26 NC_015597 Sinorhizobium meliloti AK83 plasmid pSINME01, complete sequence 166575-166600 5 0.808
NZ_LNVJ01000023_1 1.40|10764|26|NZ_LNVJ01000023|CRT 10764-10789 26 NZ_CP018064 Rhodococcus sp. 2G plasmid p1, complete sequence 323169-323194 5 0.808
NZ_LNVJ01000023_1 1.40|10764|26|NZ_LNVJ01000023|CRT 10764-10789 26 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 1168608-1168633 5 0.808
NZ_LNVJ01000023_1 1.40|10764|26|NZ_LNVJ01000023|CRT 10764-10789 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 67570-67595 5 0.808
NZ_LNVJ01000023_1 1.40|10764|26|NZ_LNVJ01000023|CRT 10764-10789 26 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 1286344-1286369 5 0.808
NZ_LNVJ01000023_1 1.40|10764|26|NZ_LNVJ01000023|CRT 10764-10789 26 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 249721-249746 5 0.808
NZ_LNVJ01000023_1 1.40|10764|26|NZ_LNVJ01000023|CRT 10764-10789 26 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 535597-535622 5 0.808
NZ_LNVJ01000023_1 1.40|10764|26|NZ_LNVJ01000023|CRT 10764-10789 26 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 89825-89850 5 0.808
NZ_LNVJ01000023_1 1.40|10764|26|NZ_LNVJ01000023|CRT 10764-10789 26 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 175304-175329 5 0.808
NZ_LNVJ01000023_1 1.40|10764|26|NZ_LNVJ01000023|CRT 10764-10789 26 NZ_CP019483 Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence 1050790-1050815 5 0.808
NZ_LNVJ01000023_1 1.40|10764|26|NZ_LNVJ01000023|CRT 10764-10789 26 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 25845-25870 5 0.808
NZ_LNVJ01000023_1 1.40|10764|26|NZ_LNVJ01000023|CRT 10764-10789 26 NZ_CP019486 Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence 1005013-1005038 5 0.808
NZ_LNVJ01000023_1 1.40|10764|26|NZ_LNVJ01000023|CRT 10764-10789 26 NZ_CP024891 Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence 84391-84416 5 0.808
NZ_LNVJ01000023_1 1.41|10812|26|NZ_LNVJ01000023|CRT 10812-10837 26 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 673011-673036 5 0.808
NZ_LNVJ01000023_1 1.42|10860|26|NZ_LNVJ01000023|CRT 10860-10885 26 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 3898-3923 5 0.808
NZ_LNVJ01000023_1 1.43|10908|26|NZ_LNVJ01000023|CRT 10908-10933 26 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 487851-487876 5 0.808
NZ_LNVJ01000023_1 1.43|10908|26|NZ_LNVJ01000023|CRT 10908-10933 26 NZ_CP017422 Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence 108324-108349 5 0.808
NZ_LNVJ01000023_1 1.43|10908|26|NZ_LNVJ01000023|CRT 10908-10933 26 NZ_CP045122 Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence 210197-210222 5 0.808
NZ_LNVJ01000023_1 1.43|10908|26|NZ_LNVJ01000023|CRT 10908-10933 26 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 341354-341379 5 0.808
NZ_LNVJ01000023_1 1.43|10908|26|NZ_LNVJ01000023|CRT 10908-10933 26 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 45322-45347 5 0.808
NZ_LNVJ01000023_1 1.44|10956|26|NZ_LNVJ01000023|CRT 10956-10981 26 NZ_CP035502 Sphingosinicella sp. BN140058 plasmid p1, complete sequence 159356-159381 5 0.808
NZ_LNVJ01000023_1 1.44|10956|26|NZ_LNVJ01000023|CRT 10956-10981 26 NZ_CP019315 Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-3, complete sequence 11628-11653 5 0.808
NZ_LNVJ01000023_1 1.44|10956|26|NZ_LNVJ01000023|CRT 10956-10981 26 MT498057 Microbacterium phage Cicada, complete genome 22953-22978 5 0.808
NZ_LNVJ01000023_1 1.45|11004|26|NZ_LNVJ01000023|CRT 11004-11029 26 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 344688-344713 5 0.808
NZ_LNVJ01000023_1 1.45|11004|26|NZ_LNVJ01000023|CRT 11004-11029 26 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 702721-702746 5 0.808
NZ_LNVJ01000023_1 1.46|11052|26|NZ_LNVJ01000023|CRT 11052-11077 26 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1389298-1389323 5 0.808
NZ_LNVJ01000023_1 1.46|11052|26|NZ_LNVJ01000023|CRT 11052-11077 26 NZ_MN433457 Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence 299573-299598 5 0.808
NZ_LNVJ01000023_1 1.46|11052|26|NZ_LNVJ01000023|CRT 11052-11077 26 NZ_CP022416 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-1, complete sequence 228968-228993 5 0.808
NZ_LNVJ01000023_1 1.46|11052|26|NZ_LNVJ01000023|CRT 11052-11077 26 MN583270 Pseudomonas aeruginosa strain NK546 plasmid pNK546b, complete sequence 26605-26630 5 0.808
NZ_LNVJ01000023_1 1.46|11052|26|NZ_LNVJ01000023|CRT 11052-11077 26 NZ_CP014598 Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence 224229-224254 5 0.808
NZ_LNVJ01000023_1 1.46|11052|26|NZ_LNVJ01000023|CRT 11052-11077 26 MK376351 Pseudomonas sp. strain ANT_H62 plasmid pA62H2, complete sequence 57727-57752 5 0.808
NZ_LNVJ01000023_1 1.47|11100|26|NZ_LNVJ01000023|CRT 11100-11125 26 NZ_CP013856 Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence 102633-102658 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1839450-1839475 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 754600-754625 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 752536-752561 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1171297-1171322 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 849514-849539 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 803210-803235 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 899399-899424 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 751676-751701 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP021043 Phaeobacter gallaeciensis strain P129 plasmid pP129_c, complete sequence 8997-9022 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 649783-649808 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 717478-717503 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP010676 Phaeobacter gallaeciensis strain P75 plasmid pP75_c, complete sequence 8986-9011 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 874639-874664 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NC_023139 Phaeobacter gallaeciensis DSM 26640 plasmid pGal_C110, complete sequence 9144-9169 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1171426-1171451 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 899391-899416 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 630477-630502 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 667645-667670 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1226801-1226826 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 899406-899431 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 791469-791494 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 234551-234576 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 878985-879010 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 725022-725047 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1202238-1202263 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 806702-806727 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 706034-706059 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 648898-648923 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 651732-651757 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 651722-651747 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 805303-805328 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 992401-992426 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1171031-1171056 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 649771-649796 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 649789-649814 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 649768-649793 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 277028-277053 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1182790-1182815 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 132453-132478 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 878974-878999 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 992368-992393 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 913215-913240 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 992369-992394 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1170976-1171001 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 773107-773132 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 913215-913240 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 659609-659634 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 992382-992407 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 754664-754689 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 773130-773155 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 913215-913240 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 913215-913240 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 913215-913240 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 992382-992407 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1158931-1158956 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 992371-992396 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 773130-773155 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 807848-807873 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 754664-754689 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 788541-788566 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 842775-842800 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 879657-879682 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1271951-1271976 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 992371-992396 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 773130-773155 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 925031-925056 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 992367-992392 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 773130-773155 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 773130-773155 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 992382-992407 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 913217-913242 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1185737-1185762 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 992393-992418 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 992371-992396 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1185737-1185762 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP010591 Phaeobacter gallaeciensis strain P11 plasmid pP11_c, complete sequence 8986-9011 5 0.808
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 754650-754675 5 0.808
NZ_LNVJ01000023_1 1.49|11196|26|NZ_LNVJ01000023|CRT 11196-11221 26 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 513479-513504 5 0.808
NZ_LNVJ01000023_1 1.49|11196|26|NZ_LNVJ01000023|CRT 11196-11221 26 NC_008308 Sphingomonas sp. KA1 plasmid pCAR3 DNA, complete sequence 118376-118401 5 0.808
NZ_LNVJ01000023_1 1.49|11196|26|NZ_LNVJ01000023|CRT 11196-11221 26 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 371854-371879 5 0.808
NZ_LNVJ01000023_1 1.49|11196|26|NZ_LNVJ01000023|CRT 11196-11221 26 NC_015597 Sinorhizobium meliloti AK83 plasmid pSINME01, complete sequence 166575-166600 5 0.808
NZ_LNVJ01000023_1 1.49|11196|26|NZ_LNVJ01000023|CRT 11196-11221 26 NZ_CP018064 Rhodococcus sp. 2G plasmid p1, complete sequence 323169-323194 5 0.808
NZ_LNVJ01000023_1 1.49|11196|26|NZ_LNVJ01000023|CRT 11196-11221 26 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 1168608-1168633 5 0.808
NZ_LNVJ01000023_1 1.49|11196|26|NZ_LNVJ01000023|CRT 11196-11221 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 67570-67595 5 0.808
NZ_LNVJ01000023_1 1.49|11196|26|NZ_LNVJ01000023|CRT 11196-11221 26 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 1286344-1286369 5 0.808
NZ_LNVJ01000023_1 1.49|11196|26|NZ_LNVJ01000023|CRT 11196-11221 26 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 249721-249746 5 0.808
NZ_LNVJ01000023_1 1.49|11196|26|NZ_LNVJ01000023|CRT 11196-11221 26 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 535597-535622 5 0.808
NZ_LNVJ01000023_1 1.49|11196|26|NZ_LNVJ01000023|CRT 11196-11221 26 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 89825-89850 5 0.808
NZ_LNVJ01000023_1 1.49|11196|26|NZ_LNVJ01000023|CRT 11196-11221 26 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 175304-175329 5 0.808
NZ_LNVJ01000023_1 1.49|11196|26|NZ_LNVJ01000023|CRT 11196-11221 26 NZ_CP019483 Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence 1050790-1050815 5 0.808
NZ_LNVJ01000023_1 1.49|11196|26|NZ_LNVJ01000023|CRT 11196-11221 26 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 25845-25870 5 0.808
NZ_LNVJ01000023_1 1.49|11196|26|NZ_LNVJ01000023|CRT 11196-11221 26 NZ_CP019486 Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence 1005013-1005038 5 0.808
NZ_LNVJ01000023_1 1.49|11196|26|NZ_LNVJ01000023|CRT 11196-11221 26 NZ_CP024891 Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence 84391-84416 5 0.808
NZ_LNVJ01000023_1 1.50|11244|26|NZ_LNVJ01000023|CRT 11244-11269 26 NZ_CP049029 Fluviibacterium aquatile strain SC52 plasmid pSC52_1, complete sequence 116653-116678 5 0.808
NZ_LNVJ01000023_1 1.51|11292|26|NZ_LNVJ01000023|CRT 11292-11317 26 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 3898-3923 5 0.808
NZ_LNVJ01000023_1 1.52|11340|26|NZ_LNVJ01000023|CRT 11340-11365 26 NZ_KX426227 Acinetobacter lwoffii strain ED23-35 plasmid pALWED1.1, complete sequence 168483-168508 5 0.808
NZ_LNVJ01000023_1 1.52|11340|26|NZ_LNVJ01000023|CRT 11340-11365 26 CP033569 Acinetobacter pittii strain 2014N21-145 plasmid p2014N21-145-1, complete sequence 150546-150571 5 0.808
NZ_LNVJ01000023_1 1.52|11340|26|NZ_LNVJ01000023|CRT 11340-11365 26 NZ_CP017422 Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence 108324-108349 5 0.808
NZ_LNVJ01000023_1 1.52|11340|26|NZ_LNVJ01000023|CRT 11340-11365 26 NZ_CP010351 Acinetobacter johnsonii XBB1 plasmid pXBB1-9, complete sequence 318096-318121 5 0.808
NZ_LNVJ01000023_1 1.52|11340|26|NZ_LNVJ01000023|CRT 11340-11365 26 NZ_CP029396 Acinetobacter defluvii strain WCHA30 plasmid pOXA58_010030, complete sequence 308932-308957 5 0.808
NZ_LNVJ01000023_1 1.53|11388|26|NZ_LNVJ01000023|CRT 11388-11413 26 NZ_CP049029 Fluviibacterium aquatile strain SC52 plasmid pSC52_1, complete sequence 116653-116678 5 0.808
NZ_LNVJ01000023_1 1.53|11388|26|NZ_LNVJ01000023|CRT 11388-11413 26 NZ_CP032326 Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence 173114-173139 5 0.808
NZ_LNVJ01000023_1 1.53|11388|26|NZ_LNVJ01000023|CRT 11388-11413 26 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1641960-1641985 5 0.808
NZ_LNVJ01000023_1 1.53|11388|26|NZ_LNVJ01000023|CRT 11388-11413 26 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1659506-1659531 5 0.808
NZ_LNVJ01000023_1 1.53|11388|26|NZ_LNVJ01000023|CRT 11388-11413 26 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 359535-359560 5 0.808
NZ_LNVJ01000023_1 1.53|11388|26|NZ_LNVJ01000023|CRT 11388-11413 26 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 359522-359547 5 0.808
NZ_LNVJ01000023_1 1.53|11388|26|NZ_LNVJ01000023|CRT 11388-11413 26 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1624841-1624866 5 0.808
NZ_LNVJ01000023_1 1.53|11388|26|NZ_LNVJ01000023|CRT 11388-11413 26 NZ_CP012918 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence 27098-27123 5 0.808
NZ_LNVJ01000023_1 1.54|11436|26|NZ_LNVJ01000023|CRT 11436-11461 26 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 3898-3923 5 0.808
NZ_LNVJ01000023_1 1.55|11484|26|NZ_LNVJ01000023|CRT 11484-11509 26 NZ_CP017782 Rhodobacter sp. LPB0142 plasmid pEJ01, complete sequence 4813-4838 5 0.808
NZ_LNVJ01000023_1 1.55|11484|26|NZ_LNVJ01000023|CRT 11484-11509 26 NZ_CP017782 Rhodobacter sp. LPB0142 plasmid pEJ01, complete sequence 114089-114114 5 0.808
NZ_LNVJ01000023_1 1.58|11628|26|NZ_LNVJ01000023|CRT 11628-11653 26 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 33473-33498 5 0.808
NZ_LNVJ01000023_1 1.58|11628|26|NZ_LNVJ01000023|CRT 11628-11653 26 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 146106-146131 5 0.808
NZ_LNVJ01000023_3 3.3|12366|25|NZ_LNVJ01000023|CRISPRCasFinder 12366-12390 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5288431-5288455 5 0.8
NZ_LNVJ01000023_3 3.3|12366|25|NZ_LNVJ01000023|CRISPRCasFinder 12366-12390 25 NZ_CP021658 Aeromonas salmonicida strain O23A plasmid pO23AP4, complete sequence 15910-15934 5 0.8
NZ_LNVJ01000023_3 3.3|12366|25|NZ_LNVJ01000023|CRISPRCasFinder 12366-12390 25 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 68354-68378 5 0.8
NZ_LNVJ01000023_3 3.3|12366|25|NZ_LNVJ01000023|CRISPRCasFinder 12366-12390 25 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 528593-528617 5 0.8
NZ_LNVJ01000023_3 3.3|12366|25|NZ_LNVJ01000023|CRISPRCasFinder 12366-12390 25 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 409238-409262 5 0.8
NZ_LNVJ01000023_3 3.3|12366|25|NZ_LNVJ01000023|CRISPRCasFinder 12366-12390 25 MN444870 Gordonia phage Syleon, complete genome 28799-28823 5 0.8
NZ_LNVJ01000023_3 3.3|12366|25|NZ_LNVJ01000023|CRISPRCasFinder 12366-12390 25 MH976515 Gordonia phage Octobien14, complete genome 29393-29417 5 0.8
NZ_LNVJ01000023_3 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder 12462-12486 25 MH727545 Mycobacterium phage DismalStressor, complete genome 39161-39185 5 0.8
NZ_LNVJ01000023_3 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder 12462-12486 25 NC_026598 Mycobacterium phage Milly, complete genome 39134-39158 5 0.8
NZ_LNVJ01000023_3 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder 12462-12486 25 MH834601 Mycobacterium phage BoostSeason, complete genome 38730-38754 5 0.8
NZ_LNVJ01000023_3 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder 12462-12486 25 KX688047 Mycobacterium phage Marcoliusprime, complete genome 39161-39185 5 0.8
NZ_LNVJ01000023_3 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder 12462-12486 25 NC_028759 Mycobacterium phage Mufasa, complete genome 38715-38739 5 0.8
NZ_LNVJ01000023_3 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder 12462-12486 25 MF140408 Mycobacterium phage DismalFunk, complete genome 39161-39185 5 0.8
NZ_LNVJ01000023_1 1.8|9228|26|NZ_LNVJ01000023|CRT 9228-9253 26 MN585989 Mycobacterium phage Superchunk, complete genome 5292-5317 6 0.769
NZ_LNVJ01000023_1 1.10|9324|26|NZ_LNVJ01000023|CRT 9324-9349 26 LT559120 Nonomuraea sp. ATCC 39727 isolate nono1 genome assembly, plasmid: III 23471-23496 6 0.769
NZ_LNVJ01000023_1 1.11|9372|26|NZ_LNVJ01000023|CRT 9372-9397 26 NZ_CP051294 Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence 352474-352499 6 0.769
NZ_LNVJ01000023_1 1.11|9372|26|NZ_LNVJ01000023|CRT 9372-9397 26 NZ_CP033363 Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence 352461-352486 6 0.769
NZ_LNVJ01000023_1 1.12|9420|26|NZ_LNVJ01000023|CRT 9420-9445 26 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 168561-168586 6 0.769
NZ_LNVJ01000023_1 1.12|9420|26|NZ_LNVJ01000023|CRT 9420-9445 26 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 168561-168586 6 0.769
NZ_LNVJ01000023_1 1.14|9516|26|NZ_LNVJ01000023|CRT 9516-9541 26 CP000618 Burkholderia vietnamiensis G4 plasmid pBVIE02, complete sequence 44311-44336 6 0.769
NZ_LNVJ01000023_1 1.15|9564|26|NZ_LNVJ01000023|CRT 9564-9589 26 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 91995-92020 6 0.769
NZ_LNVJ01000023_1 1.16|9612|26|NZ_LNVJ01000023|CRT 9612-9637 26 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 112115-112140 6 0.769
NZ_LNVJ01000023_1 1.23|9948|26|NZ_LNVJ01000023|CRT 9948-9973 26 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 481667-481692 6 0.769
NZ_LNVJ01000023_1 1.23|9948|26|NZ_LNVJ01000023|CRT 9948-9973 26 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 436572-436597 6 0.769
NZ_LNVJ01000023_1 1.23|9948|26|NZ_LNVJ01000023|CRT 9948-9973 26 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 481703-481728 6 0.769
NZ_LNVJ01000023_1 1.23|9948|26|NZ_LNVJ01000023|CRT 9948-9973 26 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 481702-481727 6 0.769
NZ_LNVJ01000023_1 1.23|9948|26|NZ_LNVJ01000023|CRT 9948-9973 26 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 481694-481719 6 0.769
NZ_LNVJ01000023_1 1.25|10044|26|NZ_LNVJ01000023|CRT 10044-10069 26 CP052389 Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1 116286-116311 6 0.769
NZ_LNVJ01000023_1 1.28|10188|26|NZ_LNVJ01000023|CRT 10188-10213 26 LT559120 Nonomuraea sp. ATCC 39727 isolate nono1 genome assembly, plasmid: III 23471-23496 6 0.769
NZ_LNVJ01000023_1 1.34|10476|26|NZ_LNVJ01000023|CRT 10476-10501 26 LT559120 Nonomuraea sp. ATCC 39727 isolate nono1 genome assembly, plasmid: III 23471-23496 6 0.769
NZ_LNVJ01000023_1 1.36|10572|26|NZ_LNVJ01000023|CRT 10572-10597 26 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 593315-593340 6 0.769
NZ_LNVJ01000023_1 1.38|10668|26|NZ_LNVJ01000023|CRT 10668-10693 26 NC_016591 Burkholderia sp. YI23 plasmid byi_2p, complete sequence 124119-124144 6 0.769
NZ_LNVJ01000023_1 1.38|10668|26|NZ_LNVJ01000023|CRT 10668-10693 26 CP000617 Burkholderia vietnamiensis G4 plasmid pBVIE01, complete sequence 313274-313299 6 0.769
NZ_LNVJ01000023_1 1.38|10668|26|NZ_LNVJ01000023|CRT 10668-10693 26 KY555147 Caulobacter phage Ccr34, complete genome 28484-28509 6 0.769
NZ_LNVJ01000023_1 1.38|10668|26|NZ_LNVJ01000023|CRT 10668-10693 26 KY555145 Caulobacter phage Ccr29, complete genome 31131-31156 6 0.769
NZ_LNVJ01000023_1 1.38|10668|26|NZ_LNVJ01000023|CRT 10668-10693 26 KY555143 Caulobacter phage Ccr2, complete genome 28964-28989 6 0.769
NZ_LNVJ01000023_1 1.38|10668|26|NZ_LNVJ01000023|CRT 10668-10693 26 KY555146 Caulobacter phage Ccr32, complete genome 28485-28510 6 0.769
NZ_LNVJ01000023_1 1.38|10668|26|NZ_LNVJ01000023|CRT 10668-10693 26 KY555144 Caulobacter phage Ccr5, complete genome 28359-28384 6 0.769
NZ_LNVJ01000023_1 1.38|10668|26|NZ_LNVJ01000023|CRT 10668-10693 26 JX163858 Caulobacter phage phiCbK, complete genome 179347-179372 6 0.769
NZ_LNVJ01000023_1 1.38|10668|26|NZ_LNVJ01000023|CRT 10668-10693 26 KY555142 Caulobacter phage Ccr10, complete genome 28489-28514 6 0.769
NZ_LNVJ01000023_1 1.40|10764|26|NZ_LNVJ01000023|CRT 10764-10789 26 CP052389 Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1 116286-116311 6 0.769
NZ_LNVJ01000023_1 1.43|10908|26|NZ_LNVJ01000023|CRT 10908-10933 26 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 67570-67595 6 0.769
NZ_LNVJ01000023_1 1.43|10908|26|NZ_LNVJ01000023|CRT 10908-10933 26 LT559120 Nonomuraea sp. ATCC 39727 isolate nono1 genome assembly, plasmid: III 23471-23496 6 0.769
NZ_LNVJ01000023_1 1.43|10908|26|NZ_LNVJ01000023|CRT 10908-10933 26 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 25845-25870 6 0.769
NZ_LNVJ01000023_1 1.48|11148|26|NZ_LNVJ01000023|CRT 11148-11173 26 NZ_CP020717 Cnuibacter physcomitrellae strain XA(T) plasmid unnamed2, complete sequence 21091-21116 6 0.769
NZ_LNVJ01000023_1 1.49|11196|26|NZ_LNVJ01000023|CRT 11196-11221 26 CP052389 Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1 116286-116311 6 0.769
NZ_LNVJ01000023_1 1.52|11340|26|NZ_LNVJ01000023|CRT 11340-11365 26 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 64151-64176 6 0.769
NZ_LNVJ01000023_3 3.3|12366|25|NZ_LNVJ01000023|CRISPRCasFinder 12366-12390 25 NC_019408 Caulobacter phage CcrRogue, complete genome 64287-64311 6 0.76
NZ_LNVJ01000023_3 3.3|12366|25|NZ_LNVJ01000023|CRISPRCasFinder 12366-12390 25 MT684599 Gordonia Phage Sephiroth, complete genome 28877-28901 6 0.76
NZ_LNVJ01000023_3 3.7|12558|25|NZ_LNVJ01000023|CRISPRCasFinder 12558-12582 25 NZ_CP022581 Gordonia rubripertincta strain CWB2 plasmid pGCWB2, complete sequence 8354-8378 6 0.76
NZ_LNVJ01000023_1 1.4|9036|26|NZ_LNVJ01000023|CRT 9036-9061 26 NZ_CP014599 Yangia sp. CCB-MM3 plasmid unnamed3, complete sequence 103494-103519 7 0.731
NZ_LNVJ01000023_1 1.52|11340|26|NZ_LNVJ01000023|CRT 11340-11365 26 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 135275-135300 7 0.731

1. spacer 1.7|9180|26|NZ_LNVJ01000023|CRT matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 2, identity: 0.923

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
cgcgggcaagggcagcgagatcaccg	Protospacer
**** ************* *******

2. spacer 1.7|9180|26|NZ_LNVJ01000023|CRT matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 2, identity: 0.923

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
cgcgggcaagggcagcgagatcaccg	Protospacer
**** ************* *******

3. spacer 1.7|9180|26|NZ_LNVJ01000023|CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
caagcgcgagggcagcgacatcaccg	Protospacer
*. ****.******************

4. spacer 1.7|9180|26|NZ_LNVJ01000023|CRT matches to NZ_CP029986 (Sphingomonas sp. FARSPH plasmid p01, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
cgcgcgcaagggaagcggcatcacgg	Protospacer
************ ****.****** *

5. spacer 1.7|9180|26|NZ_LNVJ01000023|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
cacgcgccaaggcagcgacatcaccg	Protospacer
*.***** *.****************

6. spacer 1.7|9180|26|NZ_LNVJ01000023|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
cacgcgccaaggcagcgacatcaccg	Protospacer
*.***** *.****************

7. spacer 1.8|9228|26|NZ_LNVJ01000023|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 3, identity: 0.885

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
cgccgggtcggacagcgcctggatcg	Protospacer
 ***************** * *****

8. spacer 1.8|9228|26|NZ_LNVJ01000023|CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 3, identity: 0.885

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
cgccggatcggacagcgcgtggatcg	Protospacer
 *****.************* *****

9. spacer 1.8|9228|26|NZ_LNVJ01000023|CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 3, identity: 0.885

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
cgccgggtcggacagcgcctggatcg	Protospacer
 ***************** * *****

10. spacer 1.8|9228|26|NZ_LNVJ01000023|CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 3, identity: 0.885

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
cgccggatcggacagcgcgtggatcg	Protospacer
 *****.************* *****

11. spacer 1.16|9612|26|NZ_LNVJ01000023|CRT matches to NZ_CP029986 (Sphingomonas sp. FARSPH plasmid p01, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgcgcaagggcagcgacatcactg	CRISPR spacer
cgcgcgcaagggaagcggcatcacgg	Protospacer
************ ****.****** *

12. spacer 1.16|9612|26|NZ_LNVJ01000023|CRT matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgcgcaagggcagcgacatcactg	CRISPR spacer
cgcgggcaagggcagcgagatcaccg	Protospacer
**** ************* *****.*

13. spacer 1.16|9612|26|NZ_LNVJ01000023|CRT matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgcgcaagggcagcgacatcactg	CRISPR spacer
cgcgggcaagggcagcgagatcaccg	Protospacer
**** ************* *****.*

14. spacer 1.17|9660|26|NZ_LNVJ01000023|CRT matches to NZ_CP010682 (Phaeobacter piscinae strain P14 plasmid pP14_a, complete sequence) position: , mismatch: 3, identity: 0.885

cgccggatccgacagttcgttgatcg	CRISPR spacer
cgccagatccgacaattcgttgatag	Protospacer
****.*********.********* *

15. spacer 1.17|9660|26|NZ_LNVJ01000023|CRT matches to NZ_CP010644 (Phaeobacter piscinae strain P36 plasmid pP36_a, complete sequence) position: , mismatch: 3, identity: 0.885

cgccggatccgacagttcgttgatcg	CRISPR spacer
cgccagatccgacaattcgttgatag	Protospacer
****.*********.********* *

16. spacer 1.25|10044|26|NZ_LNVJ01000023|CRT matches to NC_009427 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence) position: , mismatch: 3, identity: 0.885

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
tgcacgcgaaggcagcgacgtggccg	Protospacer
.******************** .***

17. spacer 1.25|10044|26|NZ_LNVJ01000023|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 3, identity: 0.885

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cgcgcgcgaaggcagcggcgtcacct	Protospacer
***.*************.******* 

18. spacer 1.25|10044|26|NZ_LNVJ01000023|CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 3, identity: 0.885

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
tgcacgcgaaggcgtcgacgtcaccg	Protospacer
.************. ***********

19. spacer 1.27|10140|26|NZ_LNVJ01000023|CRT matches to MN694784 (Marine virus AFVG_250M786, complete genome) position: , mismatch: 3, identity: 0.885

ctccggtagcgacagttcgctgacgg	CRISPR spacer
ctccgatagcgacagttcgctgccgc	Protospacer
*****.**************** ** 

20. spacer 1.28|10188|26|NZ_LNVJ01000023|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cgcgcgcgagggcagcggcgtcacct	Protospacer
*******.*********.******* 

21. spacer 1.30|10284|26|NZ_LNVJ01000023|CRT matches to MN694784 (Marine virus AFVG_250M786, complete genome) position: , mismatch: 3, identity: 0.885

ctccggtagcgacagttcgctgacgg	CRISPR spacer
ctccgatagcgacagttcgctgccgc	Protospacer
*****.**************** ** 

22. spacer 1.31|10332|26|NZ_LNVJ01000023|CRT matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcaccg	Protospacer
.****** ****** ***********

23. spacer 1.31|10332|26|NZ_LNVJ01000023|CRT matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcaccg	Protospacer
.****** ****** ***********

24. spacer 1.31|10332|26|NZ_LNVJ01000023|CRT matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcaccg	Protospacer
.****** ****** ***********

25. spacer 1.31|10332|26|NZ_LNVJ01000023|CRT matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcaccg	Protospacer
.****** ****** ***********

26. spacer 1.34|10476|26|NZ_LNVJ01000023|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cgcgcgcgagggcagcggcgtcacct	Protospacer
*******.*********.******* 

27. spacer 1.38|10668|26|NZ_LNVJ01000023|CRT matches to NZ_CP048816 (Caulobacter rhizosphaerae strain KCTC 52515 plasmid unnamed) position: , mismatch: 3, identity: 0.885

cgcg-ggcgcggacagcaccttgatcg	CRISPR spacer
-gcgcggcgaggacagcaccttgatct	Protospacer
 *** **** **************** 

28. spacer 1.40|10764|26|NZ_LNVJ01000023|CRT matches to NC_009427 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence) position: , mismatch: 3, identity: 0.885

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
tgcacgcgaaggcagcgacgtggccg	Protospacer
.******************** .***

29. spacer 1.40|10764|26|NZ_LNVJ01000023|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 3, identity: 0.885

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cgcgcgcgaaggcagcggcgtcacct	Protospacer
***.*************.******* 

30. spacer 1.40|10764|26|NZ_LNVJ01000023|CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 3, identity: 0.885

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
tgcacgcgaaggcgtcgacgtcaccg	Protospacer
.************. ***********

31. spacer 1.46|11052|26|NZ_LNVJ01000023|CRT matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
ctcgcgccagggcaccgacatgaccg	Protospacer
* ***** ****** ***********

32. spacer 1.49|11196|26|NZ_LNVJ01000023|CRT matches to NC_009427 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence) position: , mismatch: 3, identity: 0.885

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
tgcacgcgaaggcagcgacgtggccg	Protospacer
.******************** .***

33. spacer 1.49|11196|26|NZ_LNVJ01000023|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 3, identity: 0.885

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cgcgcgcgaaggcagcggcgtcacct	Protospacer
***.*************.******* 

34. spacer 1.49|11196|26|NZ_LNVJ01000023|CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 3, identity: 0.885

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
tgcacgcgaaggcgtcgacgtcaccg	Protospacer
.************. ***********

35. spacer 1.53|11388|26|NZ_LNVJ01000023|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.885

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
cgcgggcgcggaccgcaccctgcgcg	Protospacer
************* ********  **

36. spacer 1.55|11484|26|NZ_LNVJ01000023|CRT matches to NZ_CP015203 (Rhodococcus sp. 008 plasmid pR8L1, complete sequence) position: , mismatch: 3, identity: 0.885

ggcacggcagggcagcgacatcaccg	CRISPR spacer
cgcacaacagggcagcgacatcaccg	Protospacer
 ****..*******************

37. spacer 1.55|11484|26|NZ_LNVJ01000023|CRT matches to NZ_CP034156 (Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.885

ggcacggcagggcagcgacatcaccg	CRISPR spacer
cgcgcagcagggcagcgacatcaccg	Protospacer
 **.*.********************

38. spacer 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder matches to MT889372 (Microbacterium phage Avocadoman, complete genome) position: , mismatch: 3, identity: 0.88

gctgatcgcgggcgccgacagcacc	CRISPR spacer
tctgatcgagggcgccgacggcacc	Protospacer
 ******* **********.*****

39. spacer 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder matches to MT639649 (Microbacterium phage Burritobowl, complete genome) position: , mismatch: 3, identity: 0.88

gctgatcgcgggcgccgacagcacc	CRISPR spacer
tctgatcgagggcgccgacggcacc	Protospacer
 ******* **********.*****

40. spacer 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder matches to MN062714 (Microbacterium Phage DirtyBubble, complete genome) position: , mismatch: 3, identity: 0.88

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cctgatcgagggcgccgacggcacc	Protospacer
 ******* **********.*****

41. spacer 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder matches to MT889389 (Microbacterium phage DickRichards, complete genome) position: , mismatch: 3, identity: 0.88

gctgatcgcgggcgccgacagcacc	CRISPR spacer
tctgatcgagggcgccgacggcacc	Protospacer
 ******* **********.*****

42. spacer 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder matches to MT024860 (Microbacterium phage Stromboli, complete genome) position: , mismatch: 3, identity: 0.88

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cctgatcgagggcgccgacggcacc	Protospacer
 ******* **********.*****

43. spacer 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.88

gctgatcgcgggcgccgacagcacc	CRISPR spacer
gatgatcacgggcgccgacagcaac	Protospacer
* *****.*************** *

44. spacer 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 3, identity: 0.88

gctgatcgcgggcgccgacagcacc	CRISPR spacer
gatgatcacgggcgccgacagcaac	Protospacer
* *****.*************** *

45. spacer 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 3, identity: 0.88

gctgatcgcgggcgccgacagcacc	CRISPR spacer
gttgctcgcgggcgccgaaagcacc	Protospacer
*.** ************* ******

46. spacer 3.8|12606|25|NZ_LNVJ01000023|CRISPRCasFinder matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.88

gctgaccgccggcaagaacagcgtg	CRISPR spacer
cctgaacgccggcaagtacagcgtg	Protospacer
 **** ********** ********

47. spacer 3.8|12606|25|NZ_LNVJ01000023|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 3, identity: 0.88

gctgaccgccggcaagaacagcgtg	CRISPR spacer
ggtgaccgccgccaagaacggcgtg	Protospacer
* ********* *******.*****

48. spacer 3.8|12606|25|NZ_LNVJ01000023|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88

gctgaccgccggcaagaacagcgtg	CRISPR spacer
ggtgaccgccgccaagaacggcgtg	Protospacer
* ********* *******.*****

49. spacer 1.3|8988|26|NZ_LNVJ01000023|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.846

tgccgcgggcaggagcacgctcaccg	CRISPR spacer
tgccgcggtcgggagcacgctcacgc	Protospacer
******** *.*************  

50. spacer 1.7|9180|26|NZ_LNVJ01000023|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
cacgcgccagggcagcgacatcagca	Protospacer
*.***** *************** *.

51. spacer 1.7|9180|26|NZ_LNVJ01000023|CRT matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
cctgcgcaagggcagctacaacaccg	Protospacer
* .************* *** *****

52. spacer 1.7|9180|26|NZ_LNVJ01000023|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
catgcgcaagggcagcgacaacgccg	Protospacer
*..***************** *.***

53. spacer 1.7|9180|26|NZ_LNVJ01000023|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
cacgcgccaaggcagcgacatcacca	Protospacer
*.***** *.***************.

54. spacer 1.8|9228|26|NZ_LNVJ01000023|CRT matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.846

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
ggccgggtcggacagcgggtcgagca	Protospacer
***************** **.** *.

55. spacer 1.10|9324|26|NZ_LNVJ01000023|CRT matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcaagggcagcgacgtcaccg	CRISPR spacer
ctcccgccagggcagcgacgtcacca	Protospacer
* * *** *****************.

56. spacer 1.13|9468|26|NZ_LNVJ01000023|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgcggcaaggcagcgatatcaccg	CRISPR spacer
cacgcgccaaggcagcgacatcaccg	Protospacer
 .**** ***********.*******

57. spacer 1.13|9468|26|NZ_LNVJ01000023|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgcggcaaggcagcgatatcaccg	CRISPR spacer
cacgcgccaaggcagcgacatcaccg	Protospacer
 .**** ***********.*******

58. spacer 1.14|9516|26|NZ_LNVJ01000023|CRT matches to NZ_CP013482 (Pandoraea apista strain DSM 16535 plasmid pPA35, complete sequence) position: , mismatch: 4, identity: 0.846

tgccggtgcggacagcacgctgatcg	CRISPR spacer
tgccggcgcggccagcacgctgaggg	Protospacer
******.**** ***********  *

59. spacer 1.15|9564|26|NZ_LNVJ01000023|CRT matches to NZ_CP031960 (Phaeobacter sp. LSS9 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.846

ctcgggcagcgacagctcgctgacag	CRISPR spacer
cccgggcaccgacagctggctgacaa	Protospacer
*.****** ******** *******.

60. spacer 1.15|9564|26|NZ_LNVJ01000023|CRT matches to NZ_CP010602 (Phaeobacter inhibens strain P83 plasmid pP83_c, complete sequence) position: , mismatch: 4, identity: 0.846

ctcgggcagcgacagctcgctgacag	CRISPR spacer
cccgggcaccgacagctggctgacaa	Protospacer
*.****** ******** *******.

61. spacer 1.15|9564|26|NZ_LNVJ01000023|CRT matches to NZ_CP010769 (Phaeobacter piscinae strain P13 plasmid pP13_b, complete sequence) position: , mismatch: 4, identity: 0.846

ctcgggcagcgacagctcgctgacag	CRISPR spacer
cccgggcaccgacagctggctgacaa	Protospacer
*.****** ******** *******.

62. spacer 1.15|9564|26|NZ_LNVJ01000023|CRT matches to NZ_CP010708 (Phaeobacter inhibens strain P66 plasmid pP66_c, complete sequence) position: , mismatch: 4, identity: 0.846

ctcgggcagcgacagctcgctgacag	CRISPR spacer
cccgggcaccgacagctggctgacaa	Protospacer
*.****** ******** *******.

63. spacer 1.15|9564|26|NZ_LNVJ01000023|CRT matches to NZ_CP010737 (Phaeobacter inhibens strain P72 plasmid pP72_b, complete sequence) position: , mismatch: 4, identity: 0.846

ctcgggcagcgacagctcgctgacag	CRISPR spacer
cccgggcaccgacagctggctgacaa	Protospacer
*.****** ******** *******.

64. spacer 1.16|9612|26|NZ_LNVJ01000023|CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacatcactg	CRISPR spacer
caagcgcgagggcagcgacatcaccg	Protospacer
*. ****.****************.*

65. spacer 1.18|9708|26|NZ_LNVJ01000023|CRT matches to NZ_CP036488 (Rahnella aquatilis strain MEM40 plasmid pMEM40-1, complete sequence) position: , mismatch: 4, identity: 0.846

cgctggcagcgaaagttcgctgacgg	CRISPR spacer
cgctgacagcgaaagtgcgctgatgc	Protospacer
*****.********** ******.* 

66. spacer 1.18|9708|26|NZ_LNVJ01000023|CRT matches to NC_017060 (Rahnella aquatilis HX2 plasmid PRA1, complete sequence) position: , mismatch: 4, identity: 0.846

cgctggcagcgaaagttcgctgacgg	CRISPR spacer
cgctgacagcgaaagtgcgctgatgc	Protospacer
*****.********** ******.* 

67. spacer 1.18|9708|26|NZ_LNVJ01000023|CRT matches to NC_015062 (Rahnella sp. Y9602 plasmid pRAHAQ01, complete sequence) position: , mismatch: 4, identity: 0.846

cgctggcagcgaaagttcgctgacgg	CRISPR spacer
cgctgacagcgaaagtgcgctgatgc	Protospacer
*****.********** ******.* 

68. spacer 1.20|9804|26|NZ_LNVJ01000023|CRT matches to MN035618 (Leviviridae sp. isolate H1_Rhizo_Litter_1_scaffold_1030_e_381 hypothetical protein (H1RhizoL11030e381_000001) and RNA-dependent RNA polymerase (H1RhizoL11030e381_000002) genes, complete cds) position: , mismatch: 4, identity: 0.846

ggcgggtcacgacagttcgctgatcg	CRISPR spacer
ggtttgtcacgacagctcgctgatcg	Protospacer
**.  **********.**********

69. spacer 1.23|9948|26|NZ_LNVJ01000023|CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 4, identity: 0.846

cgccggtgccgacagtacgctgatcg	CRISPR spacer
cctcggtgccgatggtacgctgatcg	Protospacer
* .*********..************

70. spacer 1.25|10044|26|NZ_LNVJ01000023|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgacgtcaccg	Protospacer
* . .*********************

71. spacer 1.25|10044|26|NZ_LNVJ01000023|CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgacgtcaccg	Protospacer
* . .*********************

72. spacer 1.25|10044|26|NZ_LNVJ01000023|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgacgtcaccg	Protospacer
* . .*********************

73. spacer 1.25|10044|26|NZ_LNVJ01000023|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cgtccgcgaaggcagcgacgccacca	Protospacer
**. ****************.****.

74. spacer 1.25|10044|26|NZ_LNVJ01000023|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cacgcgcgaaggcaacgacgtcacca	Protospacer
*.*.**********.**********.

75. spacer 1.25|10044|26|NZ_LNVJ01000023|CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cggccaggaaggcagcgacgtcaccg	Protospacer
**  *. *******************

76. spacer 1.25|10044|26|NZ_LNVJ01000023|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgc-gaaggcagcgacgtcaccg	CRISPR spacer
-gttcgtggaaggcagcgacgtcaccg	Protospacer
 *. **. *******************

77. spacer 1.27|10140|26|NZ_LNVJ01000023|CRT matches to NZ_CP033429 (Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.846

ctccggtagcgacagttcgctgacgg	CRISPR spacer
cggcggtcgcgacagttcgcggacgg	Protospacer
*  **** ************ *****

78. spacer 1.28|10188|26|NZ_LNVJ01000023|CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
caagcgcgagggcagcgacatcaccg	Protospacer
*. ****.***********.******

79. spacer 1.28|10188|26|NZ_LNVJ01000023|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cgcgcgcgagggcagcgacgttgcgg	Protospacer
*******.*************..* *

80. spacer 1.28|10188|26|NZ_LNVJ01000023|CRT matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
ctcccgccagggcagcgacgtcacca	Protospacer
* * *** *****************.

81. spacer 1.28|10188|26|NZ_LNVJ01000023|CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cctgcgcaagggcagctacgacaccg	Protospacer
* .************* *** *****

82. spacer 1.29|10236|26|NZ_LNVJ01000023|CRT matches to MT114166 (Microbacterium phage Nike, complete genome) position: , mismatch: 4, identity: 0.846

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.  

83. spacer 1.29|10236|26|NZ_LNVJ01000023|CRT matches to NC_047973 (Microbacterium phage Hyperion, complete genome) position: , mismatch: 4, identity: 0.846

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.  

84. spacer 1.29|10236|26|NZ_LNVJ01000023|CRT matches to MT657333 (Microbacterium phage Casend, complete genome) position: , mismatch: 4, identity: 0.846

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.  

85. spacer 1.29|10236|26|NZ_LNVJ01000023|CRT matches to NC_047975 (Microbacterium phage Squash, complete genome) position: , mismatch: 4, identity: 0.846

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.  

86. spacer 1.30|10284|26|NZ_LNVJ01000023|CRT matches to NZ_CP033429 (Burkholderia gladioli strain Burkholderia gladioli Co14 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.846

ctccggtagcgacagttcgctgacgg	CRISPR spacer
cggcggtcgcgacagttcgcggacgg	Protospacer
*  **** ************ *****

87. spacer 1.31|10332|26|NZ_LNVJ01000023|CRT matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcacca	Protospacer
.****** ****** **********.

88. spacer 1.31|10332|26|NZ_LNVJ01000023|CRT matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcacca	Protospacer
.****** ****** **********.

89. spacer 1.31|10332|26|NZ_LNVJ01000023|CRT matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcacca	Protospacer
.****** ****** **********.

90. spacer 1.31|10332|26|NZ_LNVJ01000023|CRT matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcacca	Protospacer
.****** ****** **********.

91. spacer 1.31|10332|26|NZ_LNVJ01000023|CRT matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcacca	Protospacer
.****** ****** **********.

92. spacer 1.31|10332|26|NZ_LNVJ01000023|CRT matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tgcgcgccagggcatcgatgtcacca	Protospacer
.****** ****** **********.

93. spacer 1.31|10332|26|NZ_LNVJ01000023|CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
ccagcgcaccggcagcgatgtcaccg	Protospacer
*  *****  ****************

94. spacer 1.31|10332|26|NZ_LNVJ01000023|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
caggcgcaagggcatcgatgtctccg	Protospacer
*. *********** ******* ***

95. spacer 1.31|10332|26|NZ_LNVJ01000023|CRT matches to NZ_CP018080 (Sulfitobacter sp. AM1-D1 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
cgcgcgcaagggcagcgatctggacg	Protospacer
******************* * . **

96. spacer 1.32|10380|26|NZ_LNVJ01000023|CRT matches to MT114166 (Microbacterium phage Nike, complete genome) position: , mismatch: 4, identity: 0.846

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.  

97. spacer 1.32|10380|26|NZ_LNVJ01000023|CRT matches to NC_047973 (Microbacterium phage Hyperion, complete genome) position: , mismatch: 4, identity: 0.846

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.  

98. spacer 1.32|10380|26|NZ_LNVJ01000023|CRT matches to MT657333 (Microbacterium phage Casend, complete genome) position: , mismatch: 4, identity: 0.846

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.  

99. spacer 1.32|10380|26|NZ_LNVJ01000023|CRT matches to NC_047975 (Microbacterium phage Squash, complete genome) position: , mismatch: 4, identity: 0.846

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.  

100. spacer 1.34|10476|26|NZ_LNVJ01000023|CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
caagcgcgagggcagcgacatcaccg	Protospacer
*. ****.***********.******

101. spacer 1.34|10476|26|NZ_LNVJ01000023|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cgcgcgcgagggcagcgacgttgcgg	Protospacer
*******.*************..* *

102. spacer 1.34|10476|26|NZ_LNVJ01000023|CRT matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
ctcccgccagggcagcgacgtcacca	Protospacer
* * *** *****************.

103. spacer 1.34|10476|26|NZ_LNVJ01000023|CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cctgcgcaagggcagctacgacaccg	Protospacer
* .************* *** *****

104. spacer 1.35|10524|26|NZ_LNVJ01000023|CRT matches to MT114166 (Microbacterium phage Nike, complete genome) position: , mismatch: 4, identity: 0.846

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.  

105. spacer 1.35|10524|26|NZ_LNVJ01000023|CRT matches to NC_047973 (Microbacterium phage Hyperion, complete genome) position: , mismatch: 4, identity: 0.846

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.  

106. spacer 1.35|10524|26|NZ_LNVJ01000023|CRT matches to MT657333 (Microbacterium phage Casend, complete genome) position: , mismatch: 4, identity: 0.846

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.  

107. spacer 1.35|10524|26|NZ_LNVJ01000023|CRT matches to NC_047975 (Microbacterium phage Squash, complete genome) position: , mismatch: 4, identity: 0.846

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcggacagcacgctgacgc	Protospacer
***** *****************.  

108. spacer 1.36|10572|26|NZ_LNVJ01000023|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.846

ctcgggcagcgacagttcgctgacgg	CRISPR spacer
gccggacagcgacagttcgcggacgg	Protospacer
 .***.************** *****

109. spacer 1.37|10620|26|NZ_LNVJ01000023|CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacattaccg	CRISPR spacer
caagcgcgagggcagcgacatcaccg	Protospacer
*. ****.*************.****

110. spacer 1.37|10620|26|NZ_LNVJ01000023|CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacattaccg	CRISPR spacer
catgcgcaagggcagcgacaatgccg	Protospacer
*..***************** *.***

111. spacer 1.38|10668|26|NZ_LNVJ01000023|CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
ctgggccgcgtacagcaccttgatcg	Protospacer
*  ** **** ***************

112. spacer 1.38|10668|26|NZ_LNVJ01000023|CRT matches to NZ_CP044348 (Escherichia coli strain P225M plasmid pP225M-2, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
cgtgctggcggacagcaccttgatcg	Protospacer
**.*   *******************

113. spacer 1.38|10668|26|NZ_LNVJ01000023|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
ggggcgcgcgaacagcaccttgatcg	Protospacer
 * * *****.***************

114. spacer 1.39|10716|26|NZ_LNVJ01000023|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846

ctccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
* ************* *** ***** 

115. spacer 1.39|10716|26|NZ_LNVJ01000023|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846

ctccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
* ************* *** ***** 

116. spacer 1.39|10716|26|NZ_LNVJ01000023|CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 4, identity: 0.846

ctccggcagcgacagttcgctgaccg	CRISPR spacer
atgcggcggcgacagttcggtgaccg	Protospacer
 * ****.*********** ******

117. spacer 1.40|10764|26|NZ_LNVJ01000023|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgacgtcaccg	Protospacer
* . .*********************

118. spacer 1.40|10764|26|NZ_LNVJ01000023|CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgacgtcaccg	Protospacer
* . .*********************

119. spacer 1.40|10764|26|NZ_LNVJ01000023|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgacgtcaccg	Protospacer
* . .*********************

120. spacer 1.40|10764|26|NZ_LNVJ01000023|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cgtccgcgaaggcagcgacgccacca	Protospacer
**. ****************.****.

121. spacer 1.40|10764|26|NZ_LNVJ01000023|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cacgcgcgaaggcaacgacgtcacca	Protospacer
*.*.**********.**********.

122. spacer 1.40|10764|26|NZ_LNVJ01000023|CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cggccaggaaggcagcgacgtcaccg	Protospacer
**  *. *******************

123. spacer 1.40|10764|26|NZ_LNVJ01000023|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgc-gaaggcagcgacgtcaccg	CRISPR spacer
-gttcgtggaaggcagcgacgtcaccg	Protospacer
 *. **. *******************

124. spacer 1.41|10812|26|NZ_LNVJ01000023|CRT matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgggcgcggacagcaccctgatct	CRISPR spacer
gtcggcggcggacagcaccctgatcc	Protospacer
* ***  ******************.

125. spacer 1.41|10812|26|NZ_LNVJ01000023|CRT matches to NZ_CP012918 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgggcgcggacagcaccctgatct	CRISPR spacer
gtcggcggcggacagcaccctgatcc	Protospacer
* ***  ******************.

126. spacer 1.42|10860|26|NZ_LNVJ01000023|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846

ggccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
 ************** *** ***** 

127. spacer 1.42|10860|26|NZ_LNVJ01000023|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846

ggccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
 ************** *** ***** 

128. spacer 1.42|10860|26|NZ_LNVJ01000023|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.846

ggccggcagcgacagttcgctgaccg	CRISPR spacer
ggccagcagcgacatttcgctgaagg	Protospacer
****.********* ********  *

129. spacer 1.43|10908|26|NZ_LNVJ01000023|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 4, identity: 0.846

tgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cgcgcgcgagggcagcggcgtcacct	Protospacer
.******.*********.******* 

130. spacer 1.44|10956|26|NZ_LNVJ01000023|CRT matches to NZ_CP044348 (Escherichia coli strain P225M plasmid pP225M-2, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgggtgcggacagcaccttgatcg	CRISPR spacer
cgtgctggcggacagcaccttgatcg	Protospacer
**.*   *******************

131. spacer 1.45|11004|26|NZ_LNVJ01000023|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846

ctccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
* ************* *** ***** 

132. spacer 1.45|11004|26|NZ_LNVJ01000023|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846

ctccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
* ************* *** ***** 

133. spacer 1.45|11004|26|NZ_LNVJ01000023|CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 4, identity: 0.846

ctccggcagcgacagttcgctgaccg	CRISPR spacer
atgcggcggcgacagttcggtgaccg	Protospacer
 * ****.*********** ******

134. spacer 1.46|11052|26|NZ_LNVJ01000023|CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
gtcgcgcaagggcagcgacacggccg	Protospacer
  ******************.*.***

135. spacer 1.46|11052|26|NZ_LNVJ01000023|CRT matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
cgcgcgcaagggcatcgacatgttca	Protospacer
************** ******* .*.

136. spacer 1.46|11052|26|NZ_LNVJ01000023|CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
caagcgcgagggcagcgacatcaccg	Protospacer
*. ****.************* ****

137. spacer 1.46|11052|26|NZ_LNVJ01000023|CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
cgcgcgcaagggcagcgccacgatcc	Protospacer
***************** **.**.* 

138. spacer 1.46|11052|26|NZ_LNVJ01000023|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
cgcgcgcaagggcagcgccacgatcc	Protospacer
***************** **.**.* 

139. spacer 1.47|11100|26|NZ_LNVJ01000023|CRT matches to NZ_CP045406 (Roseovarius sp. THAF9 plasmid pTHAF9_b, complete sequence) position: , mismatch: 4, identity: 0.846

cgctggcgcggatagcaccttgatcg	CRISPR spacer
cgctggcgcggttatcaccttgatgc	Protospacer
*********** ** *********  

140. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 4, identity: 0.846

gtccggcagcgacagctcgctgacgg	CRISPR spacer
ttccggccgcgacagctcgccgacga	Protospacer
 ****** ************.****.

141. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.846

gtccggcagcgacagctcgctgacgg	CRISPR spacer
ttccggccgcgacagctcgccgacga	Protospacer
 ****** ************.****.

142. spacer 1.49|11196|26|NZ_LNVJ01000023|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgacgtcaccg	Protospacer
* . .*********************

143. spacer 1.49|11196|26|NZ_LNVJ01000023|CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgacgtcaccg	Protospacer
* . .*********************

144. spacer 1.49|11196|26|NZ_LNVJ01000023|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgacgtcaccg	Protospacer
* . .*********************

145. spacer 1.49|11196|26|NZ_LNVJ01000023|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cgtccgcgaaggcagcgacgccacca	Protospacer
**. ****************.****.

146. spacer 1.49|11196|26|NZ_LNVJ01000023|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cacgcgcgaaggcaacgacgtcacca	Protospacer
*.*.**********.**********.

147. spacer 1.49|11196|26|NZ_LNVJ01000023|CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cggccaggaaggcagcgacgtcaccg	Protospacer
**  *. *******************

148. spacer 1.49|11196|26|NZ_LNVJ01000023|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 4, identity: 0.846

cgcacgc-gaaggcagcgacgtcaccg	CRISPR spacer
-gttcgtggaaggcagcgacgtcaccg	Protospacer
 *. **. *******************

149. spacer 1.50|11244|26|NZ_LNVJ01000023|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
cgcgggcgcggaccgcaccctgcgcg	Protospacer
 ************ ********  **

150. spacer 1.50|11244|26|NZ_LNVJ01000023|CRT matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
gtcggcggcggacagcaccctgatcc	Protospacer
* ***  ****************** 

151. spacer 1.50|11244|26|NZ_LNVJ01000023|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
*..********.***** ********

152. spacer 1.50|11244|26|NZ_LNVJ01000023|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
*..********.***** ********

153. spacer 1.50|11244|26|NZ_LNVJ01000023|CRT matches to NZ_CP015232 (Epibacterium mobile F1926 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
tgagggcgccgacatcaccctgatcg	Protospacer
 * ****** **** ***********

154. spacer 1.50|11244|26|NZ_LNVJ01000023|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
*..********.***** ********

155. spacer 1.50|11244|26|NZ_LNVJ01000023|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
*..********.***** ********

156. spacer 1.50|11244|26|NZ_LNVJ01000023|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
*..********.***** ********

157. spacer 1.50|11244|26|NZ_LNVJ01000023|CRT matches to NZ_CP012918 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
gtcggcggcggacagcaccctgatcc	Protospacer
* ***  ****************** 

158. spacer 1.50|11244|26|NZ_LNVJ01000023|CRT matches to NZ_LR027555 (Epibacterium mobile isolate EPIB1 plasmid 3, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
cgagggcgccgacatcaccctgatcg	Protospacer
 * ****** **** ***********

159. spacer 1.51|11292|26|NZ_LNVJ01000023|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846

ggccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
 ************** *** ***** 

160. spacer 1.51|11292|26|NZ_LNVJ01000023|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846

ggccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
 ************** *** ***** 

161. spacer 1.51|11292|26|NZ_LNVJ01000023|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.846

ggccggcagcgacagttcgctgaccg	CRISPR spacer
ggccagcagcgacatttcgctgaagg	Protospacer
****.********* ********  *

162. spacer 1.53|11388|26|NZ_LNVJ01000023|CRT matches to NZ_CP015232 (Epibacterium mobile F1926 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.846

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
tgagggcgccgacatcaccctgatcg	Protospacer
.* ****** **** ***********

163. spacer 1.54|11436|26|NZ_LNVJ01000023|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846

ggccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
 ************** *** ***** 

164. spacer 1.54|11436|26|NZ_LNVJ01000023|CRT matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 4, identity: 0.846

ggccggcagcgacagttcgctgaccg	CRISPR spacer
cgccggcagcgacaggtcgatgacct	Protospacer
 ************** *** ***** 

165. spacer 1.54|11436|26|NZ_LNVJ01000023|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.846

ggccggcagcgacagttcgctgaccg	CRISPR spacer
ggccagcagcgacatttcgctgaagg	Protospacer
****.********* ********  *

166. spacer 1.55|11484|26|NZ_LNVJ01000023|CRT matches to NZ_CP014942 (Rhodococcus sp. BH4 plasmid, complete sequence) position: , mismatch: 4, identity: 0.846

ggcacggcagggcagcgacatcaccg	CRISPR spacer
cgcgcaacagggcagcgacatcaccg	Protospacer
 **.*..*******************

167. spacer 1.55|11484|26|NZ_LNVJ01000023|CRT matches to NZ_CP007256 (Rhodococcus erythropolis R138 plasmid pCRE138, complete sequence) position: , mismatch: 4, identity: 0.846

ggcacggcagggcagcgacatcaccg	CRISPR spacer
cgcgcaacagggcagcgacatcaccg	Protospacer
 **.*..*******************

168. spacer 1.55|11484|26|NZ_LNVJ01000023|CRT matches to NZ_CP017242 (Rhizobium etli 8C-3 plasmid pRsp8C3a, complete sequence) position: , mismatch: 4, identity: 0.846

ggcacggcagggcagcgacatcaccg	CRISPR spacer
gcaacggctgggcagcgacaacaccg	Protospacer
*  ***** *********** *****

169. spacer 1.57|11580|26|NZ_LNVJ01000023|CRT matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 4, identity: 0.846

cgccggctacgacagcaacctcactg	CRISPR spacer
cgccgcctacgacagcaacctcatca	Protospacer
***** *****************...

170. spacer 1.57|11580|26|NZ_LNVJ01000023|CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 4, identity: 0.846

cgccggctacgacagcaacctcactg	CRISPR spacer
cgccgactacgacagcgacctcacca	Protospacer
*****.**********.*******..

171. spacer 1.58|11628|26|NZ_LNVJ01000023|CRT matches to NZ_CP023738 (Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence) position: , mismatch: 4, identity: 0.846

ggcgcgcgaggacagctcgctcactg	CRISPR spacer
cgtgcgcgaggacagcgcgctcaccg	Protospacer
 *.************* *******.*

172. spacer 3.3|12366|25|NZ_LNVJ01000023|CRISPRCasFinder matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 4, identity: 0.84

gctgatcgcgggcaagggcagtttc	CRISPR spacer
gctgatggcgggcaagggcagtcag	Protospacer
****** ***************.  

173. spacer 3.4|12414|25|NZ_LNVJ01000023|CRISPRCasFinder matches to MK757446 (Mycobacterium phage Candle, complete genome) position: , mismatch: 4, identity: 0.84

gctcattggcggtgccgccagcgtg	CRISPR spacer
gcacattggcggtgcccccagcggc	Protospacer
** ************* ******  

174. spacer 3.4|12414|25|NZ_LNVJ01000023|CRISPRCasFinder matches to KY969628 (Mycobacterium phage Zenon, complete genome) position: , mismatch: 4, identity: 0.84

gctcattggcggtgccgccagcgtg	CRISPR spacer
gcacattggcggtgcccccagcggc	Protospacer
** ************* ******  

175. spacer 3.4|12414|25|NZ_LNVJ01000023|CRISPRCasFinder matches to MH926059 (Mycobacterium phage Riparian, complete genome) position: , mismatch: 4, identity: 0.84

gctcattggcggtgccgccagcgtg	CRISPR spacer
gcacattggcggtgcccccagcggc	Protospacer
** ************* ******  

176. spacer 3.4|12414|25|NZ_LNVJ01000023|CRISPRCasFinder matches to JF704112 (Mycobacterium phage Send513, complete sequence) position: , mismatch: 4, identity: 0.84

gctcattggcggtgccgccagcgtg	CRISPR spacer
gcacattggcggtgcccccagcggc	Protospacer
** ************* ******  

177. spacer 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.84

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cgtgatcgcggtcgccgacagcagc	Protospacer
  ********* *********** *

178. spacer 3.6|12510|25|NZ_LNVJ01000023|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 4, identity: 0.84

actgttggccggacgcaacagctat	CRISPR spacer
ggtgttgcgcggacgcaacagctat	Protospacer
. *****  ****************

179. spacer 3.6|12510|25|NZ_LNVJ01000023|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 4, identity: 0.84

actgttggccggacgcaacagctat	CRISPR spacer
ggtgttgcgcggacgcaacagctat	Protospacer
. *****  ****************

180. spacer 3.7|12558|25|NZ_LNVJ01000023|CRISPRCasFinder matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 4, identity: 0.84

gctgaccgccggcgacgacagtacg	CRISPR spacer
gctgcccgccggcgacgaccgtaaa	Protospacer
**** ************** *** .

181. spacer 3.8|12606|25|NZ_LNVJ01000023|CRISPRCasFinder matches to NZ_CP045549 (Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84

gctgaccgccggcaagaacagcgtg	CRISPR spacer
gctgaccgcgggcaagaacatcgaa	Protospacer
********* ********** ** .

182. spacer 1.1|8892|26|NZ_LNVJ01000023|CRT matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 5, identity: 0.808

cgcaggcgatcacagcgatctgatcg	CRISPR spacer
cgcaggcgatcacaacgatctggcga	Protospacer
**************.*******.. .

183. spacer 1.3|8988|26|NZ_LNVJ01000023|CRT matches to NZ_CP047178 (Rathayibacter sp. VKM Ac-2759 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.808

tgccgcgggcaggagcacgctcaccg	CRISPR spacer
ttccgcggacaggagcacgctcatgt	Protospacer
* ******.**************.  

184. spacer 1.4|9036|26|NZ_LNVJ01000023|CRT matches to NZ_CP027551 (Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

ggcgcaggaaggcagccgtctcacct	CRISPR spacer
agcgcaggaaggccgccgtctcttca	Protospacer
.************ ******** .* 

185. spacer 1.4|9036|26|NZ_LNVJ01000023|CRT matches to NZ_CP027551 (Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

ggcgcaggaaggcagccgtctcacct	CRISPR spacer
agcgcaggaaggccgccgtctcttca	Protospacer
.************ ******** .* 

186. spacer 1.4|9036|26|NZ_LNVJ01000023|CRT matches to NZ_CP027551 (Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

ggcgcaggaaggcagccgtctcacct	CRISPR spacer
agcgcaggaaggccgccgtctcttca	Protospacer
.************ ******** .* 

187. spacer 1.4|9036|26|NZ_LNVJ01000023|CRT matches to NZ_CP027551 (Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

ggcgcaggaaggcagccgtctcacct	CRISPR spacer
agcgcaggaaggccgccgtctcttca	Protospacer
.************ ******** .* 

188. spacer 1.4|9036|26|NZ_LNVJ01000023|CRT matches to NZ_CP027551 (Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

ggcgcaggaaggcagccgtctcacct	CRISPR spacer
agcgcaggaaggccgccgtctcttca	Protospacer
.************ ******** .* 

189. spacer 1.5|9084|26|NZ_LNVJ01000023|CRT matches to NC_015057 (Granulicella tundricola MP5ACTX9 plasmid pACIX901, complete sequence) position: , mismatch: 5, identity: 0.808

cagcggttctgacagcgcggtgatct	CRISPR spacer
cagcggttctgacagctccgtgactc	Protospacer
**************** * ****...

190. spacer 1.7|9180|26|NZ_LNVJ01000023|CRT matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
cgcgcgcaagggcatcgacatgttca	Protospacer
************** ******  .*.

191. spacer 1.7|9180|26|NZ_LNVJ01000023|CRT matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacatcaccg	CRISPR spacer
ttggcgcaaggacagcggcatcaccg	Protospacer
.  ********.*****.********

192. spacer 1.8|9228|26|NZ_LNVJ01000023|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 5, identity: 0.808

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
ggccgggtcggccagcgcggtgagga	Protospacer
*********** ******* ***  .

193. spacer 1.8|9228|26|NZ_LNVJ01000023|CRT matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 5, identity: 0.808

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
cgccgggtcggacagcgcgtgcagcc	Protospacer
 *******************  * * 

194. spacer 1.8|9228|26|NZ_LNVJ01000023|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 5, identity: 0.808

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
ggccgggtcggccagcgcggtgagga	Protospacer
*********** ******* ***  .

195. spacer 1.8|9228|26|NZ_LNVJ01000023|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 5, identity: 0.808

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
ggccgggtcggccagcgcggtgagga	Protospacer
*********** ******* ***  .

196. spacer 1.8|9228|26|NZ_LNVJ01000023|CRT matches to MF375456 (Xanthomonas phage phi Xc10, complete genome) position: , mismatch: 5, identity: 0.808

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
caccggatcggacagcacgttgatct	Protospacer
 .****.*********.******** 

197. spacer 1.8|9228|26|NZ_LNVJ01000023|CRT matches to NC_030937 (Xanthomonas phage f30-Xaj, complete genome) position: , mismatch: 5, identity: 0.808

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
caccggatcggacagcacgttgatct	Protospacer
 .****.*********.******** 

198. spacer 1.8|9228|26|NZ_LNVJ01000023|CRT matches to MK903278 (Xanthomonas phage Pagan, complete genome) position: , mismatch: 5, identity: 0.808

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
caccggatcggacagcacgttgatct	Protospacer
 .****.*********.******** 

199. spacer 1.8|9228|26|NZ_LNVJ01000023|CRT matches to NC_030928 (Xanthomonas phage f20-Xaj, complete genome) position: , mismatch: 5, identity: 0.808

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
caccggatcggacagcacgttgatct	Protospacer
 .****.*********.******** 

200. spacer 1.10|9324|26|NZ_LNVJ01000023|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcaagggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .**.******************

201. spacer 1.10|9324|26|NZ_LNVJ01000023|CRT matches to NZ_CP049116 (Pantoea stewartii strain ZJ-FGZX1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcaagggcagcgacgtcaccg	CRISPR spacer
tcgacgcaacggcagcgacgttaccg	Protospacer
.  ****** ***********.****

202. spacer 1.10|9324|26|NZ_LNVJ01000023|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcaagggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .**.******************

203. spacer 1.12|9420|26|NZ_LNVJ01000023|CRT matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 5, identity: 0.808

cgctggcggcgaaagctctctcaccg	CRISPR spacer
cgctggcggcggaagctttctcaata	Protospacer
***********.*****.***** ..

204. spacer 1.12|9420|26|NZ_LNVJ01000023|CRT matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgctggcggcgaaagctctctcaccg	CRISPR spacer
cgctggcggcggaagctttctcaata	Protospacer
***********.*****.***** ..

205. spacer 1.13|9468|26|NZ_LNVJ01000023|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 5, identity: 0.808

ggcgcggcaaggcagcgatatcaccg	CRISPR spacer
cacgcgccaaggcagcgacatcacca	Protospacer
 .**** ***********.******.

206. spacer 1.15|9564|26|NZ_LNVJ01000023|CRT matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 5, identity: 0.808

ctcgggcagcgacagctcgctgacag	CRISPR spacer
ctcggacagcgacagctcgctttgcg	Protospacer
*****.***************    *

207. spacer 1.15|9564|26|NZ_LNVJ01000023|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

ctcgggcagcgacagctcgctgacag	CRISPR spacer
tacggtcagcgacacctcgctgacat	Protospacer
. *** ******** ********** 

208. spacer 1.16|9612|26|NZ_LNVJ01000023|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacatcactg	CRISPR spacer
cacgcgccagggcagcgacatcagca	Protospacer
*.***** *************** ..

209. spacer 1.23|9948|26|NZ_LNVJ01000023|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.808

cgccggtgccgacagtacgctgatcg	CRISPR spacer
gttcggtgccgacaggacgccgatcg	Protospacer
  .************ ****.*****

210. spacer 1.25|10044|26|NZ_LNVJ01000023|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
attctgcgaaggcagcgacgtcaccg	Protospacer
  . .*********************

211. spacer 1.25|10044|26|NZ_LNVJ01000023|CRT matches to NC_008308 (Sphingomonas sp. KA1 plasmid pCAR3 DNA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
catgcgcgaaggcagcgacgttacca	Protospacer
*...*****************.***.

212. spacer 1.25|10044|26|NZ_LNVJ01000023|CRT matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

213. spacer 1.25|10044|26|NZ_LNVJ01000023|CRT matches to NC_015597 (Sinorhizobium meliloti AK83 plasmid pSINME01, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

214. spacer 1.25|10044|26|NZ_LNVJ01000023|CRT matches to NZ_CP018064 (Rhodococcus sp. 2G plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
acgacgcgcaggccgcgacgtcaccg	Protospacer
   ***** **** ************

215. spacer 1.25|10044|26|NZ_LNVJ01000023|CRT matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

216. spacer 1.25|10044|26|NZ_LNVJ01000023|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .****.****************

217. spacer 1.25|10044|26|NZ_LNVJ01000023|CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttcggcgaaggcagcgaagtcaccg	Protospacer
* .  ************* *******

218. spacer 1.25|10044|26|NZ_LNVJ01000023|CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

219. spacer 1.25|10044|26|NZ_LNVJ01000023|CRT matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

220. spacer 1.25|10044|26|NZ_LNVJ01000023|CRT matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

221. spacer 1.25|10044|26|NZ_LNVJ01000023|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttcggcgaaggcagcgaagtcaccg	Protospacer
* .  ************* *******

222. spacer 1.25|10044|26|NZ_LNVJ01000023|CRT matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

223. spacer 1.25|10044|26|NZ_LNVJ01000023|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .****.****************

224. spacer 1.25|10044|26|NZ_LNVJ01000023|CRT matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

225. spacer 1.25|10044|26|NZ_LNVJ01000023|CRT matches to NZ_CP024891 (Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
acgacgcgcaggccgcgacgtcaccg	Protospacer
   ***** **** ************

226. spacer 1.28|10188|26|NZ_LNVJ01000023|CRT matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
aaggcgcaaggggagcgaggtcaccg	Protospacer
 . ********* ***** *******

227. spacer 1.28|10188|26|NZ_LNVJ01000023|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .**.******************

228. spacer 1.28|10188|26|NZ_LNVJ01000023|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .**.******************

229. spacer 1.28|10188|26|NZ_LNVJ01000023|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
atggcgcaagggcagcgacgacaacg	Protospacer
   ***************** ** **

230. spacer 1.29|10236|26|NZ_LNVJ01000023|CRT matches to MN183284 (Microbacterium phage Mashley, complete genome) position: , mismatch: 5, identity: 0.808

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcgggcagcacgctgacgc	Protospacer
***** *****.***********.  

231. spacer 1.31|10332|26|NZ_LNVJ01000023|CRT matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
aaggcgcaaggggagcgaggtcaccg	Protospacer
 . ********* ***** *******

232. spacer 1.31|10332|26|NZ_LNVJ01000023|CRT matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgatgtcaccg	CRISPR spacer
tacgcgccagggcatcgatgtcacca	Protospacer
..***** ****** **********.

233. spacer 1.32|10380|26|NZ_LNVJ01000023|CRT matches to MN183284 (Microbacterium phage Mashley, complete genome) position: , mismatch: 5, identity: 0.808

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcgggcagcacgctgacgc	Protospacer
***** *****.***********.  

234. spacer 1.34|10476|26|NZ_LNVJ01000023|CRT matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
aaggcgcaaggggagcgaggtcaccg	Protospacer
 . ********* ***** *******

235. spacer 1.34|10476|26|NZ_LNVJ01000023|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .**.******************

236. spacer 1.34|10476|26|NZ_LNVJ01000023|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .**.******************

237. spacer 1.34|10476|26|NZ_LNVJ01000023|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
atggcgcaagggcagcgacgacaacg	Protospacer
   ***************** ** **

238. spacer 1.35|10524|26|NZ_LNVJ01000023|CRT matches to MN183284 (Microbacterium phage Mashley, complete genome) position: , mismatch: 5, identity: 0.808

ggcgggtgcggacagcacgctgatcg	CRISPR spacer
ggcggctgcgggcagcacgctgacgc	Protospacer
***** *****.***********.  

239. spacer 1.37|10620|26|NZ_LNVJ01000023|CRT matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacattaccg	CRISPR spacer
cgcgcgcaagggcatcgacatgttca	Protospacer
************** ******  .*.

240. spacer 1.38|10668|26|NZ_LNVJ01000023|CRT matches to NZ_CP019315 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-3, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
gcggggggcgggcagcaccttgatcg	Protospacer
   *** ****.**************

241. spacer 1.39|10716|26|NZ_LNVJ01000023|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 5, identity: 0.808

ctccggcagcgacagttcgctgaccg	CRISPR spacer
ctccggcagcgacagttcggattcgg	Protospacer
*******************    * *

242. spacer 1.39|10716|26|NZ_LNVJ01000023|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 5, identity: 0.808

ctccggcagcgacagttcgctgaccg	CRISPR spacer
ctccggcagcgacagttcggattcgg	Protospacer
*******************    * *

243. spacer 1.40|10764|26|NZ_LNVJ01000023|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
attctgcgaaggcagcgacgtcaccg	Protospacer
  . .*********************

244. spacer 1.40|10764|26|NZ_LNVJ01000023|CRT matches to NC_008308 (Sphingomonas sp. KA1 plasmid pCAR3 DNA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
catgcgcgaaggcagcgacgttacca	Protospacer
*...*****************.***.

245. spacer 1.40|10764|26|NZ_LNVJ01000023|CRT matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

246. spacer 1.40|10764|26|NZ_LNVJ01000023|CRT matches to NC_015597 (Sinorhizobium meliloti AK83 plasmid pSINME01, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

247. spacer 1.40|10764|26|NZ_LNVJ01000023|CRT matches to NZ_CP018064 (Rhodococcus sp. 2G plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
acgacgcgcaggccgcgacgtcaccg	Protospacer
   ***** **** ************

248. spacer 1.40|10764|26|NZ_LNVJ01000023|CRT matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

249. spacer 1.40|10764|26|NZ_LNVJ01000023|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .****.****************

250. spacer 1.40|10764|26|NZ_LNVJ01000023|CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttcggcgaaggcagcgaagtcaccg	Protospacer
* .  ************* *******

251. spacer 1.40|10764|26|NZ_LNVJ01000023|CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

252. spacer 1.40|10764|26|NZ_LNVJ01000023|CRT matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

253. spacer 1.40|10764|26|NZ_LNVJ01000023|CRT matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

254. spacer 1.40|10764|26|NZ_LNVJ01000023|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttcggcgaaggcagcgaagtcaccg	Protospacer
* .  ************* *******

255. spacer 1.40|10764|26|NZ_LNVJ01000023|CRT matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

256. spacer 1.40|10764|26|NZ_LNVJ01000023|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .****.****************

257. spacer 1.40|10764|26|NZ_LNVJ01000023|CRT matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

258. spacer 1.40|10764|26|NZ_LNVJ01000023|CRT matches to NZ_CP024891 (Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
acgacgcgcaggccgcgacgtcaccg	Protospacer
   ***** **** ************

259. spacer 1.41|10812|26|NZ_LNVJ01000023|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.808

ggcgggcgcggacagcaccctgatct	CRISPR spacer
cgcgggcgcggaccgcaccctgcgcg	Protospacer
 ************ ********  * 

260. spacer 1.42|10860|26|NZ_LNVJ01000023|CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 5, identity: 0.808

ggccggcagcgacagttcgctgaccg	CRISPR spacer
atgcggcggcgacagttcggtgaccg	Protospacer
.  ****.*********** ******

261. spacer 1.43|10908|26|NZ_LNVJ01000023|CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 5, identity: 0.808

tgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
caagcgcgagggcagcgacatcaccg	Protospacer
.. ****.***********.******

262. spacer 1.43|10908|26|NZ_LNVJ01000023|CRT matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 5, identity: 0.808

tgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
ctcccgccagggcagcgacgtcacca	Protospacer
. * *** *****************.

263. spacer 1.43|10908|26|NZ_LNVJ01000023|CRT matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

tgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
aaggcgcaaggggagcgaggtcaccg	Protospacer
 . ********* ***** *******

264. spacer 1.43|10908|26|NZ_LNVJ01000023|CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 5, identity: 0.808

tgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cctgcgcaagggcagctacgacaccg	Protospacer
. .************* *** *****

265. spacer 1.43|10908|26|NZ_LNVJ01000023|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

tgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
atggcgcaagggcagcgacgacaacg	Protospacer
   ***************** ** **

266. spacer 1.44|10956|26|NZ_LNVJ01000023|CRT matches to NZ_CP035502 (Sphingosinicella sp. BN140058 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgggtgcggacagcaccttgatcg	CRISPR spacer
tttggctgcggacagccccttgatcg	Protospacer
. .** ********** *********

267. spacer 1.44|10956|26|NZ_LNVJ01000023|CRT matches to NZ_CP019315 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-3, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgggtgcggacagcaccttgatcg	CRISPR spacer
gcggggggcgggcagcaccttgatcg	Protospacer
   *** ****.**************

268. spacer 1.44|10956|26|NZ_LNVJ01000023|CRT matches to MT498057 (Microbacterium phage Cicada, complete genome) position: , mismatch: 5, identity: 0.808

cgcgggtgcggacagcaccttgatcg	CRISPR spacer
ggcgggtgcggaaagcacctcgatgt	Protospacer
 *********** *******.***  

269. spacer 1.45|11004|26|NZ_LNVJ01000023|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 5, identity: 0.808

ctccggcagcgacagttcgctgaccg	CRISPR spacer
ctccggcagcgacagttcggattcgg	Protospacer
*******************    * *

270. spacer 1.45|11004|26|NZ_LNVJ01000023|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 5, identity: 0.808

ctccggcagcgacagttcgctgaccg	CRISPR spacer
ctccggcagcgacagttcggattcgg	Protospacer
*******************    * *

271. spacer 1.46|11052|26|NZ_LNVJ01000023|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
gaagcgcacgggcagcgacatgagcg	Protospacer
 . ***** ************** **

272. spacer 1.46|11052|26|NZ_LNVJ01000023|CRT matches to NZ_MN433457 (Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
tcggcgcaagggcagcgacaagcccg	Protospacer
.  ***************** * ***

273. spacer 1.46|11052|26|NZ_LNVJ01000023|CRT matches to NZ_CP022416 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
tgcgcgcaagggcatcgacatgttca	Protospacer
.************* ******* .*.

274. spacer 1.46|11052|26|NZ_LNVJ01000023|CRT matches to MN583270 (Pseudomonas aeruginosa strain NK546 plasmid pNK546b, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
tcggcgcaagggcagcgacaagcccg	Protospacer
.  ***************** * ***

275. spacer 1.46|11052|26|NZ_LNVJ01000023|CRT matches to NZ_CP014598 (Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
tgcgcgcaagggcatcgacatgttca	Protospacer
.************* ******* .*.

276. spacer 1.46|11052|26|NZ_LNVJ01000023|CRT matches to MK376351 (Pseudomonas sp. strain ANT_H62 plasmid pA62H2, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgcgcaagggcagcgacatgaccg	CRISPR spacer
tcggcgcaagggcagcgacaagcccg	Protospacer
.  ***************** * ***

277. spacer 1.47|11100|26|NZ_LNVJ01000023|CRT matches to NZ_CP013856 (Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence) position: , mismatch: 5, identity: 0.808

cgctggcgcggatagcaccttgatcg	CRISPR spacer
cgctggcgcggatagcaccgggcctg	Protospacer
*******************  * ..*

278. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

279. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

280. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

281. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

282. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

283. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

284. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

285. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

286. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP021043 (Phaeobacter gallaeciensis strain P129 plasmid pP129_c, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
ccccggcaccgacagctggctgacga	Protospacer
 .****** ******** *******.

287. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

288. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

289. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP010676 (Phaeobacter gallaeciensis strain P75 plasmid pP75_c, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
ccccggcaccgacagctggctgacga	Protospacer
 .****** ******** *******.

290. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

291. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NC_023139 (Phaeobacter gallaeciensis DSM 26640 plasmid pGal_C110, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
ccccggcaccgacagctggctgacga	Protospacer
 .****** ******** *******.

292. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

293. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

294. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

295. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

296. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

297. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

298. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

299. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

300. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

301. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

302. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

303. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

304. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

305. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

306. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

307. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

308. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

309. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

310. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

311. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

312. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

313. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

314. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

315. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

316. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
atccggcagcgacggctcggtgacca	Protospacer
.************.***** **** .

317. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

318. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

319. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

320. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

321. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

322. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

323. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

324. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

325. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

326. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

327. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

328. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

329. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

330. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

331. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

332. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

333. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

334. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

335. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

336. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

337. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

338. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

339. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

340. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

341. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

342. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

343. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

344. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

345. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

346. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

347. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

348. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

349. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

350. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

351. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

352. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

353. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP010591 (Phaeobacter gallaeciensis strain P11 plasmid pP11_c, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
ccccggcaccgacagctggctgacga	Protospacer
 .****** ******** *******.

354. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caccggcagcgacagcgcgctcacgc	Protospacer
  ************** **** *** 

355. spacer 1.49|11196|26|NZ_LNVJ01000023|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
attctgcgaaggcagcgacgtcaccg	Protospacer
  . .*********************

356. spacer 1.49|11196|26|NZ_LNVJ01000023|CRT matches to NC_008308 (Sphingomonas sp. KA1 plasmid pCAR3 DNA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
catgcgcgaaggcagcgacgttacca	Protospacer
*...*****************.***.

357. spacer 1.49|11196|26|NZ_LNVJ01000023|CRT matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

358. spacer 1.49|11196|26|NZ_LNVJ01000023|CRT matches to NC_015597 (Sinorhizobium meliloti AK83 plasmid pSINME01, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

359. spacer 1.49|11196|26|NZ_LNVJ01000023|CRT matches to NZ_CP018064 (Rhodococcus sp. 2G plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
acgacgcgcaggccgcgacgtcaccg	Protospacer
   ***** **** ************

360. spacer 1.49|11196|26|NZ_LNVJ01000023|CRT matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

361. spacer 1.49|11196|26|NZ_LNVJ01000023|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .****.****************

362. spacer 1.49|11196|26|NZ_LNVJ01000023|CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttcggcgaaggcagcgaagtcaccg	Protospacer
* .  ************* *******

363. spacer 1.49|11196|26|NZ_LNVJ01000023|CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

364. spacer 1.49|11196|26|NZ_LNVJ01000023|CRT matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

365. spacer 1.49|11196|26|NZ_LNVJ01000023|CRT matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

366. spacer 1.49|11196|26|NZ_LNVJ01000023|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttcggcgaaggcagcgaagtcaccg	Protospacer
* .  ************* *******

367. spacer 1.49|11196|26|NZ_LNVJ01000023|CRT matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

368. spacer 1.49|11196|26|NZ_LNVJ01000023|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
* . .****.****************

369. spacer 1.49|11196|26|NZ_LNVJ01000023|CRT matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
cttctgcgaaggcagcgaagtcaccg	Protospacer
* . .************* *******

370. spacer 1.49|11196|26|NZ_LNVJ01000023|CRT matches to NZ_CP024891 (Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence) position: , mismatch: 5, identity: 0.808

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
acgacgcgcaggccgcgacgtcaccg	Protospacer
   ***** **** ************

371. spacer 1.50|11244|26|NZ_LNVJ01000023|CRT matches to NZ_CP049029 (Fluviibacterium aquatile strain SC52 plasmid pSC52_1, complete sequence) position: , mismatch: 5, identity: 0.808

ggcgggcgcggacagcaccctgatcg	CRISPR spacer
tctgggcccggacagcaccctgaccg	Protospacer
  .**** ***************.**

372. spacer 1.51|11292|26|NZ_LNVJ01000023|CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 5, identity: 0.808

ggccggcagcgacagttcgctgaccg	CRISPR spacer
atgcggcggcgacagttcggtgaccg	Protospacer
.  ****.*********** ******

373. spacer 1.52|11340|26|NZ_LNVJ01000023|CRT matches to NZ_KX426227 (Acinetobacter lwoffii strain ED23-35 plasmid pALWED1.1, complete sequence) position: , mismatch: 5, identity: 0.808

ggcacggcagggcagcgacgtcaccg	CRISPR spacer
tgcacggctgggcagcgaagtcacga	Protospacer
 ******* ********* ***** .

374. spacer 1.52|11340|26|NZ_LNVJ01000023|CRT matches to CP033569 (Acinetobacter pittii strain 2014N21-145 plasmid p2014N21-145-1, complete sequence) position: , mismatch: 5, identity: 0.808

ggcacggcagggcagcgacgtcaccg	CRISPR spacer
tgcacggctgggcagcgaagtcacga	Protospacer
 ******* ********* ***** .

375. spacer 1.52|11340|26|NZ_LNVJ01000023|CRT matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 5, identity: 0.808

ggcacggcagggcagcgacgtcaccg	CRISPR spacer
ctcccgccagggcagcgacgtcacca	Protospacer
  * ** ******************.

376. spacer 1.52|11340|26|NZ_LNVJ01000023|CRT matches to NZ_CP010351 (Acinetobacter johnsonii XBB1 plasmid pXBB1-9, complete sequence) position: , mismatch: 5, identity: 0.808

ggcacggcagggcagcgacgtcaccg	CRISPR spacer
tgcacggctgggcagcgaagtcacga	Protospacer
 ******* ********* ***** .

377. spacer 1.52|11340|26|NZ_LNVJ01000023|CRT matches to NZ_CP029396 (Acinetobacter defluvii strain WCHA30 plasmid pOXA58_010030, complete sequence) position: , mismatch: 5, identity: 0.808

ggcacggcagggcagcgacgtcaccg	CRISPR spacer
tgcacggctgggcagcgaagtcacga	Protospacer
 ******* ********* ***** .

378. spacer 1.53|11388|26|NZ_LNVJ01000023|CRT matches to NZ_CP049029 (Fluviibacterium aquatile strain SC52 plasmid pSC52_1, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
tctgggcccggacagcaccctgaccg	Protospacer
. .**** ***************.**

379. spacer 1.53|11388|26|NZ_LNVJ01000023|CRT matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
gtcggcggcggacagcaccctgatcc	Protospacer
  ***  ****************** 

380. spacer 1.53|11388|26|NZ_LNVJ01000023|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
 ..********.***** ********

381. spacer 1.53|11388|26|NZ_LNVJ01000023|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
 ..********.***** ********

382. spacer 1.53|11388|26|NZ_LNVJ01000023|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
 ..********.***** ********

383. spacer 1.53|11388|26|NZ_LNVJ01000023|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
 ..********.***** ********

384. spacer 1.53|11388|26|NZ_LNVJ01000023|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
gatgggcgcgggcagcaacctgatcg	Protospacer
 ..********.***** ********

385. spacer 1.53|11388|26|NZ_LNVJ01000023|CRT matches to NZ_CP012918 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence) position: , mismatch: 5, identity: 0.808

cgcgggcgcggacagcaccctgatcg	CRISPR spacer
gtcggcggcggacagcaccctgatcc	Protospacer
  ***  ****************** 

386. spacer 1.54|11436|26|NZ_LNVJ01000023|CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 5, identity: 0.808

ggccggcagcgacagttcgctgaccg	CRISPR spacer
atgcggcggcgacagttcggtgaccg	Protospacer
.  ****.*********** ******

387. spacer 1.55|11484|26|NZ_LNVJ01000023|CRT matches to NZ_CP017782 (Rhodobacter sp. LPB0142 plasmid pEJ01, complete sequence) position: , mismatch: 5, identity: 0.808

ggcacggcagggcagcgacatcaccg	CRISPR spacer
cacggggcagggcagcgacatgaccg	Protospacer
 .*. **************** ****

388. spacer 1.55|11484|26|NZ_LNVJ01000023|CRT matches to NZ_CP017782 (Rhodobacter sp. LPB0142 plasmid pEJ01, complete sequence) position: , mismatch: 5, identity: 0.808

ggcacggcagggcagcgacatcaccg	CRISPR spacer
cacggggcagggcagcgacatgaccg	Protospacer
 .*. **************** ****

389. spacer 1.58|11628|26|NZ_LNVJ01000023|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 5, identity: 0.808

ggcgcgcgaggacagctcgctcactg	CRISPR spacer
ggcgcgcgaggacagcacgctggccc	Protospacer
**************** **** .*. 

390. spacer 1.58|11628|26|NZ_LNVJ01000023|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 5, identity: 0.808

ggcgcgcgaggacagctcgctcactg	CRISPR spacer
ggcgcgcgtggacagctcgcttgcgc	Protospacer
******** ************..*  

391. spacer 3.3|12366|25|NZ_LNVJ01000023|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcaagggcagtttc	CRISPR spacer
ggtgatcgcgggcaagggcagggcg	Protospacer
* *******************  . 

392. spacer 3.3|12366|25|NZ_LNVJ01000023|CRISPRCasFinder matches to NZ_CP021658 (Aeromonas salmonicida strain O23A plasmid pO23AP4, complete sequence) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcaagggcagtttc	CRISPR spacer
gctgatctcgggcaagggcagcacg	Protospacer
******* *************. . 

393. spacer 3.3|12366|25|NZ_LNVJ01000023|CRISPRCasFinder matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcaagggcagtttc	CRISPR spacer
gctgatggcgggcaagggcagccag	Protospacer
****** **************..  

394. spacer 3.3|12366|25|NZ_LNVJ01000023|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcaagggcagtttc	CRISPR spacer
cgtgatcgcgggcaatggcagttct	Protospacer
  ************* *******..

395. spacer 3.3|12366|25|NZ_LNVJ01000023|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcaagggcagtttc	CRISPR spacer
ggagatcgcgggcaagggcagtcat	Protospacer
*  *******************. .

396. spacer 3.3|12366|25|NZ_LNVJ01000023|CRISPRCasFinder matches to MN444870 (Gordonia phage Syleon, complete genome) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcaagggcagtttc	CRISPR spacer
gctgatcgcgggcaagggctacgcc	Protospacer
******************* .. .*

397. spacer 3.3|12366|25|NZ_LNVJ01000023|CRISPRCasFinder matches to MH976515 (Gordonia phage Octobien14, complete genome) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcaagggcagtttc	CRISPR spacer
gctgatcgcgggcaagggctacgcc	Protospacer
******************* .. .*

398. spacer 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder matches to MH727545 (Mycobacterium phage DismalStressor, complete genome) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cgcgatcgcgggcgccgacagcctc	Protospacer
  .******************* .*

399. spacer 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder matches to NC_026598 (Mycobacterium phage Milly, complete genome) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cgcgatcgcgggcgccgacagcctc	Protospacer
  .******************* .*

400. spacer 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder matches to MH834601 (Mycobacterium phage BoostSeason, complete genome) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cgcgatcgcgggcgccgacagcctc	Protospacer
  .******************* .*

401. spacer 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder matches to KX688047 (Mycobacterium phage Marcoliusprime, complete genome) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cgcgatcgcgggcgccgacagcctc	Protospacer
  .******************* .*

402. spacer 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder matches to NC_028759 (Mycobacterium phage Mufasa, complete genome) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cgcgatcgcgggcgccgacagcctc	Protospacer
  .******************* .*

403. spacer 3.5|12462|25|NZ_LNVJ01000023|CRISPRCasFinder matches to MF140408 (Mycobacterium phage DismalFunk, complete genome) position: , mismatch: 5, identity: 0.8

gctgatcgcgggcgccgacagcacc	CRISPR spacer
cgcgatcgcgggcgccgacagcctc	Protospacer
  .******************* .*

404. spacer 1.8|9228|26|NZ_LNVJ01000023|CRT matches to MN585989 (Mycobacterium phage Superchunk, complete genome) position: , mismatch: 6, identity: 0.769

ggccgggtcggacagcgcgttgatcg	CRISPR spacer
gcgtcggtcggacagcgcgttgatgt	Protospacer
*  . *******************  

405. spacer 1.10|9324|26|NZ_LNVJ01000023|CRT matches to LT559120 (Nonomuraea sp. ATCC 39727 isolate nono1 genome assembly, plasmid: III) position: , mismatch: 6, identity: 0.769

cgcacgcaagggcagcgacgtcaccg	CRISPR spacer
gatcggcaagggcagcgacgtcatcg	Protospacer
 ..  ******************.**

406. spacer 1.11|9372|26|NZ_LNVJ01000023|CRT matches to NZ_CP051294 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence) position: , mismatch: 6, identity: 0.769

ggcgggtgccgacagcaccttgatcg	CRISPR spacer
ggcgggtgccgacagcaccccttaca	Protospacer
*******************..   *.

407. spacer 1.11|9372|26|NZ_LNVJ01000023|CRT matches to NZ_CP033363 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence) position: , mismatch: 6, identity: 0.769

ggcgggtgccgacagcaccttgatcg	CRISPR spacer
ggcgggtgccgacagcaccccttaca	Protospacer
*******************..   *.

408. spacer 1.12|9420|26|NZ_LNVJ01000023|CRT matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 6, identity: 0.769

cgctggcggcgaaagctctctcaccg	CRISPR spacer
atgacgcggcgaaagctctcttaccg	Protospacer
     ****************.****

409. spacer 1.12|9420|26|NZ_LNVJ01000023|CRT matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 6, identity: 0.769

cgctggcggcgaaagctctctcaccg	CRISPR spacer
atgacgcggcgaaagctctcttaccg	Protospacer
     ****************.****

410. spacer 1.14|9516|26|NZ_LNVJ01000023|CRT matches to CP000618 (Burkholderia vietnamiensis G4 plasmid pBVIE02, complete sequence) position: , mismatch: 6, identity: 0.769

tgccggtgcggacagcacgctgatcg	CRISPR spacer
gagcggtgcggccagcacgctgatgt	Protospacer
 . ******** ************  

411. spacer 1.15|9564|26|NZ_LNVJ01000023|CRT matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.769

ctcgggcagcgacagctcgctgacag	CRISPR spacer
ttcgggcagcgacagctcgcggcgct	Protospacer
.******************* *    

412. spacer 1.16|9612|26|NZ_LNVJ01000023|CRT matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.769

cgcgcgcaagggcagcgacatcactg	CRISPR spacer
cgcgcgcaagggcatcgacatgttca	Protospacer
************** ******  ...

413. spacer 1.23|9948|26|NZ_LNVJ01000023|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.769

cgccggtgccgacagtacgctgatcg	CRISPR spacer
ggccggtgccgacggtacgctgccgc	Protospacer
 ************.******** .  

414. spacer 1.23|9948|26|NZ_LNVJ01000023|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.769

cgccggtgccgacagtacgctgatcg	CRISPR spacer
ggccggtgccgacggtacgctgccgc	Protospacer
 ************.******** .  

415. spacer 1.23|9948|26|NZ_LNVJ01000023|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.769

cgccggtgccgacagtacgctgatcg	CRISPR spacer
ggccggtgccgacggtacgctgccgc	Protospacer
 ************.******** .  

416. spacer 1.23|9948|26|NZ_LNVJ01000023|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.769

cgccggtgccgacagtacgctgatcg	CRISPR spacer
ggccggtgccgacggtacgctgccgc	Protospacer
 ************.******** .  

417. spacer 1.23|9948|26|NZ_LNVJ01000023|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.769

cgccggtgccgacagtacgctgatcg	CRISPR spacer
ggccggtgccgacggtacgctgccgc	Protospacer
 ************.******** .  

418. spacer 1.25|10044|26|NZ_LNVJ01000023|CRT matches to CP052389 (Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1) position: , mismatch: 6, identity: 0.769

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
actgttcgaaggcagcgacgtcaccg	Protospacer
  ... ********************

419. spacer 1.28|10188|26|NZ_LNVJ01000023|CRT matches to LT559120 (Nonomuraea sp. ATCC 39727 isolate nono1 genome assembly, plasmid: III) position: , mismatch: 6, identity: 0.769

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
gatcggcaagggcagcgacgtcatcg	Protospacer
 ..  ******************.**

420. spacer 1.34|10476|26|NZ_LNVJ01000023|CRT matches to LT559120 (Nonomuraea sp. ATCC 39727 isolate nono1 genome assembly, plasmid: III) position: , mismatch: 6, identity: 0.769

cgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
gatcggcaagggcagcgacgtcatcg	Protospacer
 ..  ******************.**

421. spacer 1.36|10572|26|NZ_LNVJ01000023|CRT matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 6, identity: 0.769

ctcgggcagcgacagttcgctgacgg	CRISPR spacer
gccggccagcgacagttcgctgagct	Protospacer
 .*** *****************   

422. spacer 1.38|10668|26|NZ_LNVJ01000023|CRT matches to NC_016591 (Burkholderia sp. YI23 plasmid byi_2p, complete sequence) position: , mismatch: 6, identity: 0.769

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
atagggcgcggacaccaccttgatga	Protospacer
   *********** ********* .

423. spacer 1.38|10668|26|NZ_LNVJ01000023|CRT matches to CP000617 (Burkholderia vietnamiensis G4 plasmid pBVIE01, complete sequence) position: , mismatch: 6, identity: 0.769

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
atagggcgcggacaccaccttgatga	Protospacer
   *********** ********* .

424. spacer 1.38|10668|26|NZ_LNVJ01000023|CRT matches to KY555147 (Caulobacter phage Ccr34, complete genome) position: , mismatch: 6, identity: 0.769

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
gtcgggcgcggtcagcaccttgacga	Protospacer
  ********* ***********. .

425. spacer 1.38|10668|26|NZ_LNVJ01000023|CRT matches to KY555145 (Caulobacter phage Ccr29, complete genome) position: , mismatch: 6, identity: 0.769

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
gtcgggcgcggtcagcaccttgacga	Protospacer
  ********* ***********. .

426. spacer 1.38|10668|26|NZ_LNVJ01000023|CRT matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 6, identity: 0.769

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
gtcgggcgcggtcagcaccttgacga	Protospacer
  ********* ***********. .

427. spacer 1.38|10668|26|NZ_LNVJ01000023|CRT matches to KY555146 (Caulobacter phage Ccr32, complete genome) position: , mismatch: 6, identity: 0.769

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
gtcgggcgcggtcagcaccttgacga	Protospacer
  ********* ***********. .

428. spacer 1.38|10668|26|NZ_LNVJ01000023|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 6, identity: 0.769

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
gtcgggcgcggtcagcaccttgacga	Protospacer
  ********* ***********. .

429. spacer 1.38|10668|26|NZ_LNVJ01000023|CRT matches to JX163858 (Caulobacter phage phiCbK, complete genome) position: , mismatch: 6, identity: 0.769

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
gtcgggcgcggtcagcaccttgacga	Protospacer
  ********* ***********. .

430. spacer 1.38|10668|26|NZ_LNVJ01000023|CRT matches to KY555142 (Caulobacter phage Ccr10, complete genome) position: , mismatch: 6, identity: 0.769

cgcgggcgcggacagcaccttgatcg	CRISPR spacer
gtcgggcgcggtcagcaccttgacga	Protospacer
  ********* ***********. .

431. spacer 1.40|10764|26|NZ_LNVJ01000023|CRT matches to CP052389 (Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1) position: , mismatch: 6, identity: 0.769

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
actgttcgaaggcagcgacgtcaccg	Protospacer
  ... ********************

432. spacer 1.43|10908|26|NZ_LNVJ01000023|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.769

tgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
. . .**.******************

433. spacer 1.43|10908|26|NZ_LNVJ01000023|CRT matches to LT559120 (Nonomuraea sp. ATCC 39727 isolate nono1 genome assembly, plasmid: III) position: , mismatch: 6, identity: 0.769

tgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
gatcggcaagggcagcgacgtcatcg	Protospacer
 ..  ******************.**

434. spacer 1.43|10908|26|NZ_LNVJ01000023|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 6, identity: 0.769

tgcgcgcaagggcagcgacgtcaccg	CRISPR spacer
cttctgcgagggcagcgacgtcaccg	Protospacer
. . .**.******************

435. spacer 1.48|11148|26|NZ_LNVJ01000023|CRT matches to NZ_CP020717 (Cnuibacter physcomitrellae strain XA(T) plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.769

gtccggcagcgacagctcgctgacgg	CRISPR spacer
caacggcagcgacaactcgctgacca	Protospacer
   ***********.********* .

436. spacer 1.49|11196|26|NZ_LNVJ01000023|CRT matches to CP052389 (Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-1) position: , mismatch: 6, identity: 0.769

cgcacgcgaaggcagcgacgtcaccg	CRISPR spacer
actgttcgaaggcagcgacgtcaccg	Protospacer
  ... ********************

437. spacer 1.52|11340|26|NZ_LNVJ01000023|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.769

ggcacggcagggcagcgacgtcaccg	CRISPR spacer
gttcgtccagggcagcgacgtcaccg	Protospacer
* .    *******************

438. spacer 3.3|12366|25|NZ_LNVJ01000023|CRISPRCasFinder matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 6, identity: 0.76

gctgatcgcgggcaagggcagtttc	CRISPR spacer
cctgatcgcgggcaagggcaaggaa	Protospacer
 *******************.    

439. spacer 3.3|12366|25|NZ_LNVJ01000023|CRISPRCasFinder matches to MT684599 (Gordonia Phage Sephiroth, complete genome) position: , mismatch: 6, identity: 0.76

gctgatcgcgggcaagggcagtttc	CRISPR spacer
gctgatcgcgggcaagggctacgca	Protospacer
******************* .. . 

440. spacer 3.7|12558|25|NZ_LNVJ01000023|CRISPRCasFinder matches to NZ_CP022581 (Gordonia rubripertincta strain CWB2 plasmid pGCWB2, complete sequence) position: , mismatch: 6, identity: 0.76

gctgaccgccggcgacgacagtacg	CRISPR spacer
cctgaccgccggcgacgacacgggc	Protospacer
 *******************  .  

441. spacer 1.4|9036|26|NZ_LNVJ01000023|CRT matches to NZ_CP014599 (Yangia sp. CCB-MM3 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.731

ggcgcaggaaggcagccgtctcacct	CRISPR spacer
agcgcaggaaggcagccgtcgggtaa	Protospacer
.*******************  ..  

442. spacer 1.52|11340|26|NZ_LNVJ01000023|CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 7, identity: 0.731

ggcacggcagggcagcgacgtcaccg	CRISPR spacer
attcatccagggcagcgacgtcaccg	Protospacer
. .    *******************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NZ_LNVJ01000006
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNVJ01000006_1 75569-75712 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
10. NZ_LNVJ01000020
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_LNVJ01000020_1 32193-32439 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
11. NZ_LNVJ01000119
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
12. NZ_LNVJ01000182
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
13. NZ_LNVJ01000034
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 22925 : 46403 29 Siphoviridae_environmental_samples(40.0%) tail,terminase NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_LNVJ01000034.1|WP_058195493.1|24638_25151_+|hypothetical-protein 24638_25151_+ 170 aa aa NA NA NA 22925-46403 yes
14. NZ_LNVJ01000097
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NZ_LNVJ01000097.1|WP_058195519.1|4968_5253_-|hypothetical-protein 4968_5253_- 94 aa aa AcrIC10 NA NA No NA